COVER IS HERE

desy samo

The term ecosystem services was coined to describe the societal benefit that natural ecosystems provide, as well as to raise awareness about biodiversity and ecosystem conservation [...]

Global urbanization creates opportunities and challenges for human well-being and transition towards sustainability. Urban areas are human-environment systems that depend fundamentally on ecosystems, and thus require an understanding of the management of urban ecosystem services to ensure sustainable urban planning. The purpose of this study is to provide a systematic review of urban ecosystems services research, which addresses the combined domain of ecosystem services and urban development. We examined emerging trends and gaps in how urban ecosystem services are conceptualized in peer-reviewed case study literature, including the geographical distribution of research, the development and use of the urban ecosystem services concept, and the involvement of stakeholders. We highlight six challenges aimed at strengthening the concept's potential to facilitate meaningful inter- and transdisciplinary work for ecosystem services research and planning. Achieving a cohesive conceptual approach in the research field will address (i) the need for more extensive spatial and contextual coverage, (ii) continual clarification of definitions, (iii) recognition of limited data transferability, (iv) more comprehensive stakeholder involvement, (v) more integrated research efforts, and (vi) translation of scientific findings into actionable knowledge, feeding information back into planning and management. We conclude with recommendations for conducting further research while incorporating these challenges.

ISBN 978-602-294-097-5 COVER IS HERE The ASEAN European Academic University Network (ASEA-UNINET) was established in 1994 and comprises the following universities in:                  Austria Czech Republic Denmark Germany Greece Indonesia Italy Malaysia Myanmar Netherlands Pakistan (associate member) Philippines Russia Slovakia Spain Thailand Vietnam                   */** University of Innsbruck */** University of Vienna ** University of Graz ** Johannes Kepler University Linz University of Salzburg */** Vienna University of Technology Graz University of Technology * University of Natural Resources and Life Sciences, Vienna ** Vienna University of Economics and Business University of Leoben University of Veterinary Medicine Vienna University of Music and Performing Arts, Vienna Mozarteum University Salzburg ** University of Music and Performing Arts, Graz ** Medical University of Innsbruck Medical University of Graz Medical University of Vienna ** Danube University Krems Czech Republic  Czech Technical University in Prague Denmark  University of Southern Denmark Germany  University of Freiburg Austria  University of Passau Greece  University of Ioannina Indonesia         */** Universitas Gadjah Mada ** Institut Teknologi Sepuluh Nopember (ITS) ** Diponegoro University ** Universitas Indonesia ** Institute of Technology Bandung ** Udayana University ** University of Sumatera Utara ** Airlangga University Italy     ** University of Trento Politecnico di Milano ** Università degli Studi di Genova ** Università degli Studi di Brescia Malaysia      Universiti Putra Malaysia ** University of Malaya Universiti Teknikal Malaysia Melaka (UTeM) National University of Malaysia ** Universiti Utara Malaysia (UUM) Myanmar  Yangon Technological University Netherlands  University of Groningen Pakistan  ** University of Karachi Philippines  ** University of the Philippines, Quezon City Russia  St. Petersburg State Polytechnical University Slovakia  Comenius University Spain  University of Murcia iii Thailand                   Vietnam           */** Chulalongkorn University */** Mahidol University */** Kasetsart University ** King Mongkut's Institute of Technology, Ladkrabang ** King Mongkut's University of Technology, North Bangkok King Mongkut's University of Technology, Thonburi */** Chiang Mai University ** Khon Kaen University ** Mahasarakham University ** Naresuan University ** Prince of Songkla University ** Suranaree University of Technology Silpakorn University ** Srinakharinwirot University ** Thammasat University ** Burapha University ** Ramkhamhaeng University ** Ubon Ratchathani University ** Hanoi University of Science and Technology (HUST) National Economics University (NEU), Hanoi ** University of Transport and Communications (UTC) ** Vietnam National Academy of Music (VNAM) Vietnam National University of Agriculture (VNUA) ** Hanoi University Hue University ** University of Danang * Vietnam National University - Ho Chi Minh City (VNU-HCM) */** University of Medicine and Pharmacy, Ho Chi Minh City * Founder members ** Undersigned universities of the umbrella agreement FOREWORD This proceeding is a collection of papers presented at the Scientific and Plenary Meeting ASEA-UNINET 2016 held in Bukit Jimbaran Campus, Udayana University, Bali, Indonesia from 15th to 18th of February 2016. The committee has accepted 67 papers from 7 countries (Austria 3 papers; England 1 paper; Indonesia 51 papers; the Philippines 2 papers; Poland 1 paper; Vietnam 7 papers; Thailand 1 paper; Laos 1 paper). We would like to extend our big thanks to Rector of Udayana University, Prof. Dr. dr. Ketut Suastika, Sp.PD-KEMD, Vice Rector for Academic Affairs, Prof. Dr. Drh. I Made Damriyasa, MS and Vice Rector for Cooperation and Information Affairs, Prof. Drs. I Made Suastra, Ph.D for their great support on this event. My special thank goes to committees of ASEA-UNINET and Indonesian organizing committee for the excellent collaboration. We would like to express our sincere thankfulness to those who presented their papers at the conference. We also wish to thank the students of Udayana University who have assisted us with the typesetting for the format of the proceedings. More importantly, we express our gratitude to the board of reviewers who have worked hard in reviewing the submitted papers selected for the proceedings. Jimbaran, 15 Februari 2016 The Committee LIST OF INTERNAL AND EXTERNAL REVIEWERS INTERNAL REVIEWERS 1. Dr. Achmad Arifin Nopember Surabaya) 2. Dr. Erma Suryani Nopember Surabaya) 3. Dr. Dra. Ir. Chairani Hanum, M.S 4. Fajar Juang Ekaputra Technology) 5. Prof. Harno Dwi Pranowo Yogyakarta) 6. Prof. Ir. Gamantyo Hendrantono, M.Eng.,Ph.D 7. Prof. Mohamad Isa Irawan Nopember Surabaya) 8. Satya Kumara, Ph.D 9. I Made Andi Arsana, Ph.D Yogyakarta) 10. I Wayan Gede Astawa Karang, PhD 11. Prof.Moch.Amin Alamsjah, Ph.D 12. David Segoh 13. Dr. I Made Netra 14. Dr. Seri Malini 15. Drs.Ketut Tika.,MA 16. Dr. dr. I Putu Gede Adiatmika, M.Kes 17. 18. 19. 20. 21. 22. dr. Ni Nengah Dwi Fatmawati, SP.MK. Ph.D Prof. Dr. dr. Ketut Suastika , Sp.PD-KEMD Agoes Ganesha Rahyuda, PhD I Made Budi Arsika, SH.,LLM Ni Putu Sri Harta Mimba, Ph.D Prof. DR.Ningrum Natasya Sirait, SH.,MLI (Institut Teknologi Sepuluh (Institut Teknologi Sepuluh (University of Sumatera Utara) (Vienna University of (Universitas Gadjah (ITS Surabaya) (Institut Teknologi Mada Sepuluh (Udayana University Bali) (Universitas Gadjah Mada (Udayana University Bali) (Universitas Airlangga) (Universitas Airlangga) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (Udayana University Bali) (University of Sumatera Utara) EXTERNAL REVIEWERS 1. Dr. Christoph A. Hauzenberger 2. Lisa Madlberger 3. Univ.-Prof. Dr. Dietmar Haltrich Life Sciences) 4. Univ.-Prof. Dr. Hartmut Kahlert Life Sciences) 5. Prof. Dr. Erich Schmutzhard 6. Niina Maarit Novak, Bsc. MSc. (University of Graz) (Vienna University of Technology) (University of Natural Resources and (University of Natural Resources and (Medical University of Innsbruck) (Vienna University of Technology) SETTING AND TYPESET I Made Sena Darmasetiyawan, S.S., M.Hum I Made Yoga Dwi Angga COVER I Putu Oka Pradnyana, S.Kom ii ISBN: 978-602-294-097-5 UDAYANA UNIVERSITY PRESS All rights reserved. No part of this book may be reproduced or transmitted in any form or by any means: electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without prior written permission from the writers. iii TABLE OF CONTENT FOREWORD ......................................................................................................... I LIST OF INTERNAL AND EXTERNAL REVIEWERS ................................ II TABLE OF CONTENT ..................................................................................... IV SCIENCE AND TECHNOLOGY........................................................................ I QUANTIFICATION OF ECOSYSTEM SERVICES OF URBAN GREEN SPACES: A TRANSCONTINENTAL CASE STUDY FRAMEWORK ......... 1 Jürgen Breuste ................................................................................................................ 1 Salman Qureshi............................................................................................................... 1 MAJA LEAF EXTRACT (AEGLE MARMELOS) AND SILICA GEL FOR UREA DETECTION BY USING CYCLIC VOLTAMMETRY .................... 20 Yunita Triana ................................................................................................................ 20 Tri Paus Hasiholan Hutapea ........................................................................................ 20 Fredy Kurniawan .......................................................................................................... 20 SLOPE STABILITY MONITORING DURING THE MONSOON PERIOD USING RESISTIVITY MEASUREMENT, WATER CONTENT AND TILTMETER SENSORS (CASE STUDY: NGANTANG – MALANG, EAST JAVA PROVINCE, INDONESIA) .................................................................... 28 Ria Asih Aryani Soemitro.............................................................................................. 28 Dwa Desa Warnana ...................................................................................................... 28 SYNTHESIS OF GALACTO- AND HETERO-OLIGOSACCHARIDES BY BIFIDOBACTERIAL Β-GALACTOSIDASES ............................................... 36 Sheryl Lozel Arreola ..................................................................................................... 36 Thu-Ha Nguyen ............................................................................................................. 36 Dietmar Haltrich........................................................................................................... 36 CONSISTENCY ANALYSIS OF MAPPING SYSTEM OF NOISE SPECTRAL FLUCTUATIONS IN MULTI-FREQUENCY USING TWODIMENSION DISCRETE WAVELET TRANSFORM (2D-DWT)............... 48 Melinda ......................................................................................................................... 48 Agus Santoso Tamsir..................................................................................................... 48 Dadang Gunawan ......................................................................................................... 48 Dodi Sudiana ................................................................................................................ 48 Yuwaldi Away ............................................................................................................... 48 A SEQUENTIAL HYPOTHESIS TESTING OF MULTIMODAL CARDIAC ANALYSIS ........................................................................................................... 63 Nada Fitrieyatul Hikmah .............................................................................................. 63 Achmad Arifin ............................................................................................................... 63 iv Tri Arief Sardjono......................................................................................................... 63 Eko Agus Suprayitno .................................................................................................... 63 AN EXPLORATION OF MENDELEY READER AND GOOGLE SCHOLAR CITATIONS ................................................................................... 78 Adian Fatchur Rochim ................................................................................................. 78 Riri Fitri Sari ................................................................................................................ 78 TOWARDS SURABAYA AS AN OPEN DATA CITY ................................ 86 Nur Aini Rakhmawati ................................................................................................ 86 Irmasari Hafidz .......................................................................................................... 86 Renny Pradina K. ....................................................................................................... 86 Radityo Prasetiyanto W ........................................................................................... 86 ADAPTIVE AND MULTI-CHANNEL ACCESS OF LEARNING OBJECTS RETRIEVAL SYSTEM TO FACILITATE PERSONALIZED LEARNING: CASE STUDY INDONESIA OPEN EDUCATIONAL RESOURCES (I-OER) ............................................................................................................................... 92 Harry B. Santoso .......................................................................................................... 92 Zainal A. Hasibuan....................................................................................................... 92 AN EVALUATION OF SOME FIREFLY-INSPIRED SYNCHRONICITY METHODS IN WIRELESS SENSOR NETWORKS ................................... 102 Misbahuddin ............................................................................................................... 102 Riri Fitri Sari .............................................................................................................. 102 AN SDR-BASED TESTBED FOR EVALUATION OF RADAR WAVEFORMS FOR VARIOUS RADAR APPLICATIONS ...................... 110 Gamantyo Hendrantoro.............................................................................................. 110 Prasetiyono Hari Mukti .............................................................................................. 110 Puji Handayani........................................................................................................... 110 Devy Kuswidiastuti ..................................................................................................... 110 ASSESSING ADAPTABILITY IN OLD BUILDINGS ................................ 116 Tanti S.R. Nasution ..................................................................................................... 116 Kirami Bararatin ........................................................................................................ 116 Susetyo Firmaningtyas ............................................................................................... 116 CLASSICAL OPTIMIZATION METHODS FOR WATER RESOURCES MANAGEMENT .............................................................................................. 129 Nadjadji Anwar .......................................................................................................... 129 Nastasia Festy Margini .............................................................................................. 129 Danayanti Azmi Dewi ................................................................................................. 129 Saptarita Kusumawati ................................................................................................ 129 v COAL PREPARATION USING DENSE MEDIUM CYCLONE TECHNOLOGY ................................................................................................ 141 Retno Aita Diantari ..................................................................................................... 141 Isworo Pujotomo ......................................................................................................... 141 DESIGN AND SIMULATION OF MEMS CAPACITIVE PRESSURE SENSOR USED IN BLOOD PRESSURE MONITOR .................................. 153 Diem N. Ho ................................................................................................................. 153 Hanh-Dang Ngoc ........................................................................................................ 153 PCR USING HYPERSENSITIVE REACTION AND PATHOGENICITY SPECIFIC PRIMER PAIR OF SEVERAL INFECTED HORTICULTURAL PLANTS ............................................................................................................. 163 Retno Kawuri .............................................................................................................. 163 Made Pharmawati....................................................................................................... 163 GROWTH HORMONE GENE POLYMORPHISM OF BALI CATTLE AT VILLAGE BREEDING CENTRE, NUSA PENIDA...................................... 169 Besung INK ................................................................................................................. 169 Suwiti NK .................................................................................................................... 169 Yulita H ....................................................................................................................... 169 Suardana IW ............................................................................................................... 169 Watiniasih NL ............................................................................................................. 169 Yowani C ..................................................................................................................... 169 POTENTIAL OF STREPTOMYCES SP. IN THE RHIZOSPHERE OF PLANTS ZINGIBERACEAE IN INHIBITING MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII ................................................................... 176 Ni kadek Losiani ......................................................................................................... 176 Retno Kawuri .............................................................................................................. 176 Ketut Darmadi ............................................................................................................ 176 POTENTIAL BACILLUS SP. AS BIOCONTROL AGENT OF BACTERIAL WILT RALSTONIA SOLANACEARUM IN VITRO ..................................... 183 Diah Kharismawati Djereng ....................................................................................... 183 Retno Kawuri .............................................................................................................. 183 Yan Ramona ................................................................................................................ 183 EFFECT OF EXPLANT TYPES AND PLANT GROWTH REGULATORS IN IN-VITRO CULTURE OF PINANGA ARINASAE ................................. 188 Made Pharmawati....................................................................................................... 188 I Made Anom Sutrisna Wijaya .................................................................................... 188 IN SEARCH FOR JATROPHA CURCAS L. GENOTYPES SUITABLE FOR DRY LAND AREAS .......................................................................................... 193 vi Ida Ayu Astarini.......................................................................................................... 193 Made Pharmawati ...................................................................................................... 193 Edi Purlani ................................................................................................................. 193 Bambang Heliyanto .................................................................................................... 193 DISTRIBUTED CYBER PHYSICAL SYSTEMS ......................................... 202 Albert Treytl ............................................................................................................... 202 MARITIME AFFAIRS .................................................................................... 203 REVITALIZATION OF FISHERMAN SOCIAL INSTITUTION IN THE SUSTAINABLE COASTAL MANAGEMENT ............................................. 204 R. Hamdani Harahap ................................................................................................. 204 LAW ENFORCEMENT AGAINST ILLEGAL, UNREPORTED AND UNREGULATED (IUU FISHING) IN INDONESIAN EXCLUSIVE ECONOMIC ZONE ......................................................................................... 214 Eka Martiana Wulansari ............................................................................................ 214 EFFICIENCY OF BIODIESEL PRODUCTION FROM WASTE TUNA OIL (THUNNUS SP.), SEAWEED KAPPAPHYCUS ALVAREZII AND GRACILARIA SP. ............................................................................................. 235 Mochammad Amin Alamsjah ...................................................................................... 235 Annur Ahadi Abdillah ................................................................................................. 235 Hutami Mustikawati ................................................................................................... 235 Suci Dwi Purnawa Atari ............................................................................................. 235 MAIN CHALLENGES FOR INDONESIA TO BECOME MARITIME FULCRUM ........................................................................................................ 249 Professor Melda Kamil Ariadno ................................................................................ 249 EU “YELLOW CARD” CRISIS AND ITS EFFECT ON THAI FISHERIES ............................................................................................................................. 266 Assistant Professor Charit Tingsabadh, Ph.D............................................................ 266 QUORUM SENSING INHIBITION AS AN ALTERNATIVE METHOD TO PROTECT PRAWN LARVAE FROM BACTERIAL INFECTION.......... 277 Pande Gde Sasmita J. ................................................................................................. 277 GROWTH AND MOTILITY OF CORAL`S DINOFLAGELLATE ENDOSYMBIONT SYMBIODINIUM SP. AT ELEVATED TEMPERATURES ........................................................................................... 285 Widiastuti Karim ........................................................................................................ 285 Michio Hidaka ............................................................................................................ 285 Statistical analysis...................................................................................................... 288 Photochemical efficiency of PSII of Symbiodinium cells ........................................ 288 vii THE ENSO SIGNAL ANALYSIS OF INDONESIAN SEAS BASED ON EIGHTEEN YEAR SATELLITE REMOTE SENSING DATASET........... 295 I Dewa Nyoman Nurweda Putra ................................................................................. 295 Tasuku Tanaka ............................................................................................................ 295 HUMANITIES, CULTURE AND MUSIC ..................................................... 303 CLIMATE ADAPTATION AND MITIGATION OF MAJAPAHIT’S HOUSING 13TH – 16TH CENTURY IN EAST JAVA ............................... 304 Yosafat Winarto* ........................................................................................................ 304 Happy Ratna Santosa.................................................................................................. 304 Sri Nastiti Nugrahani Ekasiwi .................................................................................... 304 SMALL-SCALE HOUSING DEVELOPMENTS AND THEIR IMPLICATIONS ON THE DEVELOPMENT OF URBAN INFRASTRUCTURE AND FACILITIES ...................................................... 317 Ispurwono Soemarno .................................................................................................. 317 Purwanita Setijanti ..................................................................................................... 317 Endy Yudho Prasetyo .................................................................................................. 317 KAMPUNG INNOVASION IN SUPPORT OF SMART CITY .................... 333 Happy Ratna Santosa.................................................................................................. 333 Johan Silas .................................................................................................................. 333 Purwanita Setijanti ..................................................................................................... 333 Rita Ernawati .............................................................................................................. 333 FORMULATING LOCAL MEASUREMENT FOR SMART SETTLEMENT IN INDONESIA ................................................................................................. 340 Purwanita Setijanti ..................................................................................................... 340 Johan Silas .................................................................................................................. 340 Rita Ernawati .............................................................................................................. 340 OVERVIEW ON ALLEY OF KAMPUNG AS SHARED-PLACE BASED ON THE INHABITANT RELATIONSHIP REFERENCES IN KAMPUNG OF SURABAYA ....................................................................................................... 351 Andarita Rolalisasi ..................................................................................................... 351 Happy Ratna Santosa.................................................................................................. 351 Ispurwono Soemarno .................................................................................................. 351 I-POP: MIMICKING K-POP AS THE ‘NEW’ GLOBAL ............................ 358 S.M.Gietty Tambunan ................................................................................................. 358 COULD TOLERANCE BE THE PROBLEM’S SOLUTION? .................... 373 Dewi Sikiani ................................................................................................................ 373 Eunike E. Hiandarto ................................................................................................... 373 viii Hutri Dhara Sasmita .................................................................................................. 373 Yohanes K. Herdiyanto............................................................................................... 373 David Hizkia Tobing................................................................................................... 373 CONTINUITIES AND CHANGES NORTH SUMATRAN PERFORMING ARTS .................................................................................................................. 381 Muhammad Takari ..................................................................................................... 381 HEALTH, PHARMACY AND MEDICINE .................................................. 394 DEVELOPMENT OF STANDARDIZED ETHANOL EXTRACT AND PRODUCTION OF HERBAL MEDICINE IN UNIVERSITAS AIRLANGGA ............................................................................................................................. 395 Sukardiman ................................................................................................................. 395 Herra Studiawan ........................................................................................................ 395 Lusiana Arifianti......................................................................................................... 395 Rakhmawati ................................................................................................................ 395 IS THERE ANY IMPACT OF VDR GENE POLYMORPHISM APAI,FOKI AND BSMI IN BATAKS ETHNIC TO HAVE TUBERCULOSIS AND COULD VITAMIN D ALLEVIATE THIS INFECTION ? ......................... 416 Yahwardiah Siregar.................................................................................................... 416 Bintang YM Sinaga ..................................................................................................... 416 UNRECOGNIZED MANAGEMENT OF DISORDERS OF SEX DEVELOPMENT IN INDONESIA: PUBLIC HEALTH PERSPECTIVE 427 Sultana MH Faradz .................................................................................................... 427 A. Zulfa Juniarto......................................................................................................... 427 ASSOCIATION OF SRD5A2 GENE POLYMORPHISM AND INDONESIAN ISOLATED HYPOSPADIAS PATIENTS ..................................................... 433 Nura Eky Vikawati...................................................................................................... 433 Ardy Santosa............................................................................................................... 433 Ahmad Zulfa Juniarto ................................................................................................. 433 Sultana MH Faradz* ................................................................................................... 433 PUBLIC HEALTH AWARENESS IN INTELLECTUAL DISABILITY FOCUS ON FRAGILE X SYNDROME: A COHORT STUDY IN INDONESIA ...................................................................................................... 444 Tri Indah Winarni* ..................................................................................................... 444 Farmaditya EP Mundhofir ......................................................................................... 444 Sultana MH Faradz .................................................................................................... 444 ANTIMICROBIAL ACTIVITY AND STRUCTURAL CHARACTERIZATION OF LIPOPEPTIDE PRODUCED BY BACILLUS AMYLOLIQUEFACIENS MD4-12 .................................................................. 453 ix Pratiwi Pudjilestari Sudarmono ................................................................................. 453 Ahmad Wibisana ......................................................................................................... 453 T. Mirawati Sudiro ...................................................................................................... 453 Wahono Sumaryono .................................................................................................... 453 DIFFERENTIATION POTENTIAL OF AMNION MEMBRANE AND DENTAL PULP DERIVED MESENCHYMAL STEM CELL TO GENERATE NEURON INDUCED WITH EGF, FGF, PDGF AND FORSKOLIN ..................................................................................................... 466 1,2 Fedik Abdul Rantam, 1,4Ferdiansyah, 1,3Purwati, 1Candra Bumi., 1Helen Susilowati., Eryk Hendrianto, 1,4Dwi Novembri Utomo, 1,4Heri Suroto, 1,5Rosy Setiawati, 6Nike Hendrijantini, 7Rimayanti ........................................................................................... 466 1 YOGYAHEALTH - A COLLABORATIVE PROJECT IN YOGYAKARTA, INDONESIA, FOUNDED UNDER THE UMBRELLA OF ASEA-UNINET AND RUNNING SUCCESSFULLY FOR OVER 7 YEARS. ....................... 476 Matthias A. Lechner and The Yogyahealth Collaborative Team ................................ 476 ECONOMIC AND SOCIAL SCIENCES ....................................................... 482 THINK GLOBALLY AND ACT LOCALLY (THE ALTERNATIF TO ENHANCE LOCAL BUSINESS PERFORMANCE,TOWARDS A GLOBAL BUSINESS)......................................................................................................... 483 Prihatin Lumbanraja .................................................................................................. 483 THE CAPACITY TO COPE WITH CLIMATE CHANGE OF COASTAL AGRICULTURE HOUSEHOLDS: A CASE STUDY IN THE RED RIVER DELTA, VIETNAM .......................................................................................... 492 Nguyen Dang Khoa ..................................................................................................... 492 Nguyen Huyen Trang .................................................................................................. 492 HOUSING PREFERENCE OF EDUCATIONAL BACKGROUND .......... 505 Anita Dianingrum ....................................................................................................... 505 Arlita Widyasari .......................................................................................................... 505 Muhamad Faqih .......................................................................................................... 505 Arina Hayati4 .............................................................................................................. 505 BUDGET DEFICITS IN VIETNAM – FROM TARGET ECONOMIC “QUADRANGLE” TO “PENTAGON” .......................................................... 516 Hoang Thi Lan Huong ................................................................................................ 516 DOES INFORMATION DISCLOSURE AND TRANSPARENCY MATTER TO PERFORMANCE OF LISTED FIRMS IN VIETNAM? ....................... 533 Le Quang Canh ........................................................................................................... 533 Nguyen Vu Hung ......................................................................................................... 533 SERVICE E-MARKETPLACE PLATFORM FOR SENIOR CITIZENS . 545 Leszek A. Maciaszek.................................................................................................... 545 x HOUSING PREFERENCE FOR LOW-INCOME PEOPLE IN INDONESIA ............................................................................................................................. 556 Desy Rahmadaniyati ................................................................................................... 556 Muhammad Faqih ...................................................................................................... 556 Arina Hayati ............................................................................................................... 556 THE HOUSING PREFERENCE OF THE URBAN MIDDLE CLASS SOCIETY IN SURABAYA, INDONESIA ..................................................... 568 Emiria Letfiani ........................................................................................................... 568 Andarita Rolalisasi ..................................................................................................... 568 Muhammad Faqih ...................................................................................................... 568 Arina Hayati ............................................................................................................... 568 THE EUROPEAN UNION CONTEMPORARY RAPPROACHMENT TO ASIA PACIFIC COUNTRIES......................................................................... 575 Evi Fitriani ................................................................................................................. 575 FIRST-GENERATION VS SECOND-GENERATION COLLEGE STUDENTS: THEIR ACADEMIC SELF-EFFICACY AND COLLEGE ADJUSTMENT ................................................................................................. 588 Tjut Rifameutia ........................................................................................................... 588 Elok D. Malay............................................................................................................. 588 RISKS IN REAL ESTATE VALUATION OF STATE BANKS IN VIETNAM ............................................................................................................................. 604 Minh Ngoc, Nguyen .................................................................................................... 604 PERSONAL TRAITS OF LEADER IN SELECTED ENTERPRISES IN VIETNAM ......................................................................................................... 613 Luong Thu HA ............................................................................................................ 613 IMPACT OF CORPORATE GOVERNANCE ON FIRM PERFORMANCE EVIDENCE IN VIETNAM .............................................................................. 628 Dao Thanh Tung ......................................................................................................... 628 THE BILATERAL REAL EXCHANGE RATE AND THE CHINESE FOREIGN DIRECT INVESTMENT IN THE LAO PDR ............................ 641 Houmlack Mingboubpha ............................................................................................ 641 Sengsathit Vichitlasy .................................................................................................. 641 THROUGH A GENDER LENS: THE BANGSAMORO POLITICAL PARTIES IN MINDANAO, PHILIPPINES .................................................. 651 Rosalie Arcala Hall .................................................................................................... 651 THE DYNAMICS TRI NING TRI ECOTOURISM IN BALI PROBLEMS AND STRATEGIES IN THE DEVELOPMENT OF THREE ECOTOURISM TYPES IN BALI ............................................................................................... 663 xi I Nyoman Sukma Arida ............................................................................................... 663 ............................................................................................................................. 675 xii SCIENCE AND TECHNOLOGY QUANTIFICATION OF ECOSYSTEM SERVICES OF URBAN GREEN SPACES: A TRANSCONTINENTAL CASE STUDY FRAMEWORK Jürgen Breuste juergen.breuste@sbg.ac.at Research Group for Urban and Landscape Ecology, Department of Geography and Geology, University of Salzburg, Hellbrunnerstrasse 34, Salzburg 5020, Austria Salman Qureshi salmanqureshi@uok.edu.pk School of Architecture, Birmingham City University, Gosta Green, Birmingham B4 7DX, UK Institute of Geography, Humboldt University of Berlin, Rudower Chaussee 16, D-12489 Berlin, Germany 1 INTRODUCTION Ecosystem services are the benefits people obtain from ecosystems, which the Millennium Ecosystem Assessment describes as provisioning, regulating, supporting, and cultural services (Millennium Ecosystem Assessment, 2003). These include provisioning services such as food and water; regulating services such as regulation of floods, drought, land degradation, and disease; supporting services such as soil formation and nutrient cycling; and cultural services such as recreational, spiritual, religious and other non-material benefits. The ecosystem services concept helps to place value on ecological functions, often to the direct benefit of human populations in terms of physical health, or in economic or social terms (Ahern, 2007). Costanza et al. (1997) identified 17 major categories of services provided by varying types of ecosystems. The changes in urban ecosystems affect not only humans but countless other species as well (Grimm et al., 2008). The degradation of ecosystem services has many causes, including excessive demand for ecosystem services stemming from economic growth, demographic changes, and individual choices at planning and management level. In recent decades the world has witnessed not only dramatic changes to bio-physical ecosystems, but equally profound changes to social systems that shape both the pressures on ecosystems and the opportunities to respond. The Millennium Ecosystem Assessment was carried out between 2001 and 2005 to assess the consequences of ecosystem change on human well-being and to establish the scientific basis for actions needed to enhance the conservation and sustainable use of ecosystems and their contributions to human wellbeing that lies in cities; ecosystem services in urban landscapes were identified with their potential, constraints and implications. Urban green is referred to as the major ecosystem services provider (Jim & Chen, 2009; Tratalos et al., 2007). However, there have been few empirical investigations into its site-based relevance to human health and social well-being and this is considered to be required urgently (Ashton, 2002; Qureshi et al., 2010b). For the majority of people cities are the most important providers of ecosystem services. In reality only small parts, specific ecosystems, of them provide these services. Bolund & Hunhammar (1999) highlighted seven ecosystems (viz. street trees, lawns/parks, Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 1 2 | Asea Uninet Scientific and Plenary Meeting 2016 urban forests, cultivated land, wetlands, lakes/sea, and streams) and the six major services (viz. air filtration, microclimate regulation, noise reduction, rainwater drainage, sewage treatment, and recreational and cultural values) that these ecosystems provide in urban system as a larger whole. The specific site related ecosystem services provided by urban green, the main provider of urban ecosystem services, need to be calculated quantitatively and included in urban design and planning. 2 ECOSYSTEM SERVICES ON THE SITE LEVEL - TYPOLOGY OF ECOSYSTEM SERVICES BY URBAN GREEN 2.1 2.1 Urban Structural Units Urban ecosystems are designed by land use and characterized by land cover (e.g. Breuste et al. 1998). Spatial planning and regulations, which influence the spatial pattern and intensity of land use, influence ecosystem services of urban ecosystems (e.g. Alberti, 2008; Breuste, 2009; Pauleit & Breuste, 2011). Urban structural units (USU) describe the morphology of urban areas. They are a composition of built-up and green elements creating a pattern of “urban structures” as providers of more or fewer ecosystem services. Green areas are the most important providers (besides lakes, streams and rivers). The quantity of green space in urban structural units influences the quantity of ecosystem services. Some urban structural units are dominated by ornamental vegetation, e.g. parks and allotments. In others the vegetation is an additional decorative element (e.g. residential areas) (Tab. 1). The balance between built-up and paved (i.e. non-providing) spaces on the one hand and vegetated surfaces (providing spaces) on the other hand, can be important to determine the degree of ecosystem services (Pauleit & Breuste, 2011). A maximum of provision of ecosystem service is given by larger (public) green areas. Table 1 Typical urban structural units in Leipzig, Germany (Breuste, 2009) Old villa areas City centre Land use Residential Residential plus commercial and offices Urban Structur al Unit type Single houses Compact building blocks Building cover 20 – 30% More than 70% Asea Uninet Scientific and Plenary Meeting 2016 Open space characte r Small open spaces in courtyards, some squares, streets Extended open spaces Vegetatio n High vegetation cover, esp. tree characte cover r Almost no vegetation cover Cover of sealed surfaces Above 90% 2.2 Below 40% |3 Urban Green Urban green as the main provider of ecosystem services in cities consists of different green elements (patches) e.g. single trees in streets and gardens, tree covers of different layers, lawns and grass, bushes and shrubs, flowerbeds and ornamental plant arrangements etc. in different ownership. These ‘basic units’ are parts of multi-structural green areas e.g. green corridors that follow transportation networks, parks and gardens, natural wild spaces, urban forest and community woodlands, cemeteries, allotments, playing fields and playgrounds, derelict and despoiled vacant land, or, to a lesser extent, of built-up urban structural units. In public green spaces many people can benefit from ecosystem services because of their accessibility. However, quantitatively residential areas are the biggest ecosystem service provider with their larger green areas. Loram et al., 2007 showed for five British cities that private domestic gardens covered between 21.8% and 26.8% of the whole urban area. Large differences in tree and shrub cover set the urban structural units apart from each other (e.g. Pauleit & Duhme, 2000; Gill et al., 2007). The tree and shrub cover ranges from a minimum of 4% to a maximum of 55% for US-cities (Nowak et al., 1996). The green patches of open spaces within urban areas range from vegetation remnants of the original natural landscape (mainly woods and wetlands), vegetation of the agricultural cultural landscapes (e.g. meadows and arable land), ornamental, horticultural and designed urban vegetation spaces (parks and gardens) to spontaneous urban vegetation (brownfields and derelict land). These four main groups of vegetation cover are results of different land uses and intensities of utilisation and maintenance. They fulfil different ecosystem services and provide potential for even more (Pauleit & Breuste, 2011) (Tab. 2). Table 2 Ecosystem services of urban green Kowarik, 1992, Bolund and Hunhammar, 1999, modified Vegetation Group Vegetation structure type Main existing Main potential Ecosystem Services ecosystem services A) Vegetation remnants of the original natural landscape Woods and forests Wetlands Timber production, recreation, biodiversity, micro-climate regulation, rainwater drainage, sewage treatment Nature experience 4 | Asea Uninet Scientific and Plenary Meeting 2016 B) Vegetation of Meadows, pastures, the cultural drifts, dry grasslands landscapes arable land formed by agriculture C) Ornamental, horticultural and designed urban vegetation spaces Recreation, biodiversity, nature experience Decorative green Decoration, cultural (flower beds, small values lawn patches, bushes, hedges, etc.) Biodiversity, rainwater drainage Accompanied green along traffic lines or as addition to fill up the space between apartment blocks Air filtering, microclimate regulation, rainwater drainage Recreation, biodiversity Recreation, microclimate regulation, Air filtering, Biodiversity, , microclimate regulation Biodiversity, nature experience, learning about nature Biodiversity, learning about nature, nature experience, recreation Gardens/parks Allotment gardens Urban trees D) Spontaneous Spontaneous urban vegetation herbaceous bush and spaces pre-forest vegetation 2.3 Food production, , micro-climate regulation, rainwater drainage Ecosystem services Bolund & Hunhammar (1999) named six ecosystem services relevant for their investigations in Stockholm: air filtering, microclimate regulation, noise reduction, rainwater drainage, sewage treatment, recreation/cultural values. Water supply, landscape (aesthetical value), sense of identity and provision of land for economic and commercial activities and housing can be added. They also combine the ecosystem services with quality of life indicators (Tab. 3). Table 3 Services and indicators of quality of life related to the dimensions of sustainability (according to Millennium Ecosystem Assessment, 2005 and Santos & Martins, 2007, changed) Sustainability dimension Urban Ecosystem Service Quality of life indicator Ecology Air filtration Climate regulation Noise reduction Rain water drainage Water supply Waste water treatment Food production Landscape Recreation Cultural values Sense of identity Health (clean air, protection against respiratory diseases, protection against heat and cold death) Safety Drinking water Food Beauty of the environment Recreation and stress reduction Intellectual endowment Social sphere Asea Uninet Scientific and Plenary Meeting 2016 Health Provision of land for economic and commercial activities and housing Economy |5 Communication Place to live Accessibility Income According to the Millennium Ecosystem Assessment, 2005), Costanza et al. (1997), McDonald 2009, Schetke et al. (2010) four categories of urban ecosystem services can be defined:     Provisioning services (food, timber, water supply, the provision of genetic resources and biodiversity), Regulating services (regulation of climate extremes such as heavy rainfall and heat waves, floods, diseases, regulation of water flows, treatment and handling of waste), Cultural services (recreation, provision of aesthetic features, spiritual requirements, nature experience and education) and, finally, Supporting services (soil formation and processes, pollination or energy, matter and nutrient fluxes). Four ecosystem services are important for public urban green spaces: biodiversity, climate regulation, recreation, and nature experience. 2.3.2 Climate regulation In particular, urban green spaces help to regulate extreme day and night time temperatures by shading, evapotranspiration and lower surface emissivity and by increasing air moisture content (Chiesura, 2004; Chang et al., 2007). This service is becoming particularly important because of the soon expected challenges of climate change for cities. A range of studies has been carried out to measure the temperature reduction potential and performance of urban green spaces by evapotranspiration and shading (e.g. Gill et al., 2007; Jim & Chen, 2006; Tratalos et al., 2007). Temperature and other climate elements can be measured at shaded and nonshaded places in a representative range of urban park situations using temperature loggers. Using an urban tree GIS-data layer the shading potential of urban parks can be extrapolated to a bigger area, e.g. the whole city. The regional GIS mapping could help to identify the hotspots and major locations to derive these climatic services. The urban heat island concept could help to identify those locations which are suppressed by intensive urbanization and an increase in temperature (Chen et al., 2006; Hahn et al., 2009) where an image-based and GIS approach could help substantially (Dousset & Gourmelon, 2003; Weng, 2001). Those locations should be the primary focus of the service provision (Bowler et al., 2010). 2.3.3 Biodiversity Urban green is the most important habitat for plants and animals in the cities. In comparison to rural degradation of biodiversity, urban biodiversity becomes more and more important. The reasons are the small scale urban space, the occurrence of a variety of different natural elements and the very varying degrees of disturbances. Urban green spaces are core areas of urban biodiversity. There a several new studies on this subject (see Müller et al., 2010; Werner & Zahner, 2009) and urban biodiversity initiatives (The Curitiba declarations 2007 6 | Asea Uninet Scientific and Plenary Meeting 2016 and 2010, The Singapore Index on Cities' Biodiversity, The Nagoya declaration URBIO 2010). The qualification and quantification of this service can be investigated by the evaluation of site equipment, structured observations (e.g. fauna) and mapping (e.g. flora). Breeding bird or bird maps or atlases are available in many cities (e.g. Biadun, 1994). They are a possible tool to indicate biodiversity on the site level. 2.3.4 Nature experience Green spaces provide a public space and, equipped with natural elements, provide an excellent possibility for urban dwellers to experience nature. The nature provided is a specific one and mostly planted and designed; for most of the residents the nearest and often the only nature they can reach and frequently visit. Their nature experiences will be dominated by this form of nature. Urban nature experience is becoming more and more important (Yli-Pelkonen & Niemelä, 2005; Breuste, 2009). These areas provide contact for urban residents to different common and typical urban species and elements of nature. The nature experience service of public open green spaces      is , for a large section of the urban population, the only possibility to come in contact to nature, cannot be easily replaced by other areas outside the city, consists of different forms of contact to nature (visual, physical, mental etc.), is always connected with special natural elements and their arrangement and can be part of daily urban life. Nature experience can be investigated, measured and evaluated by questioning and observing visitors of urban green and partly by assessment of the natural elements of the site. 2.3.5 Recreation Green spaces provide a public social space in a natural surrounding for recreation. This ecosystem service is that which is most often investigated and definitely one of the most requested and needed by urban dwellers. The recreational service of public open green spaces        is important for a large part of the urban population, may be the only option for people living in less green residential areas, cannot be replaced by other areas, supports social activities depending on time, frequency and kind from age, sex, social status, cultural background and societal norms, consists of different activities, is always connected with nature, is part of daily urban life Recreation consists of different activities such as walking, cycling, sports, resting etc. These activities can be investigated in many different types of parks (e.g. Chiesura, 2004; Li et al., 2005; Jim & Chen, 2006). Recreation is generally not limited by age, nationality and socioeconomic status, as there is an overall need for everyone (Matsuoka & Kaplan, 2008). Asea Uninet Scientific and Plenary Meeting 2016 |7 There is a range of studies on analysing and measuring the recreation function by questioning, observation, counting of visitors, evaluation of recreational facilities etc. (e.g. Chiesura, 2004; Li et al, 2005; Jim & Chen, 2006). 3 METHODOLOGY - EVALUATION OF ECOSYSTEM SERVICES IN FOUR CITIES Four case studies, each related to a different ecosystem service, have been selected to quantify ecosystem services at the site level. The case studies are original research studies of the authors or were supervised by them (Czermak, 2008; Stern, 2010) through project work. They are located in different cities of different size on three continents. The selected ecosystem services are:     3.1 climate regulation, biodiversity, nature experience, and recreation, Climate regulation: Karachi metropolitan area has experienced a tremendous population growth (currently having about 18 million inhabitants) and urban sprawl (3,527 km2), resulting not only in long commuting distances for urban dwellers but also in an increased burden on natural resources (Qureshi, 2010). The vegetation cover of the natural resources is being replaced largely by built-up land for residential and commercial purposes (Qureshi et al., 2010b). There is thus a dire need to monitor these changes in vegetation and built-up cover and compare this with the measured thermal conditions. In this study satellite images were used to derive the land-use/land-cover changes of Karachi (Qureshi et al., 2010b). A time series of Landsat TM images were used for the years 1986-2003. Multi-temporal images were processed for radiometric and geometric errors to evaluate the land use and land cover (LULC) changes. This helped identify the major areas of changes at local level. Furthermore, this method helped to identify the neighborhoods (local level) of very unique character as defined by Qureshi & Breuste (2010). Therein the green spaces had been surveyed to observe the possible relationships among different land uses and microclimatic conditions (thermal comfort in this case). Concurrently a trend analysis of the mean annual temperature (MAT) was conducted of air temperature data for the time series of the years 1961–2009 (Computerize Data Processing Center, Pakistan Meteorological Department, Government of Pakistan). The average of five different locations in Karachi was provided and used in this study. 3.2 Biodiversity: In a study in Linz (Austria, 190,000 inhabitants) all 19 public parks bigger than one hectare were investigated for their biodiversity service on the basis of breeding birds as indicators, documented in the Breeding Bird Atlas of Linz (Weissmair et al., 2000-2001). Birds are good biodiversity indicators and react very sensitively to different environmental qualities. For Linz 122 different species of birds are listed, 102 of them could be counted as breeding birds. 20 species were classified as non-breeding (passing and food seeking). The bird species number marks the observed bird in the areas. The breeding status of the green space can be defined with three breeding categories: BS 1 = Breeding possible, BS2 = Breeding probable and BS 3 = Breeding proven. Every observed species is given a 8 | Asea Uninet Scientific and Plenary Meeting 2016 breeding status. The summary of the 3 breeding category numbers per species gives a quantification of the bird breeding importance of the park. BS 1 15 e. g. means 15 breeding species possible. Species numbers in category BS 3 are multiplied with a factor of 3, in category BS 2 with a factor of 2 to weight proved breeding and probable breeding more than the possible breeding status. The summary of the three breeding statuses provides a breeding number. 3.3 Nature experience One of the most dynamic urban green developments worldwide is occurring in Shanghai (China). Between 1978 and 2006 the city extended its green area from 761 to 30,609 ha. The area of public parks increased during this time from 309 ha to 1529 ha. For the majority of the urban dwellers the public parks are the only possibility for any contact and experiences with nature. They are essential for this ecosystem function. In a study in Changning district of Shanghai (China) (614,200 inhabitants 2006)the nature experience function of three public parks was investigated by Stern (2010). In the three public parks, Zhongshan, Kai Qiao and Tianshan, the function of nature experience was investigated by questioning 322 visitors of all age groups (Zhongshan park 118, Kai Qiao park 103and Tianshan park 101) (Stern, 2010). 3.4 Recreation In a study in Buenos Aires (Argentina) five urban parks were investigated to evaluate the recreational function of the areas. 500 visitors were questioned about their recreational behavior to qualify and quantify the recreational function of the green spaces. The parks Parque Micaela Bastidas, Parque Presidente Nicolas Avellaneda, Parque General Las Heras, Parque Brigadier Cornelio de Saavedra, Parque del Centenario are typical neighborhood parks of medium size (4-10 ha) in the central district of Buenos Aires ina middle class areas. They are established with lawns, trees, bushes and playgrounds. Excluding Parque Micaela Bastidasall parks are located in highly populated areas (14.000 – 16.000 inhabitants/km2) with high recreation demand. 4 RESULTS 4.1 Climate regulation There is a declining trend in the urban green of the city (Qureshi et al., 2010b) (Fig. 1). The built-up land has increased from 104 km2 to 200 km2, whereas the overall green cover has been reduced from 111 km2 to 75 km2. Furthermore, urban development has taken over more than 50 km2 of the open spaces in and around Karachi. However, the temperature trend suggests that the temperature has increased up to 4° C in Karachi (Sajjad et al., 2009) (Fig. 2). These are alarming facts for such a populous city. The field work during this study revealed that the areas which are densely populated suppress the cooling effect of the green space due to increased concrete structures. The smaller green spaces are surrounded by walls from the neighboring builtup areas (Fig. 3), which reduces the ability of parks to provide climate moderating services. Parks have to be of a certain size to provide a comfortable microclimate. However, some larger green spaces, also due to their regional functional character (Fig. 1, red marks), maintain their position as providers of microclimate services at a local scale. Fig. 1 Land use of the core of Karachi and the fast developing Defence Housing Authority (DHA) residential areas (time series of 1986-2003) (Qureshi et al., 2010b) Asea Uninet Scientific and Plenary Meeting 2016 |9 Fig. 2 Trend of mean annual temperature in Karachi (1961-2009) Fig. 3 Green spaces in Karachi surrounded by high rise residential buildings (Left – Beach View Park; Right – Askari Park) 4.2 Biodiversity – Linz/Austria Study The very best park in the evaluation (Bauernberg-Park) has 37 species and a breeding number of 71. The park has an area of 9.54 ha and is richly structured by different vegetation types, especially old trees and small forest patches. The park with the worst result in the evaluation (Harbach-Park, 1.39 ha) has only 1 species and a breeding number of 2 (Fig. 4). Fig. 4 Bauernberg- Park (a) and Harbach-Park (b) in Linz, Austria The difference in size and structure, together with a comparable utilization level, express a clear difference in disturbance, a very important factor for ecological functionality. This can be better expressed by, for instance, birds (or other animals) than only by vegetation types. In this sense birds are more sensitive indicators for biodiversity than vegetation. The study also shows big differences between the parks which could not be expected just because of the green area structure. It also shows that biodiversity very much depends on size (and shape), disturbance, and intensity of utilization of the parks. The different breeding categories (see chapter 2) are unevenly distributed in the parks. Especially the category “breeding possible” (BS2) shows much biodiversity potential to improve the biodiversity service, even for parks of only middle rank. An additional preliminary study on the realization of biodiversity by the visitors shows no significant difference between the Bauernberg-Park and the Harbach-Park (Czermak, 2008). This links to the hypotheses that biodiversity is not always recognized by visitors without experience. Another interpretation is that the valuation of nature experience functions depends very much on the available and practical (nearest park) possibilities. The results of the Linz study also show that the highest number of bird species in the urban region can be found in unsettled areas in flood plains (70) and forests (77) and are very low in agricultural areas (52-52). In urban areas the highest numbers of bird species can be found in urban green spaces (65) and detached house neighborhoods (villa areas) (63), much more than in any other residential areas (54) (Czermak, 2008). 10 | Asea Uninet Scientific and Plenary Meeting 2016 Table 4 Biodiversity classifications of the Linz urban parks by breeding bird species (Czermak, 2008, p. 57 and 63, changed) Parks BS1 BS2 BS3 Aggregate Value of different Breeding Categories Number of breeding bird species Bauernberg Freinberg West-Ost Hummelhofwald Freinberg Aroboretum Bergschlössl Panuliwiese Wasserwald Schlossberg Donaupark Volksgarten Universitätspark Pöstlingsberg J.W.Kleinstrasse Wag-Park Ökopark Ing.Stern.Strasse Erholungspark Urfahr Peuerbachstrasse Harbachpark 15 12 10 9 10 12 8 8 12 8 13 8 71 52 65 51 37 32 31 24 1 11 10 3 6 6 6 6 4 4 7 2 3 14 6 10 10 13 7 6 6 5 5 1 2 1 9 7 3 9 2 6 4 3 1 1 2 5 3 37 37 36 41 36 32 26 24 16 16 13 16 11 25 24 22 23 21 19 16 15 10 10 10 9 7 3 0 1 0 0 1 5 2 4 1 4.3 Nature experience and education about nature – The Shanghai, China, study All parks investigated Shanghai parks are very intensively used on all days from morning to evening. This shows the general relevance of parks in Shanghai’s urban life for the close neighborhood population where most of the visitors come from. For most of the visitors the environmental conditions are important reasons for visiting (83% to 94%) (Fig. 5). Asea Uninet Scientific and Plenary Meeting 2016 | 11 Fig. 5 Park nature in Kai Qiao Park, Shanghai (photo N. Stern) The term “environmental conditions” describes the visitor’s perspective on the natural features of the parks as different surroundings compared to the limited spaces and nature in Shanghai’s residential areas. The majority of visitors questioned also expressed the view that nature experience is an important reason for visiting the park (73% to 86%). The ornamental nature of the parks creates the general vision of nature for most of the urban dwellers. Many of the visitors express being regular observers of nature in the parks (36% to 44%). A majority does this only sometimes and a certain percentage of the visitors never (11% to 18%). This seems to be more an emotional relation than an educational one (Fig.6). 18.4 Kai Qiao 44.7 36.9 11 never Tianshan 45.0 44 sometimes daily / regular 11 Zhongshan 46.5 42.4 0 10 20 30 40 50 Fig. 6 Visit of the parks to observe nature (in % questioned persons) The majority of the visitors never use the parks to learn about nature (37% to 53%). This shows the still unused potentials of these parks to built-up ecological knowledge starting from already existing emotional relations between people and the park (Fig. 7). Fig. 7 Learning about nature while visiting the parks (in % questioned persons) It becomes clear that nature experience is not only dependent on the offered nature of the parks but also from the nature related pre-education of the visitors. 12 | Asea Uninet Scientific and Plenary Meeting 2016 4.4 Recreation – Buenos Aires, Argentina, study The majority of visitors are middle class people (83-91%). They visit the parks because of their natural features (38-58%) and for recreation and stress relief (23-39%) (Fig. 8). Age, sex and family situation influence the visits (time, frequency, duration, activities and preferences of the features). The utilization of the parks is more or less comparable in frequency, duration and activities. Fig. 8 Reasons for visiting the parks The majority of visitors stay more than two hours in the parks (50-68%). Younger (15-21 years old) and older people (more than 50 years old) stay longer than others (up to 68% of these groups). The frequency of visits varies between parks and social groups. A large proportion of the users visit the park every day or whenever they have time (62-76%) independent of social status, but depending on age and family situation. A bigger group visits the parks every day (17-40%). This shows the importance of these green spaces as providers of recreational functions in the daily life of people living next to the areas. Visits to green spaces are the most time consuming and most important free time activities for 36 % to 46 % of the questioned persons. This open space activity is much more important than any other (followed by shopping, family visits, special sports and cinema visits). Cleanliness (35-59 %) and security (14-21 %) are very important for the visitors, more than natural elements (trees and plants) (6-15 %). The lawns and the trees are the most valued natural features (35-55 %). In combination, the trees provide shade, structure the space and give a picturesque impression. The lawns allow for resting, walking (partly) and observing. The majority of visitors come from a distance of less than 500 m (37-57%). This can vary if there are no green spaces nearer or if a green space further away is more attractive. This is the case with the Parque Micaela Bastidas where 45 % of visitors travel a distance of more than 2 km to the park (Fig.9). For more than 40 % of the visitors the distance is always the main reason to visit the most frequently used park. This means the parks are mainly important for the neighborhood population and should fit their recreational interests. Fig. 9 Distance from where the visitors came to the parks in Buenos Aires Most activities are sitting, resting on lawns, sunning oneself, reading, walking, walking dogs etc. Several activities are more active, such as sports, children’s play or special activities like visits with children etc. The activities can be partly in concurrence to each other depending on the size of the green space and the number of visitors doing them at the same time. The spatial separation of functional activities helps to reduce conflicts. Overcrowding based destruction of services can be avoided by a green planning strategy including the urban regional demand for recreation. Fig. 10 Parks in Buenos Aires -Parque General Las Heras and Parque Micaela Bastidas (photos by the author) Asea Uninet Scientific and Plenary Meeting 2016 5 | 13 DISCUSSION - DEVELOPMENT OF AN EVALUATION TOOL FOR URBAN ECOSYSTEM SERVICES ON SITE LEVEL (ESIS ECOSYSTEM SERVICE INDICATION SYSTEM) There is a need for an evaluation tool for urban ecosystem services to compare studies and different parks on a qualified basis.. Niemann 1982 developed a system of structural units of different levels (landscape elements and landscape units) which were used to define quantitative functional degrees. Breuste (2009) implemented this system on a large scale for urban areas; Stern (2010) adopted it for urban parks in an example study in Shanghai. The system allows the connection of ecosystem functions to spatial elements of the urban system or landscape and their quantification. It is further developed for only green areas as spatial units in urban areas providing ecosystem services. It allows the localization of ecosystem service qualities and the development of a spatial pattern of these qualities and quantities for a whole urban area. The comparison of the quality and quantity of defined ecosystem services between different green areas is possible (Stern, 2010). The evaluation tool consists of (spatial) elements on two levels, which are carriers of the ecosystem service functions and can be exactly localized in urban areas. The different ecosystem services can be qualified by indicators and quantified by the dimension or quantity of the indicator. With this tool the quantity of an ecosystem function can be individually localized in the urban area and aggregated for green areas, for example. Fig. 11 Investigation levels for ecosystem services in ESIS tool The system starts with two levels of spatial dimensions (level A and level B in Fig. 12). The first is the green patch level. These consists of the basic units providing direct ecosystem services e.g. lawns, bush groups, single trees, small woods with different layers, flower beds, etc. (Fig. 12). For quantification of climate regulation service e.g. the dimension of biomass, the extension of areas and their shape can be taken into account. Different species are habituated by different patch ecosystems and their availability in green areas can be indicators for this habitat function or biodiversity. Fig. 12 Green patches as basis level for ecosystem services in Zhongshan Park Shanghai (Stern, 2010) These patches are responsible for climate regulation, hydrological and biodiversity services. As elements of green areas (level B) they are responsible for more complex ecosystem services such as recreation, nature experience, health, cultural services etc. This second level of green area can be a reference level for the aggregated values of the patch related ecosystem services. The environment of the green areas influences the quantity of ecosystem services of the green area or in the case of large green areas the opposite, the green areas influence the climate of the environment. These environmental relations are important. The climate regulation service of a green area starts to influence its built-up surrounding when the size of the green areas is big enough. On the other hand the environment of green areas has a residential population which needs special ecosystem services, e.g. for recreation. These needs can also be quantified and compared with the quality and quantity of ecosystems services provided by the green areas located nearby. This comparison can help planners to overcome the possible gaps in ecosystem services in urban districts. This links to a planning process which investigates the ecosystems services systematically, rates and evaluates them using indicators and implements this knowledge in ecological planning (Fig. 13). 14 | Asea Uninet Scientific and Plenary Meeting 2016 Fig. 13 Investigation, rating and data collection and analysis framework of ESIS tool The further development of this evaluation tool for urban ecosystem services can, when implemented in planning processes, help to localize, quantify, secure and improve ecosystem services in cities and towns. The indicator concept allows data based evaluation by measuring systems (like climate measurement systems), but also indication of e.g. climatic conditions by green patches. The methodology is flexible enough to be adapted to indicator based evaluation or measuring techniques depending on the availability of trained personnel, equipment, time, finances etc. The indicator concept as part of the tool allows adaptation to different local conditions and implementation even in administratively less developed urban systems such as in many developing countries with rapidly growing cities. 6 6.1 CONCLUSION More ecosystem services are needed where the people live Urban green in different countries and cities can be different. Many studies reflect valuable results on urban green but have not investigated comparable types of green. A glance at recently published literature reinforces the evidence of climate change effects at all scales (Brown, 2011). Cities will be among the most affected ecosystems that are also first influenced by climate changes (Satterthwaite et al., 2007). A review of numerous observed and predicted climatic extremes has been reported by Easterling et al. (2000). Increased precipitation and runoff in some regions will lead to an increased frequency and/or intensity of flooding with consequent economic costs (Baker & Barnes, 1998). To cope with these challenges, an ecosystem services approach has the potential for adapting cites to climate change at all spatial scales (Kates & Wilbanks, 2003). The cooling effect of urban green (e.g. Gill et al., 2007) can be a key concern for thermal comfort and for combating the microclimatic changes (including heat island effects) (Wong et al., 2011) besides helping to plan settlements in a sustainable way (Mills, 2006). The climate regulation service will become more important in most of the cities worldwide. Green areas will be the most effective providers of moderate climate in heat stress situations without any energy consumption. This climate regulation function will be necessary in all areas of cities where people live and will link to a changed design of new urban residential areas and to a necessary change and adaption of existing residential areas. To adapt cities to climate change challenges means to improve ecosystem services provided mostly by urban green (Gill et al., 2007; Grant, 2010). Urban biodiversity and urban nature experience will become more and more important in urban development. Cities offer habitats which only rarely exist in the intensively used cultural landscapes of the surrounding areas. They became alternatives for native flora and fauna but also offer perspectives for new forms of nature as urbanindustrial nature. Nature protection in many countries has changed its perspective from the isolated protection of rare species and habitats to protect nature to support nature experience. This has even become the most important reason for protecting urban nature. In many countries the third generation is already growing up without any close relationship to nature or experiencing nature. The opportunities that urban nature offers for nature experience, learning from nature or even simply to enjoy nature are still only partly recognized. These services have to become a part of new urban planning concepts . The growing cities need publically accessible open spaces for recreation. This can be supported by public urban green spaces like parks. Other forms of nature can also provide this service (forests, wetlands, agricultural land, wasteland etc.). The actual studies Asea Uninet Scientific and Plenary Meeting 2016 | 15 show that traditional public parks still play an import role in recreation in urban neighbourhoods. They are needed here, directly next to the people in order to fulfil the urgent needs of urban dwellers for recreation as part of their daily lives. The studies show that this is not only an ecosystem service needed in cities of highly developed countries. In every city, even and especially in fast developing cities of the developing world where this service does not develop in parallel to urban growth, it has to be included in urban planning. 6.2 Fewer ecosystem services are available where people live Rapid urban growth links to more intensive use of all urban space and to a territorial extension of cities (Clarke & Gaydos, 1998; Smith, 2002). All available urban space is actually used for economic profitable land use (residential and commercial buildings etc.). Only social groups with high income can afford to have their own green open space (Qureshi et al., 2010a). For the majority of urban dwellers only public green remains as a provider of adequate regulated climate, urban outdoor recreation and nature experiences. Nevertheless, due to reduced finances and less public income communities are economically unable to provide functional public green spaces that are equally distributed in all residential areas. Green areas outside the cities cannot replace the necessary green areas inside the cities, which are disappearing apace or cannot be added or linked to the existing ones. The trend suggests that the majority of urban dwellers will have limited access to urban ecosystem services in their neighbourhoods. This will influence their health status (Martens, 1999; Kovats et al., 1999) and contact with nature. The need for ecosystem services in residential areas is increasing, whereas the ability to provide these services by communities is decreasing. A cautious inventory of existing ecosystem services at the site level for each green area is therefore recommended. The identification of ecosystem service gaps in the urban form is advisable to develop them with the remaining communal abilities exactly at the places where a specific service or services are urgently needed. Urban ecosystem service should become part of urban planning concepts (Colding, 2011). This includes the definition of targets for urban ecosystem services in an urban regional context and in a proposed quantity. This is actually only partly the case, is often fragmented and especially not seen in a demand and supply context. Urban green is not always the same in different countries and cities. Many studies reflect valuable results on urban green but have not investigated the same kind of areas. To avoid incomparability between different studies this paper reports only on public urban green spaces, for instance different kinds of public parks, without single specialized functions such as for sports. REFERENCES: Ahern, J., 2007. Green Infrastructure for Cities: The Spatial Dimension, in: Novotny, V., Brown, P. (Eds.), Cities of the Future: Towards integrated sustainable water and landscape management, IWA Publishing, London, pp. 267–283. Alberti, M., 2008. Advances in Urban Ecology. Integrating Humans and Ecological Processes in Urban Ecosystems, Springer, New York, 366 pp. Ashton, J., 2002. Health and greening the city. Journal of Epidemiology and Community Health. 56, 896. doi:10.1136/jech.56.12.896 Baker, M.E., Barnes, B.V., 1998. Landscape ecosystem diversity of river floodplains in north-western Lower Michigan, U.S.A. Canadian Journal of Forestry Research. 28(9), 1405–1418. 16 | Asea Uninet Scientific and Plenary Meeting 2016 Biadun, W., 1994: The breeding avifauna of the parks and cemeteries of Lublin (SE Poland). Acta Ornithol. 29, 1–13. Bolund, P., Hunhammar, S., 1999. Ecosystem services in urban areas. Ecological Economics. 29(2), 293–301. Bowler, D.E., Buyung-Ali, L., Knight, T.M., Pullin, A.S., 2010. Urban greening to cool towns and cities: A systematic review of the empirical evidence. Landscape and Urban Planning. 97, 147-155. doi:10.1016/j.landurbplan.2010.04.007 Breuste, J., Feldmann H., Uhlmann O., (Eds.), 1998. Urban Ecology, Springer Berlin, Heidelberg, 714 pp. Breuste, J., 2009. Structural analysis of urban landscape for landscape management in German cities, in: McDonnel, M., Hahs, A., Breuste, J. (Eds.), Ecology of Cities and Towns: A Comparative Approach. Cambridge University Press, Cambridge, pp. 355–379. Brown, R.D., 2011. Ameliorating the effects of climate change: Modifying microclimates through design. Landscape and Urban Planning. 100, 372–374. Chang, C. R., Li W.H., Chang S.D., 2007. A preliminary study on the local cool-island intensity of Taipei city parks. Landscape and Urban Planning. 80, 386–395. Chen, X.L., Zhao, H.M., Li, P.X., Yin, Z. Y., 2006. Remote sensing image-based analysis of the relationship between urban heat island and land use/cover changes. Remote Sensing of Environment. 104(2), 133−146. Chiesura, A., 2004. The role of urban parks for the sustainable city. Landscape and Urban Planning. 68, 29–138. Clarke, K.C., Gaydos, L.J., 1998. Loose-coupling of a cellular automaton model and GIS: long-term growth prediction for the San Francisco and Washington/Baltimore. International Journal of Geographical Information Science. 12, 699–714. Colding, J., 2011. The role of ecosystem services in contemporary urban planning, in: Niemelä, J., Breuste, J, Elmqvist, T., Guntenspergen, G., James, P., McIntryre, N. (Eds.), Urban Ecology, Patterns, Processes, and Applications. Oxford University Press, Oxford, pp. 228–237. Costanza, R., Folke, C., 1997. Valuing ecosystem services with efficiency, fairness, and sustainability goals, in: Daily, G.E. (Ed.), Nature's Services - Societal Dependence on Natural Ecosystems. Island Press, Washington D.C., pp. 49–65. Curitiba Declarations on Cities and Biodiversity, 2007. Retrieved from http://www.cbd.int/doc/meetings/biodiv/mayors-01/mayors-01-declarationen.pdf, visited 6/25/2011. Czermak, P., 2008. Ökologische Bewertung von Parkanlagen der Stadt Linz auf der Basis des Datenbestandes der Brutvogelkartierung (Ecological Assessment of Parks in the City of Linz on the Basis of the Data Set of Breeding Bird Mappping). Unpublished master´s thesis, University Salzburg. [in German] Dousset, B., F., Gourmelon, 2003. Satellite multi-sensor data analysis of urban surface temperature and land cover. ISPRS Journal of Photogrammetry and Remote Sensing. 58, 43−54. Easterling, D.R., Meehl, G.A., Parmesan, C., Changnon, S.A., Karl, T.R., Mearns, L.O., 2000. Climate extremes: observations, modeling, and impacts. Science. 289, 2068– 2074. Gill, S.E., Handley, J.F., Ennos, A.R., Pauleit, S., 2007. Adapting cities to climate change: the role of the green infrastructure. Built Environment. 33(1), 115–133. Grant, L., 2010. Multi-Functional Urban Green Infrastructure. A CIWEM Briefing Report. The Chartered Institution of Water and Environmental Management (CIWEM), London. Asea Uninet Scientific and Plenary Meeting 2016 | 17 Grimm, N.B., Foster, D., Groffman, P., Grove, J.M., Hopkinson, C.S., Nadelhoffer, K., Peters, D., Pataki, D.E., 2008. The changing landscape: ecosystem responses to urbanisation and pollution across climatic and societal gradients. Frontiers in Ecology and the Environment. 6, 264–272. Hahn, M.B., Riederer, A.M., Foster, S.O., 2009. The Livelihood Vulnerability Index: A pragmatic approach to assessing risks from climate variability and change – A case study in Mozambique. Global Environmental Change. 19, 74–88. Jim, C.Y., Chen, W.Y., 2006. Recreation-amenity use and contingent valuation of urban green spaces in Guanzhou, China. Landscape and Urban Planning. 75, 81–96. Jim, C.Y., Chen, W.Y., 2009. Ecosystem services and monetary values of urban forests in China. Cities. 26, 187–194. Kates, R.W., Wilbanks, T.J., 2003. Making the global local: Responding to climate change concerns from the ground up. Enivronment. 45(3), 12–23. Kowarik, I., 1992. Das Besondere der städtischen Flora und Vegetation. In: Natur in der Stadt - der Beitrag der Landespflege zur Stadtentwicklung, Schriftenreihe des Deutschen Rates für Landespflege, 61, 33 – 47. Kovats, R.S., Menne, B., McMichael, A.J., Corvalan, C., Bertollini, R., 2000. Climate Change and Human Health: Impact and Adaptation. WHO/SDE/OEH/ 00.4. World Health Organization, Geneva and Rome, p. 22. Li, F., Wang, R., Paulussen, J., Liu, X., 2005: Comprehensive concept planning of urban greening based on ecological principles: a case study from Beijing, China. Landscape and Urban Planning. 72, 325–336. Loram, A., Tratalos, J., Warren, P.H., Gaston, K.J., 2007. Urban domestic gardens (X): the extent & structure of the resource in five major cities. Landscape Ecology. 22, 601– 615. Martens, P., 1999. How will climate change affect human health? American Scientist. 87, 534–541. Mazuoka, R.H., Kaplan, R., 2008. People needs in the urban landscape: Analysis of Landscape and Urban Planning contributions. Landscape and Urban Planning. 84, 7–19. McDonald, R., 2009. Ecosystem service demand and supply along the urban-to-rural gradient. Journal of Conservation Planning. 5, 1–14. Millennium Ecosystem Assessment (MEA), 2003. Ecosystems and Human Well-Being; a Framework for Assessment, Island Press, Washington. Millennium Ecosystem Assessment (MEA), 2005. Ecosystems and HumanWell-Being, Synthesis, Island Press, London. Mills, G., 2006. Progress toward sustainable settlements: a role for urban climatology. Theoretical and Applied Climatology. 84, 69–76. Müller, N., Werner, P., Kelcey, J.G., 2010. Urban biodiversity and design, WileyBlackwell, Singapore. Nagoya declaration – Urbio 2010. Retrieved from http://www.cbd.int/authorities/doc/NagoyaDeclaration-URBIO-2010.pdf, visited 6/25/2011. Niemann, E., 1982. Methodik zur Bestimmung der Eignung, Leistung und Belastbarkeit von Landschaftselementen und Landschaftseinheiten (Methodology for Determining the Suitability, Performance and Capacity of Landscape Elements and Landscape Units). Scientific disclosures by the Institute for Geography and Geoecology. Academy of Science of the GDR, Special Issue 2.[in German] 18 | Asea Uninet Scientific and Plenary Meeting 2016 Nowak, D.J., Rowntree, R.A., McPherson, E.G., Sisinni, S.M., Kerkmann, E.R., Stevens, J.C., 1996. Measuring and analyzing urban tree cover. Landscape and Urban Planning. 36, 49–57. Pauleit, S., Duhme, F., 2000. Assessing the environmental performance of land cover types for urban planning. Landscape and Urban Planning. 52(1), 1–20. Pauleit, S., Breuste, J., 2011. Land use and surface cover as urban ecological indicators, in: Niemelä, J., Breuste, J., Elmqvist, T., Guntenspergen, G., James, P., McIntryre, N. (Eds.): Urban Ecology, Patterns, Processes, and Applications. Oxford University Press, Oxford, pp. 19–30. Qureshi, S., 2010. The fast growing megacity Karachi as a frontier of environmental challenges: Urbanization and contemporary urbanism issues. Journal of Geography and Regional Planning. 3, 306–321. Qureshi, S. and Breuste, J.H., 2010. Prospects of biodiversity in the mega city Karachi, Pakistan: Potentials, constraints and implications, in: Müller, N., Werner, P., Kelcey, J. (Eds.), Urban Biodiversity and Design - Implementing the Convention on Biological Diversity in Towns and Cities. Wiley-Blackwell, Oxford, pp. 497– 517. Qureshi, S., Breuste, J.H., Lindley, S.J., 2010a. Green space functionality along an urban gradient in Karachi, Pakistan: A socio-ecological study. Human Ecology 38, 283– 294. Qureshi, S., Kazmi, S.J.H., Breuste, J.H., 2010b. Ecological disturbances due to high cutback in the green infrastructure of Karachi: Analyses of public perception about associated health problems. Urban Forestry and Urban Greening 9, 187–198. Sajjad.S.H. Hussain B., Khan, M. A., Raza, A., Zaman, B., Ahmad, I., 2009. On rising temperature trends of Karachi in Pakistan. Climate Change, 96, 539-547. Santos L. D., Martins, I. 2007. Monitoring urban quality of life - The Porto Experience. Social Indicators Research 80, 411-425. Satterthwaite, D., Huq, S., Reid, H., Pelling, M., Lankao, P.R., 2007. Adapting to climate change in urban areas: the possibilities and constraints in low and middle income nations. Human Settlements Working Paper Series Climate Change and Cities No. 1. IIED, London. Schetke S., Haase D., Breuste, J., 2010. Green space functionality under conditions of uneven urban land use development. Land Use Science. 5(2), 143–158. Second Curitiba Declaration on local authorities and biodiversity, 2010. Retrieved from http://www.cbd.int/doc/?meeting=MAYORS-02, visited 6/25/2011. Smith, N., 2002. New globalism, new urbanism: gentriﬁcation as global urban strategy. Antipode. 34, 427–50. Stern, N., 2010. Bewertung der sozio-ökologischen Funktionen von Grünflächen dargestellt am Beispiel der Megastadt Shanghai (Assessment of the SocioEcological Functions of Green Areas shown on the Example of the Mega City of Shanghai.). Unpublished doctoral disseration, University Salzburg, 167 pp. [in German] The Singapore Index on Cities' Biodiversity (CBI), 2009. Retrieved from http://www.cbd.int/authorities/gettinginvolved/cbi.shtml, visited 6/25/2011 Tratalos J., Fuller R.A., Warren, P.H., Davies, R.G., Gaston, K.J, 2007. Urban form, biodiversity potential and ecosystem services. Landscape and Urban Planning. 83(4), 308−317. Weissmair, W., Rubenser, H., Brander M., Schauberger, R., 2000−2001. Linzer Brutvogelatlas (Breeding Bird Atlas of Linz.). Naturkundliches Jahrbuch der Stadt Linz, pp. 46−47. [in German] Asea Uninet Scientific and Plenary Meeting 2016 | 19 Weng, Q., 2001. A remote sensing-GIS evaluation of urban expansion and its impacts on surface temperature in the Zhujiang delta, China. International Journal of Remote Sensing. 22, 1999−2014. Werner P., Zahner R., 2009. Biologische Vielfalt und Städte. Eine Übersicht und Bibliographie (Biodiversity and Cities. An Overview and Bibliography). BfN – Scripts Nr. 245, Bonn−Bad Godesberg. [in German] Wong, N.H., Jusuf, S.K., Tan, C.L., 2011. Integrated urban microclimate assessment method as a sustainable urban development and urban design tool. Landscape and Urban Planning. 100, 386–389. Yli-Pelkonen, V., Niemelä, J., 2005. Linking ecological and social systems in cities: urban planning in Finland as a case. Biodiversity and Conservation. 14, 1947−1967. Table 4 Biodiversity classifications of the Linz urban parks by breeding bird species LIST OF TABLES:     Table 1 Typical urban structural units in Leipzig, Germany Table 2 Ecosystem services of urban green Table 3 Services and indicators of quality of life related to the dimensions of sustainability Table 4 Biodiversity classifications of the Linz urban parks by breeding bird species LIST OF FIGURES:              Fig. 1 Land use of the core of Karachi and the fast developing Defence Housing Authority Fig. 2 Trend of mean annual temperature in Karachi (1961-2009) Fig. 3 Green spaces in Karachi surrounded by high rise residential buildings Fig. 4 Bauernberg- Park (a) and Harbach-Park (b) in Linz, Austria Fig. 5 Park nature in Kai Qiao Park, Shanghai Fig. 6 Visit of the parks to observe nature (in % questioned persons) Fig. 7 Learning about nature while visiting the parks (in % questioned persons) Fig. 8 Reasons for visiting the parks Fig. 9 Distance from where the visitors came to the parks in Buenos Aires Fig. 10 Parks in Buenos Aires -Parque General Las Heras and Parque Micaela Bastidas Fig. 11 Investigation levels for ecosystem services in ESIS tool Fig. 12 Green patches as basis level for ecosystem services in Zhongshan Park Shanghai Fig. 13 Investigation, rating and data collection and analysis framework of ESIS tool MAJA LEAF EXTRACT (AEGLE MARMELOS) AND SILICA GEL FOR UREA DETECTION BY USING CYCLIC VOLTAMMETRY Yunita Triana Material and Metallurgical Engineering Department Kalimantan Institute of Technology nita@itk.ac.id Tri Paus Hasiholan Hutapea Faculty of Fisheries and Marine University of Borneo Tarakan hutapea2606@gmail.com Fredy Kurniawan Chemistry Department Institut Teknologi Sepuluh Nopember fredy@chem.its.ac.id Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract The plant family consists of many unique varieties and thus a lot of useful potential application. Blessed with a tropical climate and around 17,000 islands, Indonesia is an archipelago nation with second largest biodiversity in the world. The flora diversity of Indonesia reflects an intermingling of Asian, Australian and the native species due to the geography position and condition of Indonesia. Some researchers used plant extract for synthesis of nanoparticles (Jagajjanani Rao and Paria, 2013), medicine (Kumari et al., 2014; Rahman and Parvin, 2014), corrosion inhibitors (Kurniawan and Madurani, 2015) and sensors. Especially for sensor, there are two type of sensors, i.e. enzymatic (Fitriyana and Kurniawan, 2015; Reshetilov et al., n.d.) and non-enzymatic sensor (Kurniawan et al., 2009, 2006). Enzymatic sensors normally have very short life due to the properties of the enzyme which is very easy to decompose. In this work, we used Indonesian-naturalized plant, maja (Aegle marmelos) leaf extract instead of urease enzyme for urea sensor. Previous other works showed that determination of urea presence mainly used urease as the active material (Hao et al., 2015; Ramesh et al., 2015; Reshetilov et al., n.d.). Silica gel - maja leaf extract modified silver electrode has been studied as an alternative urea biosensor which works electrochemically. Maja leaf extract, silica gel and paraffin was mixed until homogenous, and then attached on the end of the silver wire which was tightly covered by glass tube to become silica gel-maja leaf extract modified silver electrode. Cathodic and anodic current signals at 0.4 Vand 0.625 V respectively. The electrode shows good selectivity. Keyword: silica gel, sensor, maja leaf extract, urea, Aegle marmelos Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 20 Asea Uninet Scientific and Plenary Meeting 2016 1 | 21 INTRODUCTION Urea plays an important role in many biological processes. One of them is protein decomposition. Human body produces 20 to 30 grams of urea each day (Meessen, 2012). Based on this fact, urea detection is a very important thing in clinical diagnosis. Various methods using urease enzyme like optical method (Krysteva and Mohammed Al Hallak, 2003) and colorimetry (Reddy et. al., 2004) have been used for clinical urea detection. But, some of these methods need instrumentations that complicated, relatively expensive, less sensitive in detecting urea, and not portable equipment. Therefore, in this research another alternative method is used, that is electrochemical nonenzymatic biosensor using the extract of maja leaf (Aegle marmelos). Coarse extract from maja leaf (Aegle marmelos) have been used since antiquities to cure various illnesses like asthma, inflammation of mucous membrane, acute bronchitis, and used as antidiabetic formula (Kurian, 1992). Ion content that found inside concentrated extract of maja leaf and ethanol are zinc, chromium, iron, selenium, magnesium, copper, and phosphor (Janarthanan et. al. 2012). Any content between those compounds expected to be able to decompose urea like the mechanism of urease enzyme. Method used in this research is electrochemical technique using silica gel and maja (Aegle marmelos) extract modified silver electrode. Electrochemical performance of the electrode and optimal condition for glucose biosensor also studied in this research. 2 2.1 EXPERIMENTALS Equipments The equipments used in this research were measuring pipette, Ohaus® analytical scale, Thermo Scientific® oven, Oakton® pH meter, hot plate, micropipette, spatula, 25 ml measuring flask, watch glass, glass bottle, ultrasonic, a set of evaporation equipment, a set of distillation equipment, silver wire (1mm diameter and 50mm length) and Autolab Metrohm® potentiostat type AUT84948 with three electrode system. The three electrode cells were silica gel/maja leaf extract modified electrode as working electrode, Ag|AgCl (KCl 3M) as reference electrode, and platinum wire as auxiliary electrode. 2.2 Materials Materials those used in this research were maja leaves whice were cultivated in Institut Teknologi Sepuluh Nopember (ITS), monosodium dihydrogen phosphate (NaH2PO4), disodium hydrogen phosphate (Na2HPO4), polypyrol, silica, paraffin, Brataco® aqua DM, ethanol p.a, shrinkage, silicon carbide sandpaper with grade number as 1200, N2 gas, potassium chloride (KCl), glucose, urea, HVS paper, and tissue. 2.3 Preparation of maja leaf extract Maja leafs were dried in 5 days at room temperature. The 150 g dried leaves were extracted in 1 L ethanol using maceration technique for 72 hours. Then the maja leaves which were extracted, was discarded. The solutions maja extract was evaporated using rotavapor at temperature of 60oC until no evaporate solvent produced (about 3 hours). The residue are maja leaf extract. This maja leaf extract was kept in the refrigerator to maintain the activity of the maja leaf extract. This maja leaf extract will be used as electrode active material in the further experiments. 2.4 Preparation of silver electrode 22 | Asea Uninet Scientific and Plenary Meeting 2016 Silver wire with purity of 99.97% was used as electrode. The diameter is 1 mm with 5 cm length. The electrode was subsequently washed with 70% ethanol and aqua DM. Then it is dried in room temperature. The electrode was cleaned using ultrasonic apparatus with operational time of 20 minutes, and then dried in room temperature. 2.5 Preparation of silica gel /maja leaf extract modified silver electrode Silica gel, solid paraffin, and maja leaf (Aegle marmelos) extract were mixed with certain variation of mass. The mixture was stirred inside watch glass until a paste-like form. Then the paste was inserted into the body of the glass of the electrode manually using spatula until homogenous. Finally, the surface of the electrode was polished until smooth and flat using a piece of paper. 2.6 Characterization of silica gel/maja leaf modified silver electrode The silver electrode that was modified with silica gel/maja leaf extract paste as in the section 2.5 was tested on glucose and urea solution. The test was performed by comparing the silica gel/maja leaf modified silver electrode with silica gel modified silver electrode on both solutions. The concentration for both Solutions were 5 µM at potential -1 V until +1 with scan rate 100 mV/second 3 RESULTS AND DISCUSSION Electrochemical biosensor which has high sensitivity, fast performance on in situ detection, excellent selectivity and low cost has attracted wide attention. In order to prepare an excellent biosensor there are possibility we should use several materials such as nanoparticles, redox dye, conductive polymer, biomolecules and ionic liquid together. Those materials are used to increase micro environment that provides suitable orientation and to accelerate electron transfer on surface of the electrode. Solid electrodes like carbon, gold and platinum are widely used as working electrode because of their wide potential range, low background current, inert behaviour, and suitable for various sensor and detection application. Beside of the right choice of the electrode, determination of the supporting material of the electrode for optimal electron transfer holds an important rule. In this research silica gel was used for the supporting solid material of the electrode. Silica gel have been widely used for supporting solid material for urea detecting sensor due to its hollow particle size, the physical morphology, electrical, and optical properties of silica particles that be able to increase sensor sensitivity. Asea Uninet Scientific and Plenary Meeting 2016 | 23 Figure 3.1 Voltammogram of Response Comparison Between Silica Gel and Silica Gel/Maja Leaf Extract (Agle marmelos) to Glucose Solution on pH 13 condition Other point that should be considered is the ability of biomolecule which could increase the selectivity of detected compound. In this research, the ethanol extract of maja (Aegle marmelos) leaf was the biomolecule. Maja plant has been known as medicine plant since antiquities, even from Vedic age. Its leaf, fruit flesh, flower, bark, and root have been widely used as medicines. Its leaf can be used as medication of asthma, inflammation on mucose membrane, and acute bronchitis. The root can be used to cure fever, heart arrhythmia, gastric irritation, and diarrhea. The fruit flesh is used to cure dysentery, burnt wound, epilepsy, and used as antivirus, tonic, and various health benefit. Ion contents that can be found inside concentrated ethanol extract of maja leaf is zinc, chromium, iron, selenium, magnesium, copper, and phosphorus. Some of those compound contents are expected to decompose urea which resembles the work mechanism of urease enzyme. Aegle marmelos or commonly known as beal in Hindi, Bengal quince in English, or maja in Indonesian (Javanese) is a member of Rutaceae family. The tree is medium sized, slender, and aromatic. Aegle marmelos is a slow growing tree, with average height of 25-30 meters. Its trunk is short, thick, soft. The bark is flaking, and spreading positioned. Sometimes, its branches are decorated with thorns. Its leaf stem has length of 1 until 2,5 inches. The old leaf radiates weird aroma. The flowers of maja tree grow in a group of 4 until 7 flowers along the young trunk with fleshy pod. Its flower is white greenish in colour with weird aroma. Besides that, the secondary metabolite content that found inside maja leaf extract is steroid, saponin, triterpenoid, alkaloid, and flavonoid. The compound contents that found inside concentrated ethanol extract of maja leaf are protein, fat, ash, and moisture. 24 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 3.2 Voltammogram of Response Comparison Between Silica Gel and Silica Gel/Maja Leaf Extract (Agle marmelos) to Urea Solution on pH 13 condition Silicon dioxide is one of many main component of Earth’s crust. Combined with magnesium oxide, aluminium, calcium, and iron, it formed silicate minerals inside rocks and soil. In millions or even billions years, silicon dioxide or silica have been separated from the original silicate rock by water to form quartz. In some places, this form of quarts is stored in amorphous or glassy condition. The word “silica” has a wide connotation, encompasses silicon dioxide in the all form of crystal or amorphous, soluble, of chemical fusion where silicon atom is surrounded by four or six oxygen atoms. It is not including “organosilicon” made by humans where carbon atom directly joined with silicon carbon to form silicone that cannot be found in the nature. Silica is relatively soluble in water and plays very important rule in many of life forms. For example, to form diatom skeleton, one of the pioneer of life in earth that absorb energy from sunlight to form oxygen to atmosphere in a process we called as photosynthesis. Many plants contain silica in its surface in order to protective purpose. Human body naturally contains a half gram of silica which allows the forming of human bones. Silica played an important role in the development of human civilization as firestone to provide combustion, formed as weapon, and terracotta and sand for production of clay ware. The high strength and durability of Roman concrete in period of around 2000 years even until now is caused by utilization of special volcanic ash that is a pure form of amorphous silica colloid. Now, silica used as catalyst for oil refinery, as jet engine super alloy casting mould, as modern glass and ceramics, electronic microcircuit, quartz crystal, and optical fibre. There are many applications of silica in biosensing and bioanalysis. The present development is for bioimaging, biolabelling, biosensor, and immunoassay. The development of biosensor is exploiting state of the art biotechnology to create product for analytical qualification and detection in the clinical regulation. That tool should links high sensitivity and selectivity with miniaturization, high speed processing, and low cost. Nanostructure has been widely used as moving part of biosensor. A chemical sensor is defined as a tool that responds specific analyte selectively by chemical reaction and can be used as qualitative or quantitative assessment/determination. The sensor is related with detection and to measure certain chemical substance of a set of chemical substances. The main goal of the sensor is to know some types of input or stimulus Asea Uninet Scientific and Plenary Meeting 2016 | 25 and change it into electrical signal that compatible with electronic circuit. It could be said that sensor is a translator from electronic value to become electrical value. The electric word means signal that is transmittable, could be enhanced, and able to be modified by electronic devices. The output signal of sensor could be in voltage or current form. This is more clarified into amplitude, frequency, phase, or digital code that is called as output signal format. Because of that, sensor has input properties (in various form) and output properties (in electrical form). The applications of biosensor are in medic, industrial and environmental control field. Healthcare is the main area of biosensor and chemisensor (chemical sensor) application. Blood, gas, ion, and metabolite measuring regularly required to shows patients’ metabolic condition mainly for hospital patients, especially in intensive care unit. Urine and blood sample that brought into medical analysis laboratory for classical analysis mainly needs hours or even days to give any result. The utilization of sensor, mainly biosensor could cut the time required into minutes. Cyclic voltammetry is highly useful for diagnose reaction mechanism and to study the reactive species in abnormal oxidation number. In cyclic voltammetry, microelectrode used as working electrode. The potency increases linearly and through current measuring. The area of working electrode and the level where analyte could diffuse on electrode surface obstruct the current. A single voltage path is reverted in some time length after electroactive species is reacted and sweeps reversely could detect electroactive product that produced by forward sweep called as cyclic voltammetry. Usually XY recorder or system of computer data is used for detect voltage on time axis so the reverse current appears below the peak that obtained by forward sweep but with contrast polarity. The shape of wave on different scanning level is used for diagnostic purpose. Substance usually examined in concentration of millimolar level, and electrode potency where the species undergo reduction and oxidation could be rapidly determined. In this test, silver electrode modified with maja leaf extract by silica gel in paste form. Silica gel has semiconductor property, so that it could assist the process of electron transfer, thus the electrical current that measured is increased. This matrix change was expected to be able to increase redox response on electrocatalytic activity of maja leaf. Test was done by compare the electrode that only modified by silica gel and the electrode that modified by silica gel and maja leaf extract. Performance of both elektrode were observed by electrical current responses that were generated from blank solution and analytical solution that had same concentration of 5 µM by cyclic voltammetry technique at range potential of -1 V until +1 V with scan rate of 100 mV/second. This test was performed in condition of pH 13 with solution of NaOH 0.1 M. Figure 3.1 show that the electrode doesn’t give good respon for glucose detection. While in Figure 3.2 show that the electrode gives good respon for urea detection. 26 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 3.3 Voltammogram of Response Comparison Between Silica Gel and Silica Gel/Maja Leaf Extract (Agle marmelos) to Glucose Solution and Urea on pH 13 condition The voltammogram obtained was shown in Figure 3.3 for all measurement. The detection of glucose using silica gel modified silver electrode can be seen in purple solid line (with the blank is in purple dash line). The current generated is very low in comparison with to other electrode. The detection of glucose using silica/maja leaf extract modified silver electrode can be seen in yellow solid line (with the blank is in yellow dash line). The current signal is higher than glucose detection using silica gel modified silver electrode. In the case of urea detection using silica gel modified silver electrode can be seen in brown solid line with the blank is brown dash line. The current response of this electrode on urea is similar to glucose. No significant current is generated. Conversely, the detection urea using silica/maja leaf extract modified silver give significant different voltammogram.The voltammogram shows the highest anodic and cathodic peak current response. The voltamogram shows that the cathodic and anodic current signals are at 0.4 V and 0.625 V respectively. The voltammogram also shows that the electrode shows good selectivity on urea in the present of glucose. Meanwhile silica modified silver electrode shows no peak anodic and cathodic current. 4 CONCLUSSIONS AND SUGGESTIONS The good result obtained is shown on silver electrode modified with silica gel and maja leaf extract in detection of urea. The voltammogram shows the ability of this electrode on both anodic and cathodic current which is higher than blank solution. Meanwhile, the silver electrode that modified only with silica gel do not show any the peak anodic and cathodic current that is higher than its blank solution. More investigation are conducted with the condition that have been explained. Urea detection response shows relatively high current without interference current from the glucose. Extract of maja leaf which was used as main active component acted as catalyst redox reaction against to urea. Due to this research’ limitation which uses only raw maja leaf extract as urea biosensor, thus more deep research are needed to find out the exact active compound inside maja leaf that contribute to urea Asea Uninet Scientific and Plenary Meeting 2016 | 27 oxidation reduction reaction. By knowing the compound that contribute in the oxidation reduction of urea, thus mechanism of the reaction which occurred on the surface of the electrode during urea detection could be fully understand. REFERENCES Fitriyana, F., Kurniawan, F. (2015). Polyaniline-Invertase-Gold Nanoparticles Modified Gold Electrode for Sucrose Detection. Indones. J. Chem. 15, 226–233. Hao, W., Das, G., Yoon, H.H. (2015). Fabrication of an amperometric urea biosensor using urease and metal catalysts immobilized by a polyion complex. J. Electroanal. Chem. 747, 143–148. doi:10.1016/j.jelechem.2015.03.015 Jagajjanani Rao, K., Paria, S. (2013). Green synthesis of silver nanoparticles from aqueous Aegle marmelos leaf extract. Mater. Res. Bull. 48, 628–634. doi:10.1016/j.materresbull.2012.11.035 Janarthanan, U.K., Varadharajan, V., Krishnamurthy, V. (2012). Physochemical Evaluation, Phytochemical Screening and Chromatography Fingerprint Profile Of Aegle Marmelos (L.) Leaf Extracts 1, 813–837. Krysteva, M., Mohamed Al Hallak, (2003). Optical Enzyme Sensor for Urea Determination via Immobilized pH Indicator and Urease onto Transparent Membranes 3, 585–592. Kumari, K.D.K.P., Weerakoon, T.C.S., Handunnetti, S.M., Samarasinghe, K., Suresh, T.S., (2014). Anti-inflammatory activity of dried flower extracts of Aegle marmelos in Wistar rats. J. Ethnopharmacol. 151, 1202–1208. doi:10.1016/j.jep.2013.12.043 Kurian, J. (1992). Plants that heals. Oriental Publishing House. Kurniawan, F., Madurani, K.A. (2015). Electrochemical and optical microscopy study of red pepper seed oil corrosion inhibition by self-assembled monolayers (SAM) on 304 SS. Prog. Org. Coat. 88, 256–262. doi:10.1016/j.porgcoat.2015.07.010 Kurniawan, F., Tsakova, V., Mirsky, V.M. (2009). Analytical applications of electrodes modified by gold nanoparticles: dopamine detection. J. Nanosci. Nanotechnol. 9, 2407–2412. Kurniawan, F., Tsakova, V., Mirsky, V.M. (2006). Gold Nanoparticles in Nonenzymatic Electrochemical Detection of Sugars. Electroanalysis 18, 1937–1942. doi:10.1002/elan.200603607 Meessen, J.H. (2012). Urea. In Press. Rahman, S., Parvin, R. (2014). Therapeutic potential of Aegle marmelos (L.)-An overview. Asian Pac. J. Trop. Dis. 4, 71–77. doi:10.1016/S2222-1808(14)60318-2 Ramesh, R., Puhazhendi, P., Kumar, J., Gowthaman, M.K., D’Souza, S.F., Kamini, N.R., (2015). Potentiometric biosensor for determination of urea in milk using immobilized Arthrobacter creatinolyticus urease. Mater. Sci. Eng. C 49, 786–792. doi:10.1016/j.msec.2015.01.048 Reddy, R.C., Srivastava, P.K., Dey, P.M., Kayastha, A.M. (2004). Immobilization of pigeonpea (Cajanus cajan) urease on DEAE-cellulose paper strips for urea estimation 39, 323–327. Reshetilov, A.N., Plekhanova, Y.V., Dubrovskii, A.V., Tikhonenko, S.A., n.d. Detection of urea using urease and paramagnetic Fe3O4 particles incorporated into polyelectrolyte microcapsules. Process Biochem. doi:10.1016/j.procbio.2015.11.028 SLOPE STABILITY MONITORING DURING THE MONSOON PERIOD USING RESISTIVITY MEASUREMENT, WATER CONTENT AND TILTMETER SENSORS (CASE STUDY: NGANTANG – MALANG, EAST JAVA PROVINCE, INDONESIA) Ria Asih Aryani Soemitro ria@ce.its.ac.id Civil Engineering Department Dwa Desa Warnana dwa_desa@geofisika.its.ac.id Geophysical Engineering Department Institut Teknologi Sepuluh Nopember (ITS) ABSTrACT This paper presents the slope instability investigation using the resistivity measurement to identify sub – surface soil structure and potential failure plane location where the soil cracks were found. The water content and tiltmeter sensors were then installed along the potential failure plane. The monitoring were carried out during the monsoon period in Ngantang – Malang where the landslide had happened three times in 2009, 2010 and 2011.The monitoring results showed that a shallow landslide or soil slip were found on 71.58 % volumetric water content and that the soil had been deformed on 3.06 º X – axis and – 20.30 º Y – axis. Keywords: slope stability, resistivity meter, water and tiltmeter sensors 1 INTRODUCTION Influence of rainfall result in rise of water content directly through the surface and seepage coming through slit of soil cracks. While soil became saturated, the soil will lose all the additional shear strength derived from the negative pore water pressure, which invariably leads to be unstable soil and prone to landslides (Hasrullah, 2007). The research locations chosen for conducting the slope instability investigation is Ngantang-Malang, East Java province, Indonesia. A number of landslides have occurred in the surveyed location on 2009, 2010 and 2011. Several researchers have been conducted investigation in the site using 2-dimensional (2D) resistivity, Ground penetrating Radar (GPR) and boring to assess subsurface structure and disaster areas mitigation (Susilo and Rachmansyah, 2012). An important issue for this research was to obtain subsurface soil structure, density variations in soil moisture and potential failure plane location as well as the evaluation the probability of slope failure. The consequence is to apply the resistivity method of 2- Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 28 Asea Uninet Scientific and Plenary Meeting 2016 | 29 dimensional high-resolution and the monitoring water content and soil deformation using the water content and tiltmeter sensors. The selection of resistivity method of 2-dimensional high-resolution is due to the fact that this method is commonly used to study the stability of slopes resulting from the infiltration of rainwater (Sastry et al., 2006; Colangelo et al., 2008; Yilmaz, 2011). In many cases of the slope stability studies, the resistivity method is applied to reconstruct the geometry of landslides, determine the slip area, and localize zones that are characterized by a high water content (Colangelo et al., 2008). Uchimura et al. (2010, 2011) has conducted a research to examine the data using a combination of soil displacement and volumetric water content sensor of the steep slopes. The instrument issued a warning when amount of rainfall and surface deformation of the slope exceeds a critical value. 2 METHODOLOGY The measurements were conducted in Songgorejt, Jombok Village, Ngantang Malang. Stages of research activities consist of two methods, namely 2D Resistivity measurement and monitoring of water content and tiltmeter sensors. In this study the method of 2-D resistivity measurement is employed using Wenner-Schlumberger electrode configuration as much as 3 lines (Figure 1). The 2-D resistivity measurement resulted in field data in the form of resistance value (R) from every point and pseudo depth. The next step is to transform apparent resistivity value to the true resistivity. The same process is required to obtain the value of the depth. Volumetric water content sensors are probing that measure soil moisture content using capacitance to gauge dielectric permittivity of surrounding soil. This sensor produces an output voltage directly proportional to the dielectric permittivity, namely soil moisture content. These sensors placed on the soil surface. Recorded data will be saved in the data logger that will be processed into value of volumetric water content. Tiltmeter is a slope measurement tool to monitor soil deformation. Tiltmeter attached to a solid pipe and plugged perpendicular below the soil surface. Placement of the sensor is on a single track with different heights. Sensor 3 is located on top of the slope, sensor 2 in the middle of the slope, and sensor 1 at the bottom of the slope. Data of soil deformation in the form of voltage will be processed and converted into X and Y axis degrees of inclination. The data collection obtained by direct soil investigations in the study area (Jombok, Ngantang, District of Malang). Measurement of volumetric water content and soil deformation conducted for approximately 2 months (February-April 2013) during wet season. Figure 2 shows the position of devices placement on the site. 30 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 1. Resistivity Measurement location Figure 2 Monitoring of Volumetric Water Content Sensor and Tiltmeter at Jombok Ngantang, Malang Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 | 31 FINDING AND DISSCUSION Resistivity Measurements The method of resistivity is one of the geophysical methods commonly used in environmental studies with a large coverage. It is because this method is relatively easy and effective (Panek et al, 2008). In many studies of slope stability, the resistivity method is applied to reconstruct geometrical slides, determine sliding zones, and localize the zone characterized as having high water content (Colangelo et al, 2008). The resistivity measurement is based on the difference of resistivity values among materials beneath the surface. The resistivity value of material depends on composition of material forming minerals, rock porosity, material structure, fluid content, temperature and clay content (McNeil, 1990). Resistivity measurements result showed that distribution of resistivity value (2-D resistivity tomography) measured from the surface down to the depth of 8 m for all lines ranges from 1 m to 1200 m. A difference in resistivity distribution is assumed to cause a difference in water content. The interpretation of resistivity results can be seen in Figure 3. From the cross-sectional interpretation of the subsurface structure in the sites is found that there are two cracks/fractures on the line 1 which is located at a point 47.5 to 62.5 meters and at points 20 to 40 meters. In line 2 there are 2 fractures were located at the point of 40 to 60 meters and at a point 27.5 to 37.5 meters. In line 3 is 1 fracture located at point 72.5 to 85 meters. These results can then be used for determining the water content and tiltmeter sensors location. Crack Crack (a) Crack Crack (b) Crack 32 | Asea Uninet Scientific and Plenary Meeting 2016 (c) Figure 3. The 2D resistivity tomography on (a) line 1- L1, (b) line 2- L2, (c) line 3- L3 3.2 Combined Monitoring of water content and displacement for slope instability Soil moisture content is defined as the ratio of the mass of water in a soil sample that was given to the soil mass. Volumetric water content in the soil which is also called the volume of ground water is a small fraction of the total soil volume occupied by the water contained in the soil (Gardner, 1986). Soil deformation is a change of the soil surface position in vertical and horizontal direction caused by several factors such as seismic activity, excess water in the soil, mining activities, changes in land use, increase in the number of buildings and thermal activities on the lithosphere layer (Khomarudin, 2013). There are several ways to detect abnormal soil deformation on the slope surface. Tiltmeter are used to detect movement zone and to determine whether the movement are constant, faster, or provide a good response measurement. Slope instability monitoring has been carried out using water content and tilt sensors. Installation of two sensors in the field adjusted to the results of electrical resistivity measurements. 4 water content sensors and 3 tilt sensors were installed, as shown in Figure 2. The tilt sensor behavior has reacted quickly and handling easily. Above quick reaction is advantage for early warning, although it’s very difficult to decide the threshold of slope failure because it depends on slope failure pattern (such as: landslide, slope shallow failure and so on). It has been observed for 2 months, and from observations obtained that on March 1, 2013 there has been a shallow landslide/soil slip where the water content sensor (sensor no 2) shows a high volumetric water content which is equal to 71.58% and a tilt in the soil by 3.06 ° on the axis X and -20.3 ° on the Y axis (Figure 4). If the tilt is greater than ± 1 ° could be said slope is instable or landslides. At each shifting ground event, it appears that the value of volumetric water content close to or even exceed critical limits. Thus, in this study, the threshold value as following: (a) the volumetric water content is more than 70% and (b) the tilt is more than 3 degrees. The thresholds will be used in the provision of early warning to the public who life at the top of the slope, using the SMS in accordance with the hardware that we made. Asea Uninet Scientific and Plenary Meeting 2016 | 33 Figure 4. Combined monitoring of water content and displacement for slope instability 4 CONCLUSION AND SUGGESTIONS The slope instability investigation using the resistivity measurements have been investigated. The resistivity method was applied to obtain information on the sub-surface characteristics and sliding surface location. The resistivity measurements also highlighted areas characterized by high water content in this area could have caused a weakening of the slopes. These results can then be used for determining the water content and tiltmeter sensors location. Form slope instability monitoring using water content and tilt sensors, it could be found that soil deformation increases according to increase in volumetric water content. If the tilt is greater than ± 3° and the volumetric water content is more than 70% could be said slope is instable. However, for the moment, the threshold depends on slope failure pattern. REFERENCES Colangelo, Gerardo., Vincenzo Lapenna, Antonio Loperte, Angela Perrone and Luciano Telesca, (2008). 2D electrical resistivity tomographies for investigating recent activation landslides in Basilicata Region (Southern Italy), Annals Of Geophysics, Vol. 51, N. 1, p.275-285. Gardner, WH. 1986. Water Content. Chapter 21 in Klute, a., ed. Methods of Soil Analysis. Part 1. Physical and mineralogical methods. 2nd Ed. Wisconsin: Soil Science Society of America, Inc. Hasrullah, (2007). Studi Pengaruh Infiltrasi Air Hujan Terhadap Kestabilan Lereng. Tesis M.T. Surabaya: ITS Komarudin, M. R., and Pasaribu, J. M. (2013). Kajian Pemanfaatan Data Synthetic Aperture Radar (Sar) untuk Analisa Penurunan Lahan (Land Subsidence). Deputi Bidang Penginderaan Jauh. Publikasi Online: 11 januari 2013 McNeill, J.D., (1990). Use of electromagnetic methods for groundwater studies, Geotechnical and environmental geophysics, SEG, Tulsa. Pánek ,Tomáš., Jan Hradecký, Karel Šilhán, (2008). Application Of Electrical Resistivity Tomography (Ert) In The Study Of Various Types Of Slope Deformations In Anisotropic Bedrock: Case Studies From The Flysch Carpathians, Studia Geomorphologica Carpatho – Balcanica Vol. XLII, p.57–73. Sastry, Rambhatla G., Suman K. Mondal, Ashok K. Pachauri, (2006). 2D Electrical Resistivity Tomography of a Landslide in Garhwal Himalaya, 6th International Conference & Exposition on Petroleum Geophysics “Kolkata 2006”. Susilo, Adi. Pitoyo W.A. dan Arief Rachmansyah. (2012). Penelitian Zona Longsor dengan Metode Resistivity 2D, GPR, dan Pemboran Untuk Mitigasi Bencana Tanah Longsor (Studi Kasus Daerah Kabupaten Malang). Proceeding Pit Hagi 2012. Palembang. Uchimura, T., and Towhata, I. (2010). Simple Monitoring Method for Precaution of Landslides Watching Tilting and Water Contents on Slopes Surface, Landslides. (Published online: 17 October 2009) Uchimura, T., Wang, L., Qiao, J.-P., and Towhata, I., (2011). Miniature Ground Inclinometer for Slope Monitoring, Proc. of The 14th Asian Regional Conference on Soil Mechanics and Geotechnical Engineering. Uchimura, T., Suzuki, D., Hongkwan, S., (2011). Combined Monitoring of Water Content and Displacement For Slope Instability. Kobe: Korea-Japan Workshop. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 34 Asea Uninet Scientific and Plenary Meeting 2016 | 35 Yilmaz, Sedat., (2011). A case study of the application of electrical resistivity imaging for investigation of a landslide along highway, International Journal of the Physical Sciences Vol. 6(24), p. 5843-5849. SYNTHESIS OF GALACTO- AND HETEROOLIGOSACCHARIDES BY BIFIDOBACTERIAL ΒGALACTOSIDASES Sheryl Lozel Arreola sbarreola@up.edu.ph Institute of Chemistry, University of the Philippines Los Baños College, Laguna 4031, Philippines Thu-Ha Nguyen thu-ha.nguyen@boku.ac.at Dietmar Haltrich dietmar.haltrich@boku.ac.at Food Biotechnology Laboratory, Department of Food Science and Technology University of Natural Resources and Life Sciences Muthgasse 18, Vienna, Austria Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract Bifidobacteria, which contain a large number of carbohydrate-modifying enzymes, have been of great interest in recent years because of several health promoting properties. Different attempts were made to increase the population of these beneficial bacteria in the human gastrointestinal tract, and one approach is to supply food ingredients like oligosaccharides that stimulate their growth and/or activities. Galacto-oligosaccharides (GOS) are products of the transgalactosylation activity of β-galactosidase (β-gal, EC 3.2.1.23) when using lactose or other structurally related galactosides as the substrate. In this study, two β-gal genes from Bifidobacterium breve DSM 20213, an isolate from infant gut, were characterized to determine the ability of the corresponding enzymes to produced GOS which can be used for their own proliferation. The recombinant β-galactosidases were also characterized with respect to their propensity to transfer galactosyl moieties onto certain sugar acceptors like lactose, the primary hydrolysis products D-glucose and D-galactose, L-fucose, N-acetyl-D-glucosamine, N-acetyl-D-galactosamine under defined, initialvelocity conditions. The choice of a suitable acceptor allows predicting the oligosaccharides produced. These results are valuable for obtaining novel hetero-oligosaccharides with potentially extended functionality in addition to GOS. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 36 Asea Uninet Scientific and Plenary Meeting 2016 Keywords: bifidobacteria, beta-galactosidase, oligosaccharides, hetero-oligosaccharides 1 enzyme, | 37 galacto- INTRODUCTION A “prebiotic” is a selectively fermented ingredient that results in specific changes, in the composition and/or activity of the gastrointestinal microbiota, thus conferring benefit(s) upon host’s health (ISAPP, 2008). Based on the criteria (Gibson, Probert, Loo, Rastall, & Roberfroid, 2004; Roberfroid, 2007) (i) resistance to gastric acidity, to hydrolysis by mammalian enzymes, and to gastrointestinal absorption; (ii) fermentation by intestinal microflora; and (iii) selective stimulation of growth and/or activity of intestinal bacteria associated with health/well-being, only inulin/fructo-oligosaccharides (FOS), galactooligosaccharides (GOS) and lactulose are fulfilling these requirements for prebiotics as documented and proven in several studies (Barclay, Ginic-Markovic, Cooper, & Petrovsky, 2010; Barreteau, Delattre, & Michaud, 2006; Gibson et al., 2004; Roberfroid, 2007). Beta-galactosidases catalyze the hydrolysis and transgalactosylation of β-1,4-Dglycosidic linkage of lactose and structurally related substrates. They have two main technological applications in the food industry - the removal of lactose from milk and dairy products (Nakayama & Amachi, 1999) and the production of GOS, exploiting the transglycosylation activity of some of these enzymes (Gosling, Stevens, Barber, Kentish, & Gras, 2010; Splechtna et al., 2006). Beta-galactosidases undergo a two-step mechanism of catalysis. First, this mechanism involves the formation of a covalently linked galactosylenzyme intermediate. Subsequently, the galactosyl moiety is transferred to a nucleophilic acceptor. Water, as well as all sugar species present in the reaction mixture, can serve as a galactosyl acceptor. Hence, the resulting final mixture contains hydrolysis products of lactose, which are glucose and galactose, unconverted lactose as well as di-, tri- and higher oligosaccharides (Mahoney, 1998; Sako, Matsumoto, & Tanaka, 1999). The GOS produced are kinetic intermediates; they act as substrates for hydrolysis (Boon, Janssen, & van 't Riet, 2000; Splechtna et al., 2006) hence GOS yield and composition change dramatically with reaction time, and the GOS mixtures thus obtained are very complex and can hardly be predicted. Scheme 1 illustrates the possible lactose conversion reactions catalyzed by β-galactosidases. Oligosaccharides produced by heterologous galactosyl transfer are termed as hetero-oligosaccharides or HeOS. Reports showed that β-gal can also be used to produce HeOS with mannose, fructose, N-acetylneuramic acid, N-acetyl-Dglucosamine (GlcNAc) and a number of aromatic compounds as galactosyl acceptor. (Gänzle, 2012) k E + Lac E . Lac water kdiss Glc [E-Gal .Glc] E-Gal kintra kGlc [Glc] kNu [Nu] E + Gal-Glc E + Gal E + Gal - Nu Scheme 1. Hydrolysis and galactosyl transfer reactions during the β-galactosidase catalyzed conversion of lactose. E, enzyme; Lac, lactose; Gal, galactose; Glc, glucose; Nu, nucleophile. 38 | Asea Uninet Scientific and Plenary Meeting 2016 Members of the genus Bifidobacterium are one of the most common organisms found in the human gastro-intestinal tract. (Collins, Thornton, & Sullivanc, 1998; Klaenhammer, Kleerebezem, Kopp, & Rescigno, 2012) The major Bifidobacterium species found in the adult microflora are B. adolescentis and B. longum while the predominant bifidobacteria in infant are B. infantis and B. breve. The use of bifidobacteria as sources of β-galactosidases may offer substantial production of GOS and HeOs. It is anticipated that oligosaccharides produced by these bifidobacterial β-galactosidases will have better selectivity for growth and metabolic activity of these bacterial genera in the gut, and thus will lead to improved prebiotic effects (Depeint, Tzortzis, Vulevic, I'Anson, & Gibson, 2008). 2 MATERIALS AND METHODS Enzyme Preparation Two β-galactosidases, β-gal I and β-gal II from B. breve DSM 20231 obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany), were overexpressed in Escherichia coli with co-expression of the chaperones GroEL/GroES. The purification of the recombinant enzymes was performed by immobilized metal affinity chromatography using a Ni-Sepharose column (GE Healthcare, Uppsala, Sweden). Purified enzymes were stored in 50 mM sodium phosphate buffer, pH 6.5 at 4 °C. β-galactosidase Assays The measurement of β-galactosidase activity using o-nitrophenyl-β-D-galactopyranoside (oNPG) or lactose as substrates was carried out as described previously (Nguyen et al., 2006). These assays were performed in 50 mM sodium phosphate buffer of pH 6.5 at 30 °C, and the final substrate concentrations in the 10-min assay were 22 mM for oNPG and 575 mM for lactose. Protein concentrations were determined by using the method of Bradford with bovine serum albumin (BSA) as standard. Characterization of Recombinant β-galactosidases The purity and the molecular mass of β-galactosidases were determined by SDS-PAGE using the Phast System with precast gels (Pharmacia Biotech, Uppsala, Sweden). Size exclusion chromatography - multi-angle laser light scattering (SEC-MALLS) analysis was performed with a Superdex S200 10/300 GL column (GE Healthcare) equilibrated in a buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM β-mercaptoethanol and 5 mM EDTA. On-line MALLS detection was performed with a miniDawn Treos detector (Wyatt Technology Corp., Santa Barbara, CA, USA) using a laser emitting at 690 nm. Protein concentration was measured on-line by refractive index measurement using a Shodex RI-101 instrument (Showa Denko, Munich, Germany). Analysis of the data was performed with the ASTRA software (Wyatt Technology). All steady-state kinetic measurements were obtained at 30 °C using oNPG and lactose as the substrates in 50 mM sodium phosphate buffer (pH 6.5) with concentrations ranging from 0.5 to 22 mM for oNPG and from 1 to 600 mM for lactose, respectively. The kinetic parameters were calculated by nonlinear regression, and the observed data were fit to the Henri-Michaelis-Menten equation (SigmaPlot, SPSS Inc., Chicago, IL, USA). The pH dependence of β-galactosidase activity was evaluated in the range of pH 3 – 10 using Britton – Robinson buffer (containing 20 mM each or Asea Uninet Scientific and Plenary Meeting 2016 | 39 phosphoric, acetic and boric acid adjusted to the required pH with NaOH). The temperature dependence of the enzyme activity was assessed by determining the activity in the range of 20 – 90 °C for 10 min. The thermostability was evaluated by incubating pure enzyme in 50 mM sodium phosphate buffer (pH 6.5) at various temperatures. Calorimetric studies on the thermal denaturation of the two enzymes were performed using the MicroCal VP-Differential Scanning Calorimeter (DSC) System (GE Healthcare). Data analysis was performed with the MicroCal Origin software (GE Healthcare) and experimental data points were fitted to an MN2-State Model. The effect of cations on the enzyme activity was evaluated by measuring the activity of the enzymes in 22 mM oNPG solution (in 10 mM Bis-Tris, pH 6.5). The measured activities were compared with the activity without added cation under the same conditions. The effect of MgCl2 (1 and 10 mM) on stability of the enzymes was also determined at different temperatures (30, 37, and 50 °C). Analysis of Intermolecular Galactosyl Transfer under Defined Initial-velocity Galactosyl transfer to D-glucose was determined by performing assays with 10 mM oNPG in 50 mM sodium phosphate buffer (pH 6.5) and varying D-glucose concentrations (2.5 20 mM) (Splechtna et al., 2006). The νoNP, νGlc, and νGal were measured by determining the molar concentrations of oNP, Glc, and Gal released for 20 min, respectively. Intermolecular transgalactosylation to lactose was assessed by varying the initial lactose concentration (9 – 602 mM) and incubation with the enzyme for 20 min at 30 °C in 50 mM sodium phosphate buffer (pH 6.5) containing 1 mM Mg2+. The reaction was stopped by heating at 95 °C. The galactosyl transfer to either GlcNAc, GalNAc or L-fucose was assessed using 100 mM lactose with acceptor concentrations varying from 12.5 to 200 mM. νoNP was measured using the standard β-galactosidase assay while νGal or νGlc was carried out by HPLC (Dionex; MA, USA) using an Aminex HPX-87K column (300 x 7.8 mm; Bio-Rad, Hercules, CA, USA) equipped with refractive index detector. Water was used as mobile phase at a flow rate of 0.80 mL min-1 and a column temperature of 80 °C. The transfer constant ratio kNu/kwater was obtained by applying the velocity ratio (νoNP/ (νGal) or (νGlc/ (νGal) against acceptor concentration and fitting on the Equation 1 using nonlinear least fit. 𝜈𝐺𝑙𝑐 𝜈Gal =1+ 𝑘Nu 𝑘water [Nu] Equation 1 GOS and HeOS Synthesis and Analysis The ability of β-gal I and β-gal II to synthesize GOS was compared by carrying out different discontinuous conversion reactions on a 2-mL scale. Reaction conditions were enzyme concentration of 1.5 ULac mL-1 in 600 mM initial lactose concentration in sodium phosphate buffer (50 mM, pH 6.5) containing 1 mM Mg2+. The incubation temperature was at 30 oC with continuous agitation at 300 rpm. At certain time intervals, samples were withdrawn and the reaction was stopped by heat at 90 °C for 5 minutes. The composition of the GOS mixture was analyzed by TLC and HPAEC-PAD following the method described previously (Splechtna et al., 2006). GlcNAc trans-oligosaccharide synthesis was carried out by using initial equimolar amounts of GlcNAc and lactose with β-gal II (5 ULac mL-1). A solution (10 mL) containing the substrates was dissolved in 50 mM sodium phosphate buffer, pH 6.5 containing 1 mM 40 | Asea Uninet Scientific and Plenary Meeting 2016 Mg2+. The enzyme was added and incubated at 30 °C and agitated at 300 rpm. Aliquots of samples were withdrawn at certain time intervals to determine the residual activities and carbohydrate contents using an HPLC system equipped with UV detector (210 nm) and Hypercarb column (0.32 × 150 mm, inner diameter 5 μm). Ammonium formate buffer (0.3% formic acid, pH 9.0) and acetonitrile were used as the mobile phase. 3 RESULTS AND DISCUSSION The two β-galactosidases, β-gal I and β-gal II from B. breve DSM 20213, belong to glycoside hydrolase family 2 (GH2). Members of this family receive more attention than those of GH42 because of the former’s better transgalactosylation activity. It is our interest to study the biochemical and molecular properties of these enzymes from bifidobacteria because of their status and beneficial effects on human health. Moreover, we studied the kinetic analyses of the formation of GOS and HeOS based on the transfer constants (kNu/kwater). β-gal I and β-gal II, which are both of the LacZ type, were cloned, heterologously expressed in E. coli and biochemically characterized (Arreola et al., 2014). Based on the amino acid sequence, the two lacZ genes revealed 57% homologies. The enzymes were purified with a single-step purification using an IMAC column. The specific activities of the purified enzymes were found to be 461 U mg-1 of protein for -gal I and 196 U mg-1 of protein for -gal II when using the standard oNPG assay. The two recombinant βgalactosidases from B. breve showed molecular masses of approximately 120 kDa as judged by SDS-PAGE in comparison with reference proteins (Figure 1). This is in good agreement with the calculated molecular mass of 116,127 and 116,594 Da for -gal I and -gal II, respectively, based on their DNA sequences. SEC-MALLS analysis showed that the native molecular masses of -gal I and -gal II are 220 and 211 kDa, respectively. It can be concluded that both β-gal I and β-gal II are homodimers. Asea Uninet Scientific and Plenary Meeting 2016 kDa 1 2 3 4 5 | 41 6 250 150 100 75 50 37 25 Figure 1. SDS-PAGE analysis of recombinant β-galactosidases from B. breve stained with Coomassie blue. Lanes 1 and 4 show the molecular mass marker (Amersham); lanes 2 and 5 are the crude extracts of β-gal I and β-gal II, lanes 3 and 6 are the purified enzymes of β-gal I and β-gal II. Enzyme Kinetics The steady-state kinetic constants for the hydrolysis of the natural substrate lactose as well as for the hydrolysis of the artificial substrate oNPG for -gal I and -gal II are summarized in Table 2. The kcat values were calculated on the basis of the theoretical vmax values experimentally determined by nonlinear regression and using a molecular mass of 116 kDa for the catalytically active subunit. -gal I and -gal II are not inhibited by their substrates, which are oNPG in concentrations of up to 25 mM or lactose in concentrations of up to 600 mM. The catalytic efficiencies (kcat/Km) for the two substrates indicate that the latter is the preferred substrate of both -gal I and -gal II. Table 1. Kinetic parameters of two recombinant B. breve  -gal I and  -gal II for lactose and oNPG hydrolysis Method for Substrate determination of enzyme activity Lactose release of D-Glc Kinetic parameter -gal I -gal II vmax,Lac (µmol min-1 mg-1) 59 ± 2 97 ± 5 Km,Lac 15.3 ± 3.2 7.5 ± 0.9 kcat (s-1) 114 ± 4 188 ± 10 42 | Asea Uninet Scientific and Plenary Meeting 2016 oNPG release of oNP kcat/Km (mM-1 s-1) 7.4 ± 1.9 25 ± 4 vmax,oNP (µmol min-1 mg1 ) 486 ± 9 188 ± 3 Km,oNP 1.3 ± 0.1 0.67 ± 0.07 kcat (s-1) 939 ± 7 364 ± 6 kcat/Km (mM-1 s-1) 722 ± 66 543 ± 65 Effect of pH, Temperature and Cations on Enzyme Activity Both oNPG and lactose were used as substrates to determine the pH optimum of -gal I and -gal II activity. The pH optimum of -gal I is pH 7.0 for both oNPG and lactose hydrolysis. -gal I has a half-life time of activity (1/2) of approximately 5 h when incubated at pH 7.0 and 37°C. The pH optimum of β-gal II is pH 6.5 for both oNPG and lactose hydrolysis. A profile of pH stability was also determined for both enzymes which were found to be most stable between pH 6.0 – 7.0 while the stability of both enzymes rapidly dropped at pH values below 6.0 or above 8.0. When incubated at pH 5.0 for 10 min, -gal I showed no residual activity while -gal II lost 80% of its activity. Both enzymes also showed their stability at 30°C with half-life time of activities (τ1/2) of 73 and 109 h for βgal I and β-gal II, respectively. At all temperature tested, stability of both enzymes was significantly improved in the presence of 1 mM MgCl2 Calorimetric studies on the thermal denaturation of -gal I and gal II were performed using DSC. Both enzymes showed a single endothermic peak in the DSC scan which fitted very well on the basis of a two-state transition model. The observed melting temperatures Tm, 49.97 and 55.58 °C for -gal I and -gal II are in excellent agreement with the optimum temperatures of these two enzymes. The effects of mono- and divalent cations on the activity of the recombinant enzymes were tested in Bis-Tris buffer, pH 6.5. Addition of Na+ and K+ ions showed significant increase on β-gal II activity confirming requirement of these monovalent cations for catalytic activity of the enzyme (Table 2). In contrast, Na+ ion did not significantly affect the catalytic activity of β-gal I whereas addition of K+ resulted in significant loss of its activity in comparison to the control. Addition of 1 mM Mg2+ did not show any significant increase in the activity of both enzymes and a further increase in the Mg2+ concentration to 10 mM gave a slight negative effect on the activity of both enzymes. All other ions (Ca2+, Fe2+ and Zn2+) tested showed inhibitory effect on the enzyme activity especially at higher concentrations. Asea Uninet Scientific and Plenary Meeting 2016 | 43 Table 2. Effect of cations on B. breve β-galactosidases activity in 10 mM Bis-Tris buffer (pH 6.5) relative activity (%) β-gal II β-gal I 1 mM 10 mM 1 mM 10 mM Blank (none) 100 100 100 100 Na+ 102 102 319 483 K+ 87 26 166 232 Mg2+ 100 79 101 93 Ca2+ 73 27 81 70 Fe2+ 67 6 42 26 Zn2+ 16 < 0.10 70 14 Production of GOS and HeOS Discontinuous conversion reactions were carried out to determine the transgalactosylation activity of the recombinant B. breve β-gal I and β-gal II. Highest total GOS yields of 33% and 44% were obtained when β-gal I and β-gal II were used with an initial lactose concentration of 200 g L-1. The conversions were performed with this initial lactose concentration based on the solubility of lactose at ambient temperature. An increase in reaction temperature would help to increase the solubility of lactose; however this was not possible since both enzymes lack sufficient stability above 30°C. When the concentration of β-gal II was increased to 2.5 ULac mL-1, the maximum GOS yield of β-gal II was increased to 44% of total sugars and the time to reach the maximum yield was reduced to 6 h. The maximum GOS yield obtained with β-gal II is comparable to the reported yields obtained with other β-galactosidases from Bifidobacterium spp., (Rabiu, Jay, Gibson, & Rastall, 2001; Yi, Alli, Park, & Lee, 2011) however initial lactose concentration for GOS production was 30% (w/w). Studies have shown that the initial lactose concentration has a significant positive effect on GOS yields (Mahoney, 1998; Splechtna, Nguyen, & Haltrich, 2007) The predominant oligosaccharide product was identified as β- D-Galp-(1→6)-DGlc (allolactose), accounting for approximately 45% and 50% of the GOS formed by β-gal I and β-gal II, respectively, at maximum total GOS yield (Table 3). The trisaccharide, β- DGalp-(1→3)-D-Lac was identified to be second main product of transgalactosylation. Both enzymes show preference towards β-(16)-bond formation during intramolecular transgalactosylation while β-(13) is the more preferred linkage during intermolecular transgalactosylation. After the maximum GOS yield point, the concentration of GOS decreased because they are also hydrolyzed. 44 | Asea Uninet Scientific and Plenary Meeting 2016 Table 3. Oligosaccharide components (% w/w of total sugars) of GOS mixtures obtained with two recombinant B. breve β-galactosidases β-gal I β-gal II 30.4 43.9 D-Galp-(16)-D-Glc 13.7 22.7 D-Galp-(16)-D-Gal 0.4 1.8 D-Galp-(13)-D-Gal 1.7 1.5 D-Galp-(13)-D-Glc 0.6 2.7 D-Galp-(13)-Lac 9.8 7.2 D-Galp-(14)-Lac 0.2 1.4 D-Galp-(16)-Lac 0.7 1.9 Others 3.2 5.0 Lactose Conversion 70% 84% Total GOS The intermolecular transfer of galactose to acceptors other than water typically presents the major pathway for the formation of GOS. The partitioning of galactosylated enzyme between the reaction with water, hence hydrolysis, and the reaction with the other nucleophiles present in the solution can be studied under defined initial velocity conditions. A simple equation (Equation 1) was developed to determine the ability of different nucleophiles to act as galactosyl moiety acceptor which in turn allows an estimation of the transgalactosylation products obtained (Petzelbauer, Kuhn, Splechtna, Kulbe, & Nidetzky, 2002; Petzelbauer, Splechtna, & Nidetzky, 2001, 2002; Richard, Westerfeld, Lin, & Beard, 1995). The kGlc/kwater of β-gal I and β-gal II was found to be 6.73 and 3.91, respectively while when lactose alone was used as substrate, β-gal I showed higher kLac/kwater than of βgal II. When kGlc/kLac was determined (obtained from the ratio of kGlc/kwater to kLac/kwater ), βgal I and β-gal II showed ratios of 7.4 and 4.2, respectively suggesting that glucose is a better galactosyl acceptor than lactose. Hence, disaccharides other than lactose will make Asea Uninet Scientific and Plenary Meeting 2016 | 45 up a large portion of GOS mixtures produced by these two bifidobacterial enzymes. Our previous study confirms that indeed glucose is a better acceptor than lactose when looking at the ratio of total GalGlc disaccharides to GalLac trisaccharides formed. When looking at the process of HeOS production that mimic human milk oligosaccharides (HMO), the main candidates for galactosyl acceptors are the substrate lactose, and the primary hydrolysis products D-glucose and D-galactose, GlcNAc, GalNAc and Fuc. To establish the kNu/kwater with either GlcNAc, GalNAc and Fuc as the nucleophile, a fixed initial lactose concentration (100 mM) as galactosyl donor and the respective nucleophile in varying concentration as galactosyl acceptor were employed. The kGalNAc/kwater and kFuc/kwater were found to be ≤ 1.0 M-1 for β-gal I and β-gal II suggesting that GalNAc and Fuc are weak nucleophilic acceptors. On the other hand, β-gal II showed higher preference to transfer the galactosyl moiety to GlcNAc rather than to water (kGlcNAc/kwater = 5.42) and to lactose (kGlcNAc/kLac = 10.23) suggesting that the disaccharide GalGlcNAc will be the main products rather than tri-GOS or other GOS when using mixture of GlcNAc and lactose as substrate. The N-acetyl-oligosaccharides production of β-gal II with lactose and GlcNAc as substrates was also investigated using a discontinuous batch reaction. Results showed that the maximum molar yield of total N-acetyl oligosaccharides produced was 32% after 8 h. After these maximum yield points, the concentration of GlcNAc-containing oligosaccharides decreased as they are also subject to hydrolysis. The HPLC profile also showed that both di- and trisaccharides containing GlcNAc were formed however, the individual components were not yet structurally identified or quantified. 4 CONCLUSIONS Two GH2 β-galactosidases from B. breve DSM 20213, β-gal I and β-gal II, were studied in detail regarding their biochemical properties and distribution of oligosaccharides formed during transgalactosylation mode. Kinetic studies analyses with various sugars as nucleophile provided a view of the specificities of these two enzymes for GOS and HeOS formation. Both enzymes were found to be well-suited for the production of GOS while βgal II was found to have higher yields of N-acetyl oligosaccharides. A detailed knowledge about the properties of these two enzymes can serve as the basis for various food-related applications. REFERENCES Arreola, S. L., Intanon, M., Suljic, J., Kittl, R., Pham, N. H., Kosma, P., Haltrich, D., & Nguyen, T. H. (2014). Two beta-galactosidases from the human isolate Bifidobacterium breve DSM 20213: molecular cloning and expression, biochemical characterization and synthesis of galacto-oligosaccharides. PLoS One, 9(8), e104056. Barclay, T., Ginic-Markovic, M., Cooper, P., & Petrovsky, N. (2010). Inulin - a versatile polysaccharide with multiple pharmaceutical and food chemical uses. Journal of Excipients & Food Chemicals, 1(3), 27-50. Barreteau, H., Delattre, C., & Michaud, P. (2006). Production of oligosaccharides as promising new food additive generation. Food Technology and Biotechnology, 44, 323-333. Boon, M. A., Janssen, A. E., & van 't Riet, K. (2000). Effect of temperature and enzyme origin on the enzymatic synthesis of oligosaccharides. Enzyme Microb Technol, 26(2-4), 271-281. 46 | Asea Uninet Scientific and Plenary Meeting 2016 Collins, J. K., Thornton, G., & Sullivanc, G. O. (1998). Selection of Probiotic Strains for Human Applications. International Dairy Journal, 8(5-6), 487–490. Depeint, F., Tzortzis, G., Vulevic, J., I'Anson, K., & Gibson, G. R. (2008). Prebiotic evaluation of a novel galactooligosaccharide mixture produced by the enzymatic activity of Bifidobacterium bifidum NCIMB 41171, in healthy humans: a randomized, double-blind, crossover, placebo-controlled intervention study. Am J Clin Nutr, 87(3), 785-791. Gänzle, M. G. (2012). Enzymatic synthesis of galacto-oligosaccharides and other lactose derivatives (hetero-oligosaccharides) from lactose. International Dairy Journal, 22(2), 116-122. Gibson, G. R., Probert, H. M., Loo, J. V., Rastall, R. A., & Roberfroid, M. B. (2004). Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutr Res Rev, 17(2), 259-275. Gosling, A., Stevens, G. W., Barber, A. R., Kentish, S. E., & Gras, S. L. (2010). Recent advances refining galactooligosaccharide production from lactose. Food Chemistry, 121, 307-318. ISAPP. (2008). 6th Meeting of the International Scientific Association of Probiotics and Prebiotics. London, Ontario. Klaenhammer, T. R., Kleerebezem, M., Kopp, M. V., & Rescigno, M. (2012). The impact of probiotics and prebiotics on the immune system. Nat Rev Immunol, 12(10), 728734. Mahoney, R. R. (1998). Galactosyl-oligosaccharide formation during lactose hydrolysis: A review. Food Chemistry, 63(2), 147-154. Nakayama, T., & Amachi, T. (1999). Beta-galactosidase, enzymology. In M. C. Flickinger & S. W. Drew (Eds.), Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bioseparation. (Vol. 3, pp. 1291-1305). New York: John Willey. Nguyen, T.-H., Splechtna, B., Steinböck, M., Kneifel, W., Lettner, H. P., Kulbe, K. D., & Haltrich, D. (2006). Purification and characterization of two novel betagalactosidases from Lactobacillus reuteri. J Agric Food Chem, 54(14), 4989-4998. Petzelbauer, I., Kuhn, B., Splechtna, B., Kulbe, K. D., & Nidetzky, B. (2002). Development of an ultrahigh-temperature process for the enzymatic hydrolysis of lactose. IV. Immobilization of two thermostable β-glycosidases and optimization of a packedbed reactor for lactose conversion. Biotechnol Bioeng, 77, 619-631. Petzelbauer, I., Splechtna, B., & Nidetzky, B. (2001). Galactosyl transfer catalyzed by thermostable beta-glycosidases from Sulfolobus solfataricus and Pyrococcus furiosus: kinetic studies of the reactions of galactosylated enzyme intermediates with a range of nucleophiles. J Biochem, 130(3), 341-349. Petzelbauer, I., Splechtna, B., & Nidetzky, B. (2002). Development of an ultrahightemperature process for the enzymatic hydrolysis of lactose. III. Utilization of two thermostable β-glycosidases in a continuous ultrafiltration membrane reactor and galacto-oligosaccharide formation under steady-state conditions. Biotechnol Bioeng, 77(4), 394-404. Rabiu, B. A., Jay, A. J., Gibson, G. R., & Rastall, R. A. (2001). Synthesis and fermentation properties of novel galacto-oligosaccharides by beta-galactosidases from Bifidobacterium species. Applied and environmental microbiology, 67(6), 25262530. Richard, J. P., Westerfeld, J. G., Lin, S., & Beard, J. (1995). Structure-reactivity relationships for β-galactosidase (Escherichia coli, lac Z). 2. Reactions of the galactosyl-enzyme intermediate with alcohols and azide ion. Biochemistry, 34(37), 11713-11724. Asea Uninet Scientific and Plenary Meeting 2016 | 47 Roberfroid, M. (2007). Prebiotics: the concept revisited. J Nutr, 137(3 Suppl 2), 830S837S. Sako, T., Matsumoto, K., & Tanaka, R. (1999). Recent progress on research and applications of non-digestible galacto-oligosaccharides. International Dairy Journal, 9, 69-80. Splechtna, B., Nguyen, T. H., & Haltrich, D. (2007). Comparison between discontinuous and continuous lactose conversion processes for the production of prebiotic galacto-oligosaccharides using beta-galactosidase from Lactobacillus reuteri. J Agric Food Chem, 55, 6772-6777. Splechtna, B., Nguyen, T. H., Steinbock, M., Kulbe, K. D., Lorenz, W., & Haltrich, D. (2006). Production of prebiotic galacto-oligosaccharides from lactose using βgalactosidases from Lactobacillus reuteri. J Agric Food Chem, 54(14), 4999-5006. Yi, S. H., Alli, I., Park, K. H., & Lee, B. (2011). Overexpression and characterization of a novel transgalactosylic and hydrolytic β-galactosidase from a human isolate Bifidobacterium breve B24. New Biotechnology, 28(6), 806-813. CONSISTENCY ANALYSIS OF MAPPING SYSTEM OF NOISE SPECTRAL FLUCTUATIONS IN MULTIFREQUENCY USING TWO-DIMENSION DISCRETE WAVELET TRANSFORM (2D-DWT) Melinda imel.elektro@gmail.com Agus Santoso Tamsir agus.tamsir@gmail.com Dadang Gunawan guna@eng.ui.ac.id3 Dodi Sudiana dodi.sudi@gmail.com Department of Electrical Engineering, Faculty of Engineering, University of Indonesia Kampus Baru UI, Depok 16424 Yuwaldi Away yuwaldi@gmail.com University of Syiah Kuala5 Universitas Syiah Kuala, Indonesia Abstract The development of sensor technology is growing rapidly, one of this applications is impedance spectroscopy that perform the multi-spectral approach and also has non-destructive characteristic, complex data analysis, and measuring a relatively quick and accurate. Based on the preliminary research, which has been done by using the principle of impedance spectroscopy, noise signal is modified into multi-spectral with the object is water. Here, each spectral frequency input will be analyzed. However, the data is still not consistent that can be seen from the result of fluctuation pattern MF (Mean Fluctuation), HF (High Fluctuation), HMF (High Mean Fluctuation) and HHF (High Mean Fluctuation). Data is displayed in the form of 2dimensional images which have size in the matrix. This study aims to analyze the consistency of measurement data in the mapping system of fluctuation noise spectral of multi-frequency on the materials of purified water, which consist of 4 categories fluctuation patterns: MF (Mean Fluctuation), HF (High Fluctuation), HMF (High Mean-Fluctuation) and HHF (High HighFluctuation). 2D-DWT (Two-Dimension - Discrete Wavelet Transform) wavelet method will be used for feature extraction. Therefore, it can process the results from the fluctuation pattern obtained in the form of 2D image and also data in large quantities. Thus, the extraction will Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 48 Asea Uninet Scientific and Plenary Meeting 2016 | 49 reduce the value on the matrix without losing the real value at the actual data. Moreover, analysis was performed on 150 of pure water of data measurement using disturbing frequency at 0 Hz and 0.5 KHz, respectively The results show that the data consistency will be stable at the value of Approximation level 2 (A2). In addition, the result obtained suggest, which is the approximation of level 2 (A2) coefficient can uniquely represents the different fluctuation types. Keywords: data consistency, two-dimension discrete wavelet transform, fluctuation 1 INTRODUCTION Sensor technology is growing over the years, in which the sensor research is still a great theme and involve a variety of disciplines. Some sensor applications will continue to grow and mastery of this technology will be indispensable for detecting various parameters in nature, one of which was to identify the water. The research that conducted is a multidisciplinary research, which are include impedance spectroscopy (Air et al., 2015) and features extraction (Guyon & Elisseeff, 2006) . In addition, the sensor used is not destructive (non-destructive), it means that the material is measured will not in direct contact with the sensor used and do not disturb as well. Preliminary research has been done by using the principle of impedance spectroscopy noise signal that is modified by multispectral with the object is water. Under the above circumstances, we need a method that is able to identify the ingredients of water based on the pattern of a database containing results 2D graphics, which shows the image fluctuation pattern of the material being measured, namely MF (Mean Fluctuation), HF (High Fluctuation), HMF (High Mean-Fluctuation) and HHF (High High-Fluctuation). Based on the results of fluctuation pattern and will be shown in the next part, it was found that the results of the measurement data are still not stable and inconsistent. There are some differences with fluctuations less evenly between the data among water material at the same measurement. This study will perform feature extraction or pattern characteristic of the water in order to obtain the characteristic or unique characteristics of the water fluctuation patterns that have not been consistent and will make it easier to identify. Based on some research methods that have been done by (Fatima, Sarvepalli, & Nakhi, 2007), (Dimitroulakos, Galanis, Milidonis, & Gouti, 2005), (S, 2014) , there were many of image feature extraction process. However, the extraction process will be applied in this study aimed to: 1) 2) 3) 4) Data obtained in previous studies have not been consistent, therefore, for further processing of the data will be extracted without losing its basic form. Extraction is essential to acquire the unique features or characteristics from the pattern of the material being measured, which in this study material is water and Lampung Land’s mine. There are quite large amounts of data that obtained from the measurement, so it is necessary to compress by doing the extraction process and the result is simply unique and necessary data can be processed further. The extraction process can distinguish between the patterns of fluctuation of water with other water fluctuation pattern and each of them has the 50 | Asea Uninet Scientific and Plenary Meeting 2016 unique characteristics and can be a reference in the subsequent identification process. Extraction will be used in this research is a kind of 2D-DWT. Have been many studies that have been conducted by previous researchers related to the extraction of features such as (Sutarno, 2010), (Błażewicz, Ciżnicki, & Kopta, 2012), (Imtiaz & Fattah, 2012), (Materka, 2001) , in which the researchers this study is going to apply 2D-DWT (Two Dimensional Discrete Wavelet Transform) to do extraction for fluctuation pattern. It is used the JPEG image form the water materials that are tested. It distinguishes the research that has been done with several related research of feature extraction. Here, the research will be done by using the results from sensors 4E after passing through preprocessing stage that will be explained clearly in the next part. Furthermore, the data is not the image but rather in the form of a matrix with a 2D image, the size of the matrix is [31 x 8193]. The extraction process will also be carried out for all four categories fluctuations: MF, HMF, HF and HHF. This paper will be divided into several parts: the first part contains the background of research, followed by the theory of 2D DWT. The next part is the research methodology and then will describe some of the results obtained and discussion. The last part is the conclusion of research results obtained. 2 TWO DIMENSION-DISCRETE WAVELET TRANSFORM (2D-DWT) There are several categories of wavelets used for image processing, but in this study will use the categories of discrete wavelet transform with 2-dimensional or 2D-DWT (Materka, 2001) . Basically 2D-DWT is a generalization of the 1-D wavelet transform (Barford, Fazzio, & Smith, 1992) . This transformation signal is divided into two parts: the high frequency and low frequency and filtered by Low Pass Filter (LPF) and High Pass Filter (HPF). Furthermore, the high frequency will be divided back into low frequency and high frequency and continue to be made until decomposed at a level that enables and improved signal back to the Inverse Discrete Wavelet Transform (IDWT). Wavelet function for 2-D DWT can be obtained by multiplying two wavelet functions and scaling function of 1D analysis. There are 3 functions for 2D-DWT are: horizontal (H), vertical (V) and diagonal (D) (Barford et al., 1992) . DWT consists of log2N stages, where the signal s is the length N. The first step is to produce two sets of coefficients, which are coefficients of approximation CA1 and detail coefficients CD1. These vector are obtained from the convolution s with LPF and HPF, Lo_D for approximation and Hi_D to detail, for more details, it can be seen in Figure 1. Asea Uninet Scientific and Plenary Meeting 2016 | 51 Figure 1. The initial process of DWT (Mallat, 1999) The length of each filter is equal to 2L, then the long convolution filter signal N to the length of 2L is N + 2L-1, then after downsampling by 2, the coefficient vector CA1 and CD1 become to: cDk( h ) , cDk( v ) , cDk( d )  (1) The next step is to enter CA1 approximation coefficients into two parts using the same scheme to replace s by CA1 and it will produce CA2 and CD2 and so on. Moreover, there is a schematic that illustrates the basic stages of decomposition and reconstruction for the 2D-DWT image that will be used in this study that is shown in Figure 2. 52 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 2. Steps in the 2D-DWT decomposition (Mallat, 1999) Figure 2 shows the image, which is processed on the 2D-DWT decomposition level 1, then, it will produce 4 sub-bands as follows: 1) 2) 3) 4) Sub-band LL (Low-Low) for Approximation coefficient (CAJ + 1) Sub-band HL (High-Low) for Horizontal Details coefficient (Cd (h) j + 1) Sub-band LH (Low-High) for Vertical Detail coefficient (Cd (v) j + 1) Sub-band HH (High-High) for Diagonal Details coefficient (Cd (d) j + 1) Decomposition can be performed again for the next level because the wavelet level is 1 to n. If the decomposition performed on the sub-band LL 4 and then the sub-band will generate new one level with: • LL2: approximation coefficients of 2 • HL2: horizontal detail coefficients of 2 • LH2: vertical detail coefficients of 2 • HH2: diagonal detail coefficient of 2 Asea Uninet Scientific and Plenary Meeting 2016 | 53 Decomposition can be carried on until the desired level as shown in Fig. 3. LL2 HL2 LH2 HH2 HL1 LH1 HH1 Figure 3. Decomposition of level 2 3 RESEARCH METHOD Stages of the research that is conducted in this study can be seen in Figure 4. First of all, the process begins at data acquisition by using sensor 4 electrode. Then, it followed by preprocessing in order to produce 4 different types of fluctuation. Both of these stages have been done previously. Furthermore, there will be feature extraction process. In this work, we have considered to employ the 2D-DWT as a potential approach for extract feature. Lastly, there will be analysis and discussion related to the result obtained. Off all the stages are going to be explain quite detail in the next part of the method proposed. Data aqcuisition preprocessing feature extraction analysis & conclusion Figure 4. Proposed Method 3.1 Stages of Data Acquisition Data acquisition process has been done in previous studies by other researchers that aims to identify the materials that have been measured using a capacitive sensor 2 pairs of electrodes with multi-spectral. The scheme of data acquisition can be seen in the figure 5. Figure 5. Scheme of the Acquisition Data 54 | Asea Uninet Scientific and Plenary Meeting 2016 As highlighted in the figure 5, in the proses of data acquisition, firstly, this process is started with the identification circuit series using sensors 4 Electrodes. Then, the captured data will be stored in DSO (Digital Storage Oscilloscope). Here, DSO is controlled by the PC (Personal Computer), and is used to store data after pass through the circuit of 4E sensor. 3.2 Stages of Preprocessing In this study, the preprocessing stage is a stage of processing the data that has been obtained in the process of the acquisition data. This was done to facilitate the next process, which is the extraction process. At the stage of preprocessing, the data obtained will be divided into 4 types category of different fluctuations, namely: (1). HF (High Fluctuation) (2). HHF (High High Fluctuation) (3). MF (Mean Fluctuation), (4) HMF (High Mean Fluctuation). Based on the results of data acquisition, then the preprocessing stage has obtained data have been grouped based material, the amount of data obtained and perturbation frequency used in the experiments as shown in Table 1 Table 1. Result from preprocessing stage Frequency No 1. (KHz) Number of Data 0 150 0.5 300 Material Type of Fluctuation Category MF, HF,HMF, HF Pure water MF, HF,HMF,HHF Furthermore, we are concern to process 2 types of fluctuation pattern, which are MF and HF. These are because, both of these two categories are the core or base of fluctuations generated in the data processing, whereas HMF and HHF represent the result of fluctuations which clarify or reinforce the results of fluctuations of MF and HF with containing M x N matrix of [31x8193]. The pattern of these 4 types of fluctuation categories (HF, MF, HHF, and HMF) can be seen in the figure 6, 7, 8, 9, respectively. Figure 6. High Fluctuation(HF) category of 150 data at perturbation frequency of 0.5 KHz (pure-water) Figure 7. Mean Fluctuation (MF) category of 150 data at perturbation frequency of 0.5 KHz (pure-water) Asea Uninet Scientific and Plenary Meeting 2016 Figure 8. High High-Fluctuation (HHF) category of 150 data at perturbation frequency of 0.5 KHz (pure-water) 3.3 | 55 Figure 9. High Mean Fluctuation (HMF) category of 150 data at perturbation frequency of 0.5 KHz (purewater) Stages of Feature Extraction The extraction process or characteristic features serve to reduce the size of a data without changing the characteristics of the images. This research employs method of 2D-DWT as a potential process of extraction feature. Generally, the implementation of 2D DWT applies the mother wavelet such as Haar, Meyer, Morlet, Bior and Coiflet (Hawari, Mansor, & Hussain, 2007) . However, this study are considering to employ Bior 3.7 mother wavelet to extract a new set of feature based on the 2D-DWT with coefficient approximation of level 2 (A2). There are several steps in the process of feature extraction will be done with 2DDWT, where the input data for the extraction process will be applied equally to the 2 categories of data fluctuation (MF and HF). In this process, data input was originally obtained from previous studies that produce 2D graphics with the size of the matrix. This kind of matrix contains the average values (mean) and standard deviations that are different for each category of fluctuations in the size of the matrix of [31 x 8193]. Based on this result, it can differentiate the inputs that are used in this research with several previous studies related to the extraction process, which is generally used the input in the image form and has been converted into image or JPEG. Feature extraction produces approximation level 2 or A2. 2D-DWT algorithms that will be used are modified from (Mallat, 1999) , as follows: 3.4 Inilitialization stage 1. Load image HF atau MF with the size of the matrix [31x8193] 2. Then, transpose matrix 3.5 Decomposition stage 3. Perform the single-level wavelet decomposition using wavelet bior3.7. Serves to generalize the coefficient matrix at level-1 with approximation [CA1], horizontal [CH1], vertical [CV1] and diagonal [CD1]. 4. Perform construction and then show approximation detail of each coefficient. 56 | Asea Uninet Scientific and Plenary Meeting 2016 Where to reconstruct level-1 approximation and detail of [A1, H1, V1, D1] from the coefficient [CA1, CH1, CV1, CD1]. Furthermore, the results show the decomposition level 1 for every detail. 5. Perform regeneration with single-level image of the inverse wavelet transform. By using the command: Xsyn = idwt2[cA1, cH1, cV1, cD1,’bior3.7’]; This is a reconstruction of the original image or the synthesis of a level-1, approximation coefficients and detail. 6. Decomposed multilevel wavelet (level 2) using bior 3.7 wavelet by: [C,S]= wavedec2 (X,2,’bior3.7’); Where X : original image 2 : decomposition level The coefficients of all the components at decomposition level 2 are returned to the relationship in one vector C. 3.6 Extraction stage 7. Perform extraction approximation of coefficients in detail. To extract the level 2 approximation coefficients of C, do: cA2 = appcoef2(C,S,’bior 3.7,2); Perform extraction levels 1 and 2 of the detail coefficients of C, where the argument for (h, v and d) shows the type of detail from the (horizontal, vertical and diagonal) which will extract at what level is. 3.7 Reconstruction stage 8. Perform reconstruction for at detail and approximation of the level 2 9. Show the results on multilevel decomposition. 10. Run back to the original image reconstruction from the decomposition of multilevel 11. Do compressed image and show the results 12. Finish. 4 SIMULATION RESULT AND DISCUSSION Based on the research that has been done, it has obtained some results of the experiment. The results are shown in the Table 2. The material used is pure water with the results of preprocessing are two types of fluctuations, the MF and HF. Frequencies perturbation that are used are 0 KHz and 0.5 KHz for both types of these fluctuations. The feature extraction coefficient, which is generated in this study is an approximation value of A1 and A2. The Asea Uninet Scientific and Plenary Meeting 2016 | 57 number of data obtained in the process of acquisition and preprocessing are 150 data for each category of fluctuations. In addition, the feature extraction process in this study uses Matlab R2013a for simulation. The focus of this research is to gain consistency of data from two types of fluctuations are the MF and HF. because both these categories are the core fluctuation that obtained from experiments for the average value fluctuation and the average fluctuation is high, while the category of HMF and HHF are fluctuation pattern that reinforce or clarify the results of fluctuations in the MF and HF. So for the next analysis only focused on MF (Mean Fluctuation) and HF (High Fluctuation) categories. Table 2. Fluctuation Category of the results obtained No 1. 2. 3. 4. Type of Material Pure water Pure water Pure water Pure water Type of Fluctuation MF HF MF HF Frequency Pertubation (KHz) 0 0 0.5 0.5 Number of Data 150 150 150 150 Result of coefficient extraction A1,A2 A1,A2 A1,A2 A1,A2 Furthermore, the next stage is to extract features from the chart pattern results of fluctuations in the MF and HF in the form of 2D containing matrix size of (31 x 8193). One of the reasons that we employ 2D-DWT for extracting feature because it can help to reduce the size of wavelet coefficient and also can produce a smaller size of feature vectors. The methods of 2D-DWT coefficients produce four categories, namely: the diagonal (D) coefficients, the horizontal (H) coefficient, the vertical (V) coefficient and the approximation (A) coefficient. This is because the method of 2D-DWT has two levels to the results obtained on the second level, which are called D2, H2, V2 and A2. However, the results A2 or approximation levels 2 are used as output of this measurement to be analyzed. The reason used approximation A2 as a result that will be used for segmentation stage because A2 is the result whose value is derived from the 2D-DWT to the low-frequency sub-bands (Low Pass Filter). Figure 10. Original image of MF category of 150 data at perturbation frequency of 0 KHz (pure-water) 58 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 11. Approximation Level 1 (A1) of MF category of 150 data at perturbation frequency of 0 KHz (purewater) Figure 12. Approximation Level 2 (A2) of MF category of 150 data at perturbation frequency of 0 KHz (purewater) Figure 13. Original image of HF category of 150 data at perturbation frequency of 0 KHz (pure-water) Asea Uninet Scientific and Plenary Meeting 2016 Figure 14. Approximation Level 1 (A1) of HF category of 150 data at perturbation frequency of 0 KHz (purewater) | 59 Figure 15. Approximation Level 2 (A2) of HF category of 150 data at perturbation frequency of 0 KHz (purewater) Figure 16. Original image of MF category of 150 data at perturbation frequency of 0.5 KHz (pure-water) 60 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 17. Approximation Level 1 (A1) of MF category of 150 data at perturbation frequency of 0.5 KHz (purewater) Figure 18. Approximation Level 2 (A2) of MF category of 150 data at perturbation frequency of 0.5 KHz (purewater) Figure 18. Original image of HF category of 150 data at perturbation frequency of 0.5 KHz (pure-water) Asea Uninet Scientific and Plenary Meeting 2016 Figure 19. Approximation Level 1 (A1) of HF category of 150 data at perturbation frequency of 0.5 KHz (purewater) | 61 Figure 20. Approximation Level 2 (A2) of HF category of 150 data at perturbation frequency of 0.5 KHz (purewater) As aforementioned before, the implementation of 2D-DWT generates 4 coefficient values of level 2 that follow the same size as the original images. In other word, the size of the wavelet coefficients gained will be the same as the images that have the size of matrix are (31x 8193). Here, we only employ the value of approximation of level 2. The results from previous studies that found in the original images preprocessing are divided into two types of two fluctuations categories, namely MF and HF. Figure 10 and figure 16 show the original image of MF categories, while the original image of HF category can be seen in the figure 13 and figure 18. Of all these results have perturbation frequencies, which are 0 KHz and 0.5 KHz. However, the used of these kinds of frequencies aim to create a resonance effect on the results obtained. As a result, they can generate the resonance influence on the material being measured. Based on the results of the original image, it will be resumed the next process, which is the feature extraction process by applying 2D-DWT. Extraction results for the category MF and HF will be conducted at the level 1 and 2, namely approximation 1 (A1) and approximation 2 (A2). This is done in order to gain the differences between these two of different level of approximation. The images extraction results for the MF and HF categories of approximation level 1 with perturbation frequency of 0 kHz can be seen in Figure 11 and Figure 14. As for the perturbation frequency of 0.5 KHz with the same categories are shown in Figure 17 and figure 19. The results of approximation coefficient of level 2 for the categories of MF and HF with perturbation frequency of 0 kHz are exhibited in Figure 12 and figure 15. Furthermore, figure 18 and figure 20 display the results of the approximation of level 2 (A2) categories of MF and HF by applying perturbation frequency of 0.5 KHz. From the results obtained for the approximation at level 1 and level 2, it is noticeable to discuss that they show different results on their matrix values. Therefore, the matrix values of the approximation of level 2 have greater values of the maxima and the minima than that of approximation of level 1. Interestingly, this phenomenon can be seen in the figure of approximation of level 2 (A2), which are clearer and sharper image when compared to the results of the approximation A1. Therefore, the results of approximation 62 | Asea Uninet Scientific and Plenary Meeting 2016 A2 have unique shape that can represent the results of the original image and can be used as input to the next process in the next study. 5 CONCLUSION Briefly, it can be concluded that 2D-DWT, as a feature extraction technique, has quite great potential method to produce a unique the extracted feature sets, which is represent the different types of fluctuation (Mean fluctuation and High Fluctuation). As a result, application of 2D-DWT wavelet coefficients with the approximation level 2 (A2) produces sharper images and clearer compare to approximation of level 2. In addition, A2 has range maxima and minima values greater than that of A1 and also it represents an interpretation of the original image. Future work is going to do segmentation technique for the result of approximation level 2(A2) in order to improve the feature extraction. REFERENCES Air, I., Sistem, D., Derau, P. F. M., Kapasitif, M. S., Kualifikasi, P. P. R. A., Teknik, F., … Elektro, T. (2015). UNIVERSITAS UNIVERSITAS INDONESIA INDONESIA IDENTIFIKASI AIR DENGAN SISTEM. Barford, L. A., Fazzio, R. S., & Smith, D. R. (1992). An introduction to wavelets, 2, 1–18. Błażewicz, M., Ciżnicki, M., & Kopta, P. (2012). Two-Dimensional discrete wavelet transform on large images for hybrid computing architectures: GPU and CELL. Euro-Par 2011: Parallel …. Retrieved from http://link.springer.com/chapter/10.1007/978-3-642-29737-3_53 Dimitroulakos, G., Galanis, M. D., Milidonis, A., & Gouti, C. E. (2005). A highthroughput, memory efficient architecture for computing the tile-based {2D} discrete wavelet transform for the {JPEG2000}. Integration, the VLSI Journal, 39(1), 1–11. http://doi.org/10.1016/j.vlsi.2004.11.002 Fatima, K., Sarvepalli, V. G., & Nakhi, Z. N. (2007). A Novel Architecture for the Computation of the 2D-DWT. 2007 International Conference on Computational Intelligence and Security CIS 2007, 531–535. http://doi.org/10.1109/CIS.2007.172 Guyon, I., & Elisseeff, A. (2006). An introduction to feature extraction. Feature Extraction, Foundations and Applications, 24. http://doi.org/10.1007/978-3-540-35488-8_1 Hawari, K., Mansor, M. F., & Hussain, A. (2007). Feature Extraction Technique using Discrete Wavelet Transform for Image Classification. Image (Rochester, N.Y.), (December), 5–8. Imtiaz, H., & Fattah, S. A. (2012). A Wavelet-Domain Local Dominant Feature Selection Scheme for Face Recognition. ISRN Machine Vision, 2012, 1–13. http://doi.org/10.5402/2012/976160 Mallat, S. (1999). A Wavelet Tour of Signal Processing. A Wavelet Tour of Signal Processing, 20–41. http://doi.org/10.1016/B978-012466606-1/50004-0 Materka, A. (2001). Discrete Wavelet Transform – Derived Features for Digital Image Texture Analysis, (September), 163–168. S, S. G. C. (2014). Image Compression and Denoising Effects using Wavelets, 2, 1–4. Sutarno. (2010). Identifikasi Ekspresi Wajah Menggunakan Alihragam Gelombang Singkat (Wavelet) dan Jaringan Syaraf Tiruan Learning Vector Quantization (LVQ). Universitas Sriwijaya Indralaya, 2010(semnasIF), 87–94. A SEQUENTIAL HYPOTHESIS TESTING OF MULTIMODAL CARDIAC ANALYSIS Nada Fitrieyatul Hikmah nada13@mhs.ee.its.ac.id* Electrical Engineering Department Achmad Arifin arifin@bme.its.ac.id Tri Arief Sardjono sardjono@bme.its.ac.id Biomedical Engineering Department, Institut Teknologi Sepuluh Nopember (ITS) Surabaya, Indonesia Eko Agus Suprayitno eko.agus@umsida.ac.id Department of Electrical Engineering, Universitas Muhammadiyah Sidoarjo, Indonesia Abstract Focus of our research group is development of integrated cardiac analysis system. A measurement and analysis system of cardiovascular system can be realized in an integrated system that includes all cardiac vital signs [1]. We have tested a signal processing framework of multimodal cardiac signals, electrocardiogram, carotid pulse, and phonocardiogram of normal subjects [2]. This paper describes a follow up effort in analysis and classification of heart conditions. Multimodal cardiac signals were recorded from 20 normal and 3 abnormal subjects. The measurements were performed after obtaining the consent of subjects. The data were recorded using a special instrument designed by our group, and digitized with 1 kHz sampling frequency. The recordings were performed in 10 trials, with 5 second for each trial. Parameters of the cardiac signals were extracted. Sequential hypothesis testing [3] was used in classification stage to produce a diagnosis of normal and abnormal heart based on the extracted parameters. The overlapping problem was solved by selecting two thresholds, upper and lower, resulted in no decision taken while the value of data tested was in the overlapping zone. The results of normal subjects showed that 90% of the data were identified in the 3rd test and 100% of the data could be identified after the 4th test, while the abnormal subjects showed that 80% of data were identified in the 3rd test and 100% of the data could be identified after the 4th test. The classification result recommended the proposed method should be realized in clinical use. Keywords: multimodal signal analysis; sequential hypothesis; diagnosis. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 63 64 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION The measurement and analysis of cardiovascular system in the clinical level should have done by integrated system. Combining information of cardiac signals produced important interpretation for a cardiologist to decide patient heart condition. Fusion information refers on data combination based on various sources and used to improve accuracy of decision. In multimodal system, by using the same methods, it could improve diagnosis result that had more than two data source [4, 5, 6]. One of the studies related to decision-making about the heart condition written by Subbalakshmi [7]. Subbalakshmi in the journal entitled "Decision Support in Heart Disease Prediction System using Naive Bayes", proposed the concept of decision making based on data mining that was processed by Naive Bayes methods. Data mining is proposed intends to gather information from large amounts of data from an existing database and find the relationship patterns of data so that it was possible to improve the quality of decisionmaking in terms of the clinical. However, the concept offered has a disadvantage in terms of amounts of data and enforcement for patients who have no previous history. In the previous study, we had proposed digital signal processing of multimodal cardiac signal consisting of ECG, carotid pulse, and PCG signals in normal subjects [2]. Digital signal processing resulted in the extraction of cardiac parameters, including heart rate, QRS width, PR interval, QT interval, percussion-S2 interval, S1 and S2 width, also frequency spectrum of S1 and S2. This research describes the follow up effort of analysis and classification of cardiac conditions. Multimodal cardiac signals recorded from 20 normal and 3 abnormal subjects using special instrumentation designed by our research group. The recordings were performed in 10 trials, with 5 second for each trial. Simple method was proposed to detect normal and abnormal heart by parameter extraction of cardiac signals. Sequential hypothesis testing procedure developed by adding the test data until a decision was reached normal or abnormal heart. Sequential hypothesis testing procedure was intended for the system to determine normal and abnormal conditions of various cardiac parameters. Sequential hypothesis testing was used in this research because normal and abnormal rule of the system to be tested had rules with overlapping zone between normal and abnormal. The theory was based on the Wald sequential testing procedure [8]. The advantages of sequential hypothesis testing were the result of the classification could be updated in accordance with addition of new data tested and not required large amounts of data tested such as data mining system. The method used sequential hypothesis could determine the classification of the parameters that were in overlapping zone. Pattekari used Naive Bayesian method to predict patients with heart disease [9]. The research incorporated 15 medical attributes using Naive Bayesian to produce a probability. Naive Bayesian coud be used to compute the probability that a proposed diagnosed was correct, given that observation. However, the medical attributes from his research could not describe essential parameters of the heart and it was based on questionnaires system. In this research, the normal and abnormal probability of ECG, carotid pulse, and PCG signals were determined by using Naive Bayesian method. The parameters extraction, such as heart rate, QRS width, PR interval, and QT interval were incorporated for probability of ECG signal, percussion-S2 interval for probability of carotid pulse signal. Meanwhile, the probability of PCG signal was consist of S1 width, S2 width, also frequency spectrum of S1 and S2. The classification results based on parameter extraction multimodal cardiac signal is recommended to be applied in the clinical level. Asea Uninet Scientific and Plenary Meeting 2016 2 | 65 METHODS ECG, carotid pulse and PCG signal recorded directly from 20 normal subjects and 3 subjects abnormal with age range 23-62 years old. Each subject performed 10 times trial. ECG signal was recorded using electrodes placed on the right arm (RA), left arm (LA) and left leg (LL) based on first lead in Einthoven triangle rule. Carotid pulse signal was recorded using piezoelectric sensors in the left upper neck area, where carotid artery vessel was located. PCG signal was recorded directly on the subject using a Riester stethoscope which placed on the mitral area, that was the intercostal V. Third signal was recorded, then passed to the non-inverting adder circuit with the offset voltage was set at 1 Volt. This circuit was used to raise the voltage of the signal to be in the positive voltage range so that the signal could be read by ADC. The third analog signal was converted into a digital signal using an ARM microcontroller's internal ADC STM32F407 with a sampling frequency of 1 KHz. The digital signal was sent to the computer by serial communications. Data was stored in computers in the form of .txt format for the recording of the subject. The signal was processed using digital signal processing to obtain parameters extraction. Bayesian sequential hypothesis testing was used for the classification of normal and abnormal heart based on the extracted parameters. Bayesian sequential hypothesis testing algorithm consists of several steps that will be explained in the following subsection. 2.1 Rules for Each Parameters 1. Rules for ECG: Characteristics of a normal ECG signal can be categorized as normal sinus rhythm. Normal heart rhythm is controlled by the SA node (sinoatrial). This rhythm is called a normal sinus rhythm which in a state of basal trigger action potentials 60-100 bpm (beats per minutes). Characteristics of normal sinus rhythm [10] ,as follows : (a) (b) (c) (d) Beat : 60-100 bpm PR interval : 0.12-0.20 s QRS width : 0.05-0.11 s QT interval : <0.46 s Meanwhile, the abnormal of ECG signal [10], as follows : (a) (b) (c) (d) Beat : <60 bpm (bradycardia) >100 bpm (tachycardia) PR interval : <0,12 s (atrial tachycardia) >0.20 s (first degree AVBlock) QRS width : >0.10 s (idioventricular rhytm) QT interval : >0,46 s (hypokalemia) 2. Rules for carotid pulse: Carotid pulse signal can be used to determine heart sounds and abnormal heart sounds (murmurs). The first heart sound occurs just before the onset of the percussion wave in the carotid pulse signal and the second heart sound occurs shortly before or simultaneously with the onset of the dicrotic notch (D) wave in the carotid pulse signal. The carotid pulse signal was normal if the interval between percussion wave of the carotid pulse signal to S2 signal of PCG signal has a range of about 200 ms. This value obtained from the average value of normal subjects in previous study [2]. Meanwhile, the carotid pulse signal was abnormal if the interval between percussion wave to S2 signal has value over 200 ms. 66 | Asea Uninet Scientific and Plenary Meeting 2016 3. Rules for PCG: The interval between S1 and S2, and S2 to S1 in the next cycle usually has silent circumstances. In the state of abnormal heart, murmur can occur at the interval. Murmur is a high frequency noise that occur when high blood flow velocity due to flow through narrowed blood vessels which causes blood flow turbulence. S1 and S2 signal characteristic of normal PCG [11], as follows: (a) (b) (c) (d) S1 width : 0.04-0.20 s S2 width : 0.03-0.12 s S1 frequency : 100-150 Hz S2 frequency : 50-250 Hz Meanwhile, the abnormal of PCG signal [12], as follows : (a) (b) (c) (d) S1 width : >0.20 s (early aortic stenosis) S2 width : >0.12 s (late aortic stenosis) S1 frequency : >150 Hz (murmur) S2 frequency: >250 Hz (murmur) The next stage was to determine the probability density function of normal and abnormal rules for each parameters extraction. For example there is a random signal x(n) in certain intervals and consist of random variables for n = 0, 1, 2, ..., N. Occurence of each signal sample is determined by probabilistic density function (PDF). The distribution function is positive with an area equal to 1. The value of normal and abnormal PDF can be calculated using Equation (1), p1, 2 ( x)  1 2  1, 2 e ( x  1, 2 ) 2 / 2 12, 2 (1) Where x is parameter value, σ is standard deviation, µ is mean, the index 1 is normal status, and index 2 is abnormal status. In this research, the mean value was obtained from median value of each parameters rule and the standard deviation was obtained from the range of the median value to lowest or highest value of the rule. 2.2 Sequential Hypothesis Testing In this research, sequential hypothesis testing was used to determine normal and abnormal in each parameters. The first stage was determining the error probability value of normal and abnormal in each parameters. The error probability was represented by  and, which a single threshold  was chosen to distinguish normal and abnormal distribution. The value of  and  could be calculated with Equation (2) and (3). The  be the probability of rejecting HA when it is true,      2 exp     A  / 2 A2 d 2  A       1  (2) and  be the probability of rejecting HN when it is true,       1 2  N      2 exp     N  / 2 N2 d   (3) A single threshold comparison could generate high error rates because normal and abnormal distributions overlap considerably. This problem was solved by choosing two threshold, 1 and 2, where no decision was made if the data tested located in this Asea Uninet Scientific and Plenary Meeting 2016 | 67 overlapping intermediate zone. This is the idea behind Wald’s sequential test. The threshold 1 and 2 could be calculated by using Equation (4). 1  1  and  2   (4) 1 The probability ratio test was carried out by a consecutive observation of data tested, i.e. T1, T2, ... Tm. After a consecutive Tm testing, a sequential test being carried out, namely by getting the likelihood ratio f in Equation (5), f  where PT1 , T2 ,...Ti (7), P (T1 , T2 ,...Tm | N )  P (T1 , T2 ,...Tm | A)  P(T1 , T2 ,...Tm | N ) P (T1 , T2 ,...Tm | A) | N (5) and PT1 , T2 ,...Ti | A could be calculated using Equation (6) and  m N  1 exp  2  2 N  (T  m A  1 exp  2 2  A   (T 1 ( 2 ) m/2 (2 ) m/2 1 m i 1 i m i 1 i   N )2   (6)    A )2   (7) while PT1 , T2 ,...Ti | N  and PT1 , T2 ,...Ti | A value constitute a probability based on sequential observation of T1, T2, ... Tm. The hypothesis test was carried out after discovers the values of 1, 2, and likelihood. The HN hypothesis was accepted if f(Ti) ≥ 1 and the test stop. The HA hypothesis was accepted if f(Ti) ≤ 2 and the test stop. Meanwhile, if 2 < f(Ti) < 1, then no classified result, and process continued by enhancing the data tested until one of HA or HN was accepted. 2.3 Multimodal Decision of ECG, Carotid Pulse, and PCG Multimodal cardiac in this study constituted a combination of several cardiac parameters, ie. ECG signals, carotid pulse, and PCG signals. Based on the results of the extraction parameters of ECG, carotid pulse, and PCG, it could be known a heart condition. The various unit value in each parameters became a reason why a system that could determine normal and abnormal of cardiac condition was needed. In the previous study, Naive Bayesian method was used to determine the condition of a cardiac abnormality, based on several different parameters [7]. Same reason of the previous study, this paper proposed the Naive Bayesian method to be used to determine the normal and abnormal of cardiac condition based on multimodal cardiac parameters. The probability of several parameters of normal and abnormal heart was decided by using Equation (8) and (9), n P( x | normal)   P( xk | normal) (8) k 1 n P( x | abnormal)   P( xk | abnormal) (9) k 1 where x was one of the multimodal parameters, e.g. heart rate, QRS width, PR interval, QT interval, percussion-S2 interval, width of S1 and S2, frequency of S1 and S2, while n shown the number of parameters that be used in feature extraction. ECG signal had 4 parameters extraction, carotid had 1 parameter extraction and PCG had 4 parameters extraction. Normal condition could be concluded if P( x | normal)  P( x | abnormal) , vice versa. 68 | Asea Uninet Scientific and Plenary Meeting 2016 2.4 Data Recording The analysis of ECG, carotid pulse, and PCG signals were recorded directly from 20 normal subjects (4 female subjects and 16 male subjects) and 3 abnormal subjects (2 female subjects and a male subject) with age range of 23-62 years old. Each subject was recorded using spesial tools that developed by our tim research for 10 trials, with a duration of 5 seconds each trials. The data that recorded consist of 5-9 cycles of the signal and digitized with 1 kHz sampling frequency. Each data trials was processed using digital signal processing to produce 9 extraction parameters, which consist of heart rate (bpm), PR interval (s), QRS width (s), QT interval (s), percussion-S2 interval (s), the width of S1 and S2 (s), also frequency spectrum of S1 and S2 (Hz). Each parameters extraction would generate 5 data test, that would be used for sequential hypothesis testing. This process would generate a single decision each data test. Second process constitute combination process of all 5 data test from all extraction parameters using Naive Bayesian to be a single decision of cardiac condition. The probability value was calculated by using the average value and deviation standart from 5 data test for each extraction parameters to be a single PDF. 3 FINDINGS AND DISCUSSION Results in this study were divided into 9 parameters, namely heart rate, QRS width, PR interval, QT interval, Percussion - S2 interval, S1 width, S2 width, frequencies of S1 and S2. PDF results were used to determine normal and abnormal conditions on each parameter. In this research, PDF was build in different parameters. PDF were generated by comparing data with mean and deviation of each rule using Equation (1). Figure 1 were shown the kind of PDF rule of each extraction parameters. Asea Uninet Scientific and Plenary Meeting 2016 (a) (b) (c) (d) Figure 1. PDF of multimodal parameters extraction rule of ECG signal, i.e. (a) Heart rate (bpm), (b) QRS width (ms), (c) PR interval (ms), (d) QT interval (ms). Figure 1. PDF of multimodal parameters extraction rule of ECG signal, i.e. (a) Heart rate (bpm), (b) QRS width (ms), (c) PR interval (ms), (d) QT interval (ms). Figure 2. PDF of multimodal parameters extraction rule of carotid pulse signal. | 69 70 | Asea Uninet Scientific and Plenary Meeting 2016 (a) (b) (c) (d) Figure 3. PDF of multimodal parameters extraction rule of PCG signal, i.e. (a) S1 width (ms), (b) S2 width (ms), (c) S1 frequency (Hz), and (d) S2 frequency (Hz). Figure 4 were obtained using mean and deviation of rules of normal and abnormal heart rate while Table 1 shows probability of data subject based on normal condition (P(x/N)), Bradycardiac (P(x/B)) and Tachycardiac (P(x/T)). Normal heat rate has a rule between 60 to 100 bpm, which can be concluded mean and deviation of a normal heart rate respectively were 80 bpm and 20 bpm. Abnormal heart rate have two kinds of rule, i.e. bradycardia (<60 bpm) and tachycardia rule (>100 bpm). Mean and deviation of those rules respectively were 50 bpm and 10 bpm for bradycardia and also 110 bpm and 10 bpm for tachycardia. The PDF of patient heart rate marked by blue colour and the probability of its data record base on normal condition (P(x/N)) was marked by red colour in line with PDF of normal. It shows that the PDF of patient heart rate is located in PDF of normal zone. It indicates that the patient heart rate was normal with heart rate value was 89.471.66 bpm. Normal QRS width rule placed between 0.05 – 0.11 second, which mean, the average value was 0.08 s and deviation value was 0.01 s. Meanwhile abnormal QRS width (idioventricular rhytm) was sized more than 0.1 s, which mean, average and deviation width of abnormal QRS could be written respectively 0.2 s and 0.06 s. Figure 5 shows PDF of QRS width in mili second while Table 2 shows probability of data subject base on normal condition (P(x/N)) and Idioventricular rhytm (P(x/Ir)). It indicates that the QRS width patient was normal with QRS width value was 0.113±0.001 s. Asea Uninet Scientific and Plenary Meeting 2016 Table 1. Probability heart rate record (x) base in rule. Hear rate record (x) 90.50 bpm 88.11 bpm 87.98 bpm 89.15 bpm 92.31 bpm 88.76 bpm P(x/N) P(x/B) Mean = (80 bpm) Mean = (50 bpm) Deviasi = (20 bpm) Deviasi = (10 bpm) 0.0088 0.0000 0.0214 0.0000 0.0223 0.0000 0.0150 0.0000 0.0039 0.0000 0.0172 0.0000 P(x/T) Mean = (110 bpm) Deviasi = (10 bpm) 0.0000 0.0000 0.0000 0.0000 0.0002 0.0000 Figure 4. PDF of heart rate in bpm. Table 2. Probability QRS record (x) base in rule. P(x/N) QRS Width (x) mean = (0.08 s) 0.112 0.114 0.115 0.111 0.113 0.113 0.112 deviation = (0.01 s) 0.0000001018 0.0000000073 0.0000000018 0.0000003588 0.0000000277 0.0000000277 0.0000001018 P(x/Ir) mean = (0.20 s) deviation = (0.06 s) 0.0000000030 0.0000000030 0.0000000030 0.0000000030 0.0000000030 0.0000000030 0.0000000030 | 71 72 | Asea Uninet Scientific and Plenary Meeting 2016 Probability QRS Width 0.60 0.50 0.40 0.30 0.20 0.10 0.00 P(x/N) P(x/Ir) normal 0 100 200 Idioventricular rhytm 300 milisecond x .Figure 5. PDF of QRS width in mili second. 0.06 Probability 0.05 0.04 0.03 0.02 0.01 0.00 0 100 200 300 400 500 S2 Frequency in Hz Patient Normal Aurtic Regurgitation We analyzed the data of 20 normal subjects and 3 abnormal subjects to calculate level of accuracy in the detection of normal and abnormal heart. Table 3 shows probability of normal subjects. Meanwhile, Table 3 shows probability of abnormal subject with Figure 6. PDFrythm. of S2 The frequency in Hz means the stage of sequential hypothesis testing for tachycardia table column the first until fifth data tested. The abnormality of tachycardia is shown by Table 4 in heart rate parameter. Final decision of each parameter probability is shown in fifth stage of data tested. Table 3. Normal Probability of subjects A (Normal). Parameter Probability st nd 1 3rd 2 4th 5th Heart rate 0.87 0.89 0.91 0.92 0.92 QRS width 0.23 0.50 0.78 0.86 0.87 PR interval 0.47 0.74 0.79 0.82 0.83 QT interval 0.74 0.80 0.82 0.82 0.83 P-S2 interval 0.57 0.89 0.90 0.90 0.90 S1 width 0.83 0.87 0.90 0.95 0.95 S2 width 0.31 0.46 0.52 0.58 0.59 S1 frequency 0.78 0.89 0.92 0.92 0.94 S2 frequency 0.90 0.92 0.94 1.00 1.00 Asea Uninet Scientific and Plenary Meeting 2016 | 73 Table 4. Normal Probability of subject B (Tachycardia). Parameter Probability 1st 2nd 3rd 4th 5th Heart rate 0.18 0.29 0.31 0.49 0.50 QRS width 0.22 0.38 0.65 0.85 0.88 PR interval 0.42 0.51 0.59 0.67 0.72 QT interval 0.65 0.68 0.73 0.76 0.89 P-S2 interval 0.67 0.76 0.82 0.85 0.87 S1 width 0.40 0.54 0.89 0.94 1.00 S2 width 0.54 0.68 0.82 0.98 1.00 S1 frequency 0.73 0.76 0.82 0.87 0.92 S2 frequency 0.81 0.86 0.89 0.94 1.00 Figure 7. PDF of PR interval parameter. Sequential hypothesis testing method was used to determine the decision of normal and abnormal the data that was overlapping zone. Figure 7 consist of PDF patient (blue), normal PDF (red), and abnormal PDF (green and violet) of PR interval. Figure 7 shows that the PR interval data in one of the patients was in the overlapping zone. PDF of patient located between the normal PDF and wpw syndrome PDF. 74 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 8. Decision process from 1st data until 5th data. Table 5. Correlation between α, β, upper and lower threshold. Lower α threshold β Upper threshold Lower threshold A 0.3 0.006 166.67 0.301 B 0.03 0.0006 1616.67 0.03 C 0.003 0.00006 16616.666 0.003 Based on sequential hypothesis testing method, the system could determine the decision while it was overlapping. First, likelihood was calculated as each successive stage. Second, the probability of rejecting normal and wpw syndrome was calculated. Based on Figure 7, probability of rejecting normal was 0.003 and probability of rejecting wpw syndrome was 0.00006. Third, upper threshold and lower threshold was calculated. Based on probability of rejecting normal and wpw syndrome above, upper threshold was 16616.66 and lower threshold was 0.003. Fourth, likelihood was calculated. Based on Figure 8, likelihood for subject in first stage, likelihood was 0.44. It was between upper threshold and lower threshold, so it could not taken a decision. In the second stage, likelihood was 0.194. Based on upper and lower threshold, the second stage could not take a decision. In the third stage, likelihood was 0.294. Based on upper and lower threshold, the third stage could not taken a decision. In fourth stage, likelihood was 0.000579. Based on upper and lower threshold, the fourth stage could take a decision. It was wpw syndrome. In the fifth stage, likelihood was 0.000037. Based on upper and lower threshold, the fifth stage could take a decision, because it was lower than lower threshold. Therefore, wpw syndrome was accepted. Value of α and β affected the decision [3]. Various α and β was tested in PR interval which had an overlapping zone. In lower threshold A (α was 0.3 , β was 0.006), the decision could be taken in the second stage. Likelihood in the second stage was 0.194. Likelihood in the second stage was lower than lower threshold A which value was 0.301. Based on this condition, wpw syndrome was accepted. In lower threshold B (α was 0.03 , β was 0.0006), the decision could be taken in the fourth stage. Likelihood in the fourth stage was Asea Uninet Scientific and Plenary Meeting 2016 | 75 0.000579. Likelihood in the second stage was lower than lower threshold B, which value was 0.0301. Based on this condition, wpw syndrome was accepted. In lower threshold C (α was 0.003, β was 0.00006), the decision could be taken in the fourth stage. Likelihood in the fourth stage was 0.000579. Likelihood in the fourth stage was lower than lower threshold B, which value 0.00301. Based on this condition, wpw syndrome was accepted. Based on this research we could concluded that lower value of α and β, can accelerate the decision in small value of stage, vice versa. Based on Figure 8, first data was in the overlapping zone if using threshold A, first data until third data was in the overlapping zone if using threshold B and C. Decisions could be taken after 4th and 5th data which the likelihood parameter value was below the lower threshold. Based on this analysis, it could be concluded that the sequential hypothesis testing was important to make a decision for multimodal cardiac signal that had the overlapping zone for each rules.Naive Bayesian method was used for normal and abnormal classification for ECG, carotid pulse, and PCG. Patient 1st until 20th were normal and 21st until 23rd were abnormal patient. Based on the result, normal patient was classified as normal, but abnormal patient was classified as normal. It could happen because the abnormal parameter in each segment was only one parameter. Based on this research, in abnormal patient, heart rate parameter was only detected as abnormal condition. However, it could effect the normal decision because the others parameter was in normal condition. Table 3 and Table 4 shows that the more data that is tested, the higher the value of the accuracy of decision of these parameters, and vice versa. It could be shown from the average value in each data trial. So it could be concluded that the level of accuracy of decision is proportional to the amount of test data the previous research was oriented for overlapping case. In precious research was used detecting ventricular fibrillation (VF) and ventricular tachycardia (VT) [3]. First algorithm generated a binary sequence by comparing the signal to a threshold after that PDF of the time intervals of the binary sequence was obtained. The sequential decision rule is then activated once every second. The test is repeated every second until a decision is reached. Detecting ventricular fibrillation (VF) and ventricular tachycardia (VT) used only one parameter there was time intervals. However, in our research using various parameters, e.g heart beat in bpm, QRS interval in second and frequency of S1 in Hz. Sequential hypothesis testing of 85 cases resulted in identification of ventricular fibrillation was 97.64% and ventricular tachycardia was 97.65% episodes after 5 s, 100% identification of both VF and VT after 7 s [3]. In our research, the experiment was done with a duration of 5 seconds each experiment. It showed that the average of accuracy result in 5 second was 86.96 % for normal case. In abnormal case, showed that average of accuracy result in 5 second was 82,22%. The Naive Bayesian methods was used to decided heart condition in ECG, carotid pulse, and carotid. Result of heart disease was decided using Naive Bayesian [7]. The output for decision of heart disease were low, average, high risk of disease. The result of decision method for 23 subjects was shown in Table 6. 76 | Asea Uninet Scientific and Plenary Meeting 2016 Table 6. The decision for 23 subjects. Subject 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 4 Decision Normal Late aortic stenosis Normal Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Normal Idioventricular Idioventricular Late aortic stenosis Late aortic stenosis Normal Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Late aortic stenosis Wpw syndrome Late aortic stenosis Tachycardia Idioventricular Late aortic stenosis Normal Probability Normal 0.0934276 0.0000446 0.0959254 0.0000006 0.0073410 0.0029770 0.0036381 0.0000044 0.0742819 0.0158349 0.1263452 0.0000618 0.0032462 0.0077219 0.0001973 0.0000955 0.0000006 0.0001831 0.0166012 0.0166012 0.0099212 0.0024484 0.0004214 0.0000000 0.0000000 0.0007799 0.0867219 Abnormal 0.0000324 0.0940729 0.0008546 0.0006121 0.1582649 0.3123331 0.2804149 0.0088487 0.0001742 0.0000062 0.0001525 0.1219084 0.2989482 0.0000673 0.2565363 0.1669794 0.0006576 0.2468721 0.0498127 0.0498127 0.1109490 0.0423989 0.3485809 0.0646948 0.0015378 0.3939682 0.0000721 CONCLUSIONS AND SUGGESTIONS Sequential hypothesis testing was easy to implement in decision-making because it did not require large amounts of data. Sequential decision was used along with the test data. Testing was repeated by increasing the amount of data that a decision be reached. Based on the results of each data trial, it would increase the accuracy of decision making while the amount of data increase. Based on the data tested 1st to the 5th could be concluded that the level of accuracy of data was increasing. In this paper, a decision on the subject of the normal 86.96 % achieved on the fifth of data and decisions on the subject of abnormal 82.22 % achieved in fifth data. Results of classification based on parameter extraction multimodal cardiac signal is expected to be applied at the clinical level. Asea Uninet Scientific and Plenary Meeting 2016 | 77 REFERENCES E. Kenneth, R.U. Acharya, N. Kannathal, and L.C. Min, “Data Fusion of Multimodal Cardiovascular Signals”, IEEE Engineering in Medicine and Biology 27th Annual Conference, pp. 4689-4692, 2005. N. F. Hikmah, A. Arifin, T.A. Sardjono, and E.A. Suprayitno, “A Signal Processing Framework for Multimodal Cardiac Analysis”, Intelligent Technology and Its Applications (ISITIA), IEEE Conference Publications, pp. 125-130, 2015. N.V. Thakor, Y. Zhu, and K. Pan, “Ventricular Tachycardia and Fibrillation Detection by a Sequential Hypothesis Testing Algorithm”, IEEE Transactions on Biomedical Engineering, Vol. 37, No. 9, pp. 837-843, 1990. D. Rangaprakash and T. Srinivas, “Study of Phase Synchronization in Multimodal Cardiovascular Signals Using Recurrence Plots”, International Journal of Electronics &Communication Technology, Vol.3, pp. 454-459, 2012. E. Kenneth, R.U. Acharya, N. Kannathal, and L.C. Min, “Data Fusion of Multimodal Cardiovascular Signals”, IEEE Engineering in Medicine and Biology 27th Annual Conference, pp. 4689-4692, 2005. R. Watrous, B. Mead, N. Reichek, and F. Salonga, “Multi-modal Cardiac Diagnostic Decision Support System and Method”, United States Patent Application Publication, 2003. G. Subbalakshmi, K. Ramesh, and M.C.Rao, “Decision Support in Heart Disease Prediction System using Naive Bayes”, Indian Journal of Computer Science and Engineering, Vol. 2, No. 2, pp. 170-176, 2011. A.J. Wald and J. Wolfowitz, “Optimum Character of The Sequential Probability Ratio Test”, Ann. Math. Statistics, Vol. 19, pp. 326-339, 1948. S.A. Pattekari and A. Parveen, “Prediction System for Heart Disease Using Naive Bayes”, International Journal of Advanced Computer and Mathematical Sciences, Vol. 3, Issue 3, pp. 290-294, 2012. S.A. Jones, ECG Success Exercises in ECG Interpretation, F.A. Davis Company, Philadelphia, 2008. P.S. Vikhe, N.S. Nehe, and V.R. Thool, “Heart Sound Abnormality Detection Using Short Time Fourier Transform and Continuous Wavelet Transform”, Emerging Trends in Engineering and Technology (ICETET), IEEE Conference Publications, pp. 5054, 2009. D. Boutana, M. Benidir, and B. Barkat, “Segmentation and Identification of Some Pathological Phonocardiogram Signals Using Time-Frequency Analysis”, IET Signal Processing, Vol. 5, Iss. 6, pp. 527-537, 2011. AN EXPLORATION OF MENDELEY READER AND GOOGLE SCHOLAR CITATIONS Adian Fatchur Rochim adian.fatchur@ui.ac.id/ adian@undip.ac.id Riri Fitri Sari riri@ui.ac.id Department of Electrical Engineering Universitas IndonesiaJakarta, Indonesia Abstract This paper aims to analyse the count of a readers of published articles of 100 Indonesian researchers in Mendeley reference management software. The list of the Indonesia’s scientists are obtained from the webometrics ranking of scientists. We used the Application Programming Interface (API) of Mendeley to count the number of reader for each article in Mendeley and combine it with Google Scholar citation using the scrap method. We processed an evaluation of 10 (ten) mostly cited articles that is indexed in the first page of the Google Scholar for each designated scientist. Furthermore, we used the Pearson method to analyse the correlation of the Mendeley reader count and the Google Scholar citation. The results show that they are highly correlated. We found that many online Indonesian’s journals have no Digital Object Identifier (DOI) yet. In order to obtain more readers on the Mendeley and the Web at large, the DOI assignment should be organized. Keywords: Mendeley, Google Scholar and Digital Object Identifier (DOI) 1 INTRODUCTION Online scientific publications is increasingly being used both by higher education institutions and research institutes . Results of scientific papers produced can be accessed freely used at no charge online by the public (N. Li & Zhao, 2012). This activity began with the movement of Open Access Initiative ( OAI ), which allows people to free online access of online all the scientific works containing results of the conference, the chapters of a book or thesis(Farida, Tjakraatmadja, Firman, & Basuki, 2015). The impact factor was measured by how many articles cited / referenced by others and written back into the published article (Pan & Fortunato, 2014). The article cited by others who work as academics or researchers will add citation value of the article. Increased activity of others have done citations and produce new article published would increase the value of the impact that cited article (Hirsch, 2005). An article that may be of interest and help a nurse to support their activity as a nurse . Beneficial because the article is used and shared to peers, discussed via the Internet through blogs , websites and through social media forums (Jason Priem & Hemminger, 2010). This means that the article has a good impact value . Citation performed by people who do not work as researchers / academics do not add value to the impact of the cited Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 78 Asea Uninet Scientific and Plenary Meeting 2016 | 79 article because the nurses did not produce the results of a new article citations the article (Mcfedries, 2012). Scientometrics 2.0 / altmetrics is a quantitative study to measure the results of research , scientific communication, also measure how much science discussed in the social media world (Jason Priem, Piwowar, & Hemminger, 2012). Networking and collaboration technology xml-based applications make more research activities grow rapidly. Initiation of the Open Archive Initiative to accelerate the growth of research results published in scientific journals and facilitate the tracking citation (“Open Archives Initiative,” n.d.). Sample of an application that is widely used to writing scientific publications are Mendeley. Mendeley is a reference manager that can be used to organize the results of our reference citations in our article (X. Li, Thelwall, & Giustini, 2012). Similar applications like Zotero or End Note. Mendeley difference with the others is, it has a service feature interaction with other users. Service communication interaction with other users is similar to the feature on the social media application, so we call Mendeley is a social media network research (Haustein, Larivière, Thelwall, Amyot, & Peters, 2014). Mendeley is the reference manager, which can use to manage the references we have. Similar of the Mendeley we can see like: Zotero or End Note. The difference of the Mendeley among other is: Mendeley using “social media” function to create the network of the authors. Mendeley is one of the popular reference manager to manage of the references to produce scholarly articles.(X. Li et al., 2012)(J Priem, Piwowar, & Hemminger, n.d.) Open Archive Initiative develops and promotes interoperability standards that aim to facilitate effective dissemination of content. Open Archives Initiative is rooted in efforts to improve access to e-print archives as a means of increasing the availability of scholarly communication (“Open Archives Initiative,” n.d.). Secondly our motivation in doing this experiment is based on the manifesto issued by Jason Priem called " Manifesto Altmetrics " . Altmetrics Manifesto is trying to find data on the internet using the technique - a technique called scientometrics webometrics 2.0. Purpose of the manifesto altmetrics is trying to raise the value of the impact of the hidden, that the citation of an article, but the citation is not used to scholarly product ( for example, the nursing profession who took the citation / read data in Mendeley , but do not write the paper because it is not a profession produce paper) (J Priem, Taraborelli, Groth, & Neylon, 2010). Here's some information about the research profile obtained from a search engine such as Google Scholar and Microsoft Academic Search ( MAS ) . Data information data about the profile of researchers in both the search engine displays the number of articles indexed in the search engine Google Scholar : the article title , author and co , as well as citations obtained also h -index and h - 10 index researcher. 80 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 1. Author profile from Google Scholar In addition to the Google Scholar, is other search engines are: Microsoft Academic Search also gives users with the facility to see of the researchers profile. The data is displayed on the Microsoft Academic search in addition: information of an articles, information researchers, also networking researchers with co author. Figure 2. Author profile from Microsoft Academic Search Asea Uninet Scientific and Plenary Meeting 2016 | 81 Data obtained from the MAS networks and relationships with co author on the menu of the MAS co-author graph can be seen for example in Figure 3 below: Figure 3. Networking author and co-author on the MAS MAS is not used as the data in our experiments, experiments that we are doing just the search engine Google Scholar, one reference manager Mendeley, indexing engine and resolving the DOI CrossRef. MAS only as an example that the scholarly community has been widely used general search engines such as Google Scholar and Microsoft Academic Search for references to articles that they made (Of et al., 2015). 2 2.1 GOOGLE SCHOLAR AND MENDELEY Google Scholar Google Scholar is a services from the Google corporation to provides us for search the scholarly literature. From difference more disciplines and sources: articles, theses, books, abstracts and court opinions, from academic publishers, professional societies, online repositories, universities and other web sites (“About Google Scholar,” n.d.). Figure 4. Profile on Google site 82 | Asea Uninet Scientific and Plenary Meeting 2016 2.2 Mendeley Mendeley is reference manager, Mendeley is a dynamic global research collaboration platform that is helping academics improve their workflow and accelerate the pace of scientific discovery. We can download the application of the Mendeley and use the application. Mendeley gives us to interact with other users, follow and communication like other social media. Mendeley gives us to measure how many our articles read by others to support of their activities (“Awards and Reviews | Mendeley,” n.d.). Figure 5. Profile on Mendeley 3 METHODOLOGY The method used to measure of the articles in Mendeley and GS : Stages / steps - steps taken in conducting the experiment is as follows: (a) (b) (c) (d) (e) Collecting and make a list of the names of researchers obtained sampling from a list of 100 ranked first Indonesian researchers in Webometrics ranks of scientists (http://webometrics.info), a spreadsheet application to create a list of names of researchers (“Asia/Pacifico | Ranking Web of Repositories,” n.d.). The data obtained using the article title scrapping of the search engine Google Scholar with the input data is the name of the researcher. Based applications using the Python programming language (Cristian, 2011) (“scholar.py — A Parser for Google Scholar,” n.d.). Calculate the data reader to the article on the Mendeley API Query method. Mendeley API can be used to authenticate applications on the site Mendeley. Displays the results in a bar chart representation of the picture and the list of researchers using the programming language PHP and Apache webserver applications. Calculate correlation number of Mendeley Reader with Google Scholar scitation, with Pearson Method. Asea Uninet Scientific and Plenary Meeting 2016 | 83 Method of the Google Scholar scrapping: take the first pages found in Google Scholar by keyword researcher name, then the data obtained parsed / selected data types to be used alone. Figure 5. Scrapping method with scholar.py (Cristian, 2010) Scholar.py parsing results from the application, and then we select the data (title of the article) and the number of citations using the Bash shell scripting with awk application. Awk is simple applications with an input such as the C language that we can use to process the word (Dougherty, Robbins, & Edition, 2014). Finally, the results of the three processes the query is stored in a MySQL data base and displayed via the website: Figure 6. The data from the profile view is based on the articles that cited researchers and number of the Mendeley readers and Google Scholar Citations 4 FINDING AND DISCUSSION Finally, the results of the three processes the query is stored in a MySQL data base and displayed via the web. Data obtained are : 10 articles of 100 researchers in Indonesia from various fields. List of researchers used data issued by the site webometrics July 2015, rank of Indonesia scientists. The number of samples processed data is 1000 article title with two parameters: Number of readers in Mendeley and the amount of citations that are indexed in the search engine Google Scholar. The result that I get that, an author who has an active account on Mendeley also has a higher value of citations indexed in google scholar than researchers who do not have an account at Mendeley. 84 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 7. Scatter Plot of Mendeley reader number and Google scholar citation 5 CONCLUSION The results of my work contributes to the relationship and correlation of information Mendeley number of readers and the number of citations of articles Google Scholar of researchers / authors. This information is required authors to see the representation of his his work (papers) in the Search Engine. More links / link from a search engine to the article author then other researchers more easily read the articles. Mendeley helped researchers to publish author’s paper to the search engines in addition to its function as a reference manager. Number of readers Mendeley has a correlation with the number of citations that are indexed in google scholar with a value of 0.266 according to the method of Pearson with N = 1000. Result of the research is contributing in the form of a data search application site article citations. The data representation of the results of citations and the number of readers who obtained the researcher can be accessed through the website by entering a list of names of researchers ( plural in the form of a file ) or the name of the researcher ( single ). Future research will including the parameters provided by Scopus citations features through APIs provided. The hope is the data representation of each researcher can be displayed on the web complete from a search engine, citations and citation on altmetrics bibliometrics / scientometrics 2.0 . The expectation that our application is able to attract motivated researchers working to improve research, once can measure the performance of publications it produces. REFERENCES: About Google Scholar. (n.d.). Retrieved December 8, 2015, from https://scholar.google.co.id/intl/en/scholar/about.html Asia/Pacifico | Ranking Web of Repositories. (n.d.). Retrieved September 9, 2015, from http://repositories.webometrics.info/en/Asia_Pacifico Asea Uninet Scientific and Plenary Meeting 2016 | 85 Awards and Reviews | Mendeley. (n.d.). Retrieved December 8, 2015, from https://www.mendeley.com/review/ Dougherty, B. D., Robbins, A., & Edition, S. (2014). Sed & Awk. Nicotine & tobacco research : official journal of the Society for Research on Nicotine and Tobacco (Vol. 16). doi:10.1093/ntr/ntt263 Farida, I., Tjakraatmadja, J. H., Firman, A., & Basuki, S. (2015). A conceptual model of Open Access Institutional Repository in Indonesia academic libraries. Library Management, 36(1/2), 168–181. doi:10.1108/LM-03-2014-0038 Haustein, S., Larivière, V., Thelwall, M., Amyot, D., & Peters, I. (2014). Tweets vs. Mendeley readers: How do these two social media metrics differ? Information Technology, 56(5), 207–215. doi:10.1515/itit-2014-1048 Hirsch, J. E. (2005). An index to quantify an individual’s scientific research output. Proc Natl Acad Sci U S A, 102(46), 16569–16572. doi:10.1073/pnas.0507655102 Hood, W. W., & Wilson, C. S. (2001). The literature of bibliometrics, scientometrics, and informetrics. Scientometrics, 52(2), 291–314. doi:10.1023/A:1017919924342 Li, N., & Zhao, X. (2012). The study on constructing institutional repository of university. Proceedings - 2012 4th International Conference on Multimedia and Security, MINES 2012, 689–692. doi:10.1109/MINES.2012.237 Li, X., Thelwall, M., & Giustini, D. (2012). Validating online reference managers for scholarly impact measurement, 461–471. doi:10.1007/s11192-011-0580-x Mcfedries, P. (2012). Measuring the impact of altmetrics [Technically Speaking]. IEEE Spectrum, 49(8), 28–28. doi:10.1109/MSPEC.2012.6247557 Of, J., American, T. H. E., For, S., Sciencetechnology, I., Luis, J., Spanish, O., … National, S. (2015). Microsoft Academic Search and Google Scholar Citations : Comparative Analysis of Author Profiles Microsoft Academic Search and Google Scholar Citations : A, (JUNE 2014). doi:10.1002/asi.23036 Open Archives Initiative. (n.d.). Retrieved December 22, 2015, from https://www.openarchives.org/OAI/OAI-organization.php Pan, R. K., & Fortunato, S. (2014). Author Impact Factor: tracking the dynamics of individual scientific impact. Scientific Reports, 4, 4880. doi:10.1038/srep04880 Part, C., Rank, S. J., Snip, S., & Reports, J. C. (2014). Bibliometrics : an overview, 1–7. Priem, J., & Hemminger, B. H. (2010, July 2). Scientometrics 2.0: New metrics of scholarly impact on the social Web. First Monday. Retrieved from http://journals.uic.edu/ojs/index.php/fm/article/view/2874/2570 Priem, J., Piwowar, H. a, & Hemminger, B. M. (2012). Altmetrics in the wild: Using social media to explore scholarly impact. arXiv12034745v1 csDL 20 Mar 2012, 1203.4745, 1–23. doi:http://arxiv.org/abs/1203.4745v1 Priem, J., Piwowar, H. A., & Hemminger, B. H. (n.d.). Altmetrics in the wild: An exploratory study of impact metrics based on social media. Priem, J., Taraborelli, D., Groth, P., & Neylon, C. (2010). Altmetrics: a manifesto. scholar.py — A Parser for Google Scholar. (n.d.). Retrieved December 8, 2015, from http://icir.org/christian/scholar.html Thelwall, M. (2007). Bibliometrics to Webometrics. Journal of Information Science, 34(4), 1–18. doi:10.1177/0165551506nnnnnn TOWARDS SURABAYA AS AN OPEN DATA CITY Nur Aini Rakhmawati nur.aini@is.its.ac.id* Irmasari Hafidz irma@is.its.ac.id Renny Pradina K. renny.pradina@gmail.com Radityo Prasetiyanto W radityo.p.w@is.its.ac.id Department of Information Systems, Faculty of Information Technology, Institut Teknologi Sepuluh Nopember, Surabaya, Indonesia Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Key Area: Science and Technology Abstract Surabaya is one of the best cities in Indonesia that has already implemented E-Government to give better services to the citizen of Surabaya. Therefore, Surabaya a plays an important role as a benchmark for city development in Indonesia, especially in E-government. Generally, public authorities consider statistical data to decide a public policy. Thus, in this paper, we describe our past and present projects that are related to Surabaya data. Finally, an open data city pipelines for Surabaya proposal are presented. This proposal attempts to integrate those projects in one single system. At present, the development of the Open Data related projects in Surabaya has already opened the city data to the public, but they are stored in pdf, xls, html. Moreover, those data are distributed in several website . Therefore, in the first step, all those data are col- lected in a single store. Additionally, we also take into account data from Twitter statuses that report about the current neighbourhood condition of Surabaya. All those data are analysed and presented in a better visu- alisation to give a big picture of Surabaya development. Keywords: Surabaya, Open Data, E-government 1 INTRODUCTION The open data movement especially in e-government area is a global trend in recent years. Surabaya, the second of biggest cities in Indonesia has been open- ing up Surabaya data to its citizen. To date, the city hall of Surabaya provides Surabaya In Figures [Surabaya2015] in PDF and printed formats. This annual book contains data of Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 86 Asea Uninet Scientific and Plenary Meeting 2016 | 87 various sectors of Surabaya. Apart of that, the city hall of Surabaya also present the Surabaya data at Statistic Surabaya Bureau site1 and Surabaya government agencies site in HTML and Excel formats. Accord- ing to [Rakhmawati2015], the current state of Surabaya Open Data is at two out of five star Open Data [Berners-Lee2009]. Thus, heterogeneous sources and formats of the Surabaya data is a big challenge to collect, clean and integrate the data. Another challenge is to analyse the Surabaya data to reveal the facts of Surabaya and finally could assist the city hall of Surabaya to create a better policy for citizen of Surabaya. Therefore, in this paper we present our past and present projects that use the Surabaya data from various sectors in Section 2. Additionally, we discuss our proposed system which integrates our past and presents project in Section 3. 2 PAST AND PRESENT PROJECTS This section describes our projects that are used Surabaya data namely Surabaya city development, official Surabaya social media, traffic accidents, air pollution and crime. Statistic Surabaya Bureau: http://surabayakota.bps.go.id/ Figure 1: MonVis Musrenbang Application 2.1 MonvisMusrenbang In the similar thread of gauging the condition of the city, we develop MonvisMusrenbang [Kusumawardani et al.2015]. MonvisMusrenbang is a web-based application which builds upon the existing e-Musrenbang, a system through which people could give the government input on the development they want to see in the city, such as the building of public facilities or skill training programs for youth. To enable people and the government to monitor the progress and outcome of these proposals, we develop MonvisMusrenbang with the important aspect of taking a visualization approach to present the progress (Figure 1). It also provide the facility to comment and interact on each proposal and its progress, which not only enables a twoway dialogue between the citizens of Surabaya and the City Government, but also is a rich source of information important to both the government and the people. 2.2 Natural Language Processing for Social Media in the City An important aspect of the city is the aspiration of its citizens. Nowadays, social media such as Twitter and Facebook provide an informal medium of interaction. The people of Surabaya have been actively using these media to voice their aspirations, both through government-created accounts such as @sapawargasby at Twitter, and also 88 | Asea Uninet Scientific and Plenary Meeting 2016 other accounts such as @e100, an account owned by a popular radio station in Surabaya. The interaction in these accounts is a rich source of information about Surabaya and its people. Using Natural Language Processing techniques such as Sentiment Analysis, we extract information from these accounts, providing insight into what actually goes on in the city, which is a both important and fascinating information for the government of Surabaya and its people. 2.3 Visualization and Clustering of Traffic Accidents Traffic is one of the most important aspect of the dynamics of a city, as cities are generally characterized by high mobility. Analyzing traffic accidents is thus crucial for improvement in its safety and comfort. However, the format of the record of traffic accidents currently available does not lend itself well for analysis. To provide insight into these data and to enable more effective decision making, we develop a system to visualize and analyze the traffic in the Province of East Java, of which Surabaya is the capital. We enhance the visualization of the traffic accident information and analysis by presenting them in geographical maps (Figure 2). As the extension of this work, we plan to develop such system for the specific area of the City of Surabaya, incorporating more fine-grained information on each of the accidents. Figure 2: Traffic Accidents Application 2.4 Environmental Awareness: Air Pollution Urban air pollution is a major environmental problem in the developing coun- tries of the world. On the previous research, we have studied some data about pollution data on city of Surabaya which being provided and collected by col- lected by Badan Pengelola Lingkungan Hidup Daerah Surabaya (BPLH Surabaya) or it is simply the Ministry of Environment of Indonesia, Air Quality Division in Surabaya region. The data is an index named ISPU (Indeks Standar Pencemar Udara) or it is known as AQI (Air Quality Index). There are six pollutants that are being collected by integrated monitoring station spread through 5 places all over Surabaya. They are: Particulate Matter (PM10), Sulfur Dioksida (SO2), Carbon Monoksida (CO), Ozon (O3), Nitrogen Dioksida (NO2) and Hidro Car- bon (HC). The air quality information provided is the amount of contamination of air by smoke and harmful gases, mainly oxides of carbon, sulfur, and ni- trogen. From the data, we build clusters and visualization using Matlab with K-Means and Self Organizing Map (SOM) [Hájek and Olej] techniques to see how many type of pollution based on region in the city based on their pollutant data [Istanto et al.2013]. Instead from the advantages about informing the city pollution state on the civil people, we also think about to bring more awareness to the citizens. Based on the categories; thus Asea Uninet Scientific and Plenary Meeting 2016 | 89 we could also provide some profiles and strategies about what actions should be done by the Government, due to the type of the pollution. 2.5 Crime According to the National Crime Information Center (NCIC) Indonesian Police (Kepolisian Republik Indonesia or POLRI), on 2012 East Java province is rank as second highest on the national level after Jakarta. The dataset used comes from the 36 police department in city level or Kepolisian Resort (or POLRES) in East Java province from year 2012-2014. It has 127 attributes from 8 subcat- egory of attributes, which are (1) the type of conventional crime, (2) offenders, (3) age of the offend-ers, (4) victims, (5) age of victims, (6) type of crime targets, (7) the time pattern of crime, and (8) modus operandi. We conduct a research [Ma’arif et al.2015] that used crime dataset on 36 cities all over East Java province. We build a clustering based on the number of crimes and casualties using K-Means and build geographic visualization in R using a Shiny web framework. The main challenge that emerges is how to collect and analyze the growing volume of crime data and how to extract information on crime patterns in certain geographic location. 2.6 Linked Open Data Surabaya [Rakhmawati2015] is an effort to promote Surabaya to implement the Linked Open data [W3C2007]. In that effort, several data at Surabaya in Figures are converted to RDF [Brickley and Guha2014]. We initially create a vocabulary for the data before converting process. In the end, a showcase is provided to present the RDF data of Surabaya. 3 AN OPEN DATA CITY PIPELINE FOR SURABAYA The projects that have been discussed in Section 2 are not integrated in a single system. As a result, an holistic picture of Surabaya is not visible. Therefore, we propose an open data city pipeline for Surabaya which will be described in Section 3.1. In addition, a list of challenges will be identified in Section 3.2. 90 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 3: System Architecture of Open data Surabaya pipeline 3.1 System A system architecture of Open data Surabaya pipeline is presented in Figure 3. Surabaya documents in Excell, HTML and PDF are collected in advance. Furthermore, information from social media are gathered. Those data are parsed and annotated in the second stage. Next, the data stored in a set of data stor- age. We then start analysing the data by implementing clustering algorithms and aggregation. As the final steps, we visualise the data to give a better view of Surabaya and publish the data in Linked Open Data format. 3.2 Challenges We discover several challenges while building the system, as follows: 1) Heterogeneous systems, sources and formats As we stated in Section 1, the Surabaya data are distributed in several locations such as government agency sites and e-book. Moreover, the data formats are vary. Additionally, the projects in Section 2 are developed in different systems. Asea Uninet Scientific and Plenary Meeting 2016 2) 3) 4) 4 | 91 Identify, educate and onboard influential government and community leaders to use and advocate for the tool. The citizen participation Social media is one of the channel that are used as one of the system inputs. Thus, generating awareness about and interest in the system is a must. Moreover, the monvis-musrenbang system requires the citizen feedback about the Surabaya development. Therefore, several ways to encourage citizen to contribute in the system should be considered. For instance, a gamification process can be launched, where the most active users will be ranked and monthly winners will receive prizes. Next, integration between the system and existing e-Government Musrenbang tools must be achieved to facilitate the significant shift in “how”/the way infrastructure development and government-citizen collaboration works today. CONCLUSION We have explained our past and ongoing projects related to Surabaya data. Those projects is preliminary works of open data city pipeline development. Several challenges during the system development have been identified. As a next step, we will use the MonvisMusrenbang system as a centre of this system, then other projects will be attached as an extension. REFERENCES [Berners-Lee2009] Berners-Lee, T. (2009). Linked-data design issues. W3C design issue document. http://www.w3.org/DesignIssues/LinkedData.html. [Brickley and Guha2014] Brickley, D. and Guha, R. (2014). RDF Schema 1.1 - W3C Recommendation 25 February 2014. Technical report. [Hajek and Olej] Hajek, P. and Olej, V. Air quality modelling by kohonen’s selforganizing feature maps and lvq neural networks. [Istanto et al.2013] Istanto, R. C., Hendrawan, R. A., and Hafidz, I. (2013). Vi- sualisasi kualitas udara untuk menentukan titik rawan polusi menggunakan algoritma selforganizing map dan k-means studi kasus kota surabaya. Tech- nical report, Institut Teknologi Sepuluh Nopember Surabaya. [Kusumawardani et al.2015] Kusumawardani, R. P., Hafidz, N. A. R. I., , Wi- bowo, R. P., and Pranantha, D. (2015). A prototype of monvis-musrenbang: Monitoring and visualization application for surabaya development plan. In Proceedings of the 3th International System Information Conference 2015. [Ma’arif et al.2015] Ma’arif, S., Kusumawardhani, R. P., and Hafidz, I. (2015). Geographic visualization of crime datasets using r: Case study crime data from indonesian police department, east java. In Proceedings of the 3th International System Information Conference 2015. [Rakhmawati2015] Rakhmawati, N. A. (2015). Menuju surabaya sebagai linked open data city. In Inovasi di Bidang rekayasa teknologi serta Aplikasi Industri dan Management. Badan Inovasi dan Bisnis Ventura ITS. [Surabaya2015] Surabaya, B. (2015). Surabaya In Figures. Statistic of Surabaya City. [W3C2007] W3C (2007). Linking Open Data. ADAPTIVE AND MULTI-CHANNEL ACCESS OF LEARNING OBJECTS RETRIEVAL SYSTEM TO FACILITATE PERSONALIZED LEARNING: CASE STUDY INDONESIA OPEN EDUCATIONAL RESOURCES (I-OER) Harry B. Santoso harrybs@cs.ui.ac.id Zainal A. Hasibuan zhasibua@cs.ui.ac.id* Faculty of Computer Science Universitas Indonesia *) The corresponding author Presented at the: ASEA-UNINET International Workshop Bali, 15th – 18th, February 2016 Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract The use of Open Educational Resources (OER) is one of potential ways to increase the participation rate and quality of educational services, especially in developing countries. Although OER has been using for several years in different countries, there is no strict rules on how to implement it. For example, educational institutions, citizens, and organizations can share their knowledge or learning objects through the OER. The Asosiasi Pendidikan Tinggi Informatika dan Ilmu Komputer (APTIKOM) has developed a framework for Indonesia Open Educational Resources (I-OER). The framework consists of three components: Open Content (OCT), OpenCourseWare (OCW), and Open Education (OED). The framework is used as a reference to develop the I-OER platform. A team at one reputable university in Indonesia is currently developing the platform by integrating those three components. The current paper aims to propose an adaptive and multi-channel access of learning objects retrieval system to facilitate personalized learning using the I-OER platform. The adaptive platform can facilitate students with different characteristics, such as prior knowledge, needs, and learning styles, by providing different learning objects. Ontology-based learning object searching technique is also applied. Moreover, the platform is designed to address learning objects retrieval from different platforms and accessibility of learning learning objects from any digital communication devices (multi-channel access). Keywords: Adaptive, Multi-Channel Access, Open Educational Resources, Personalized Learning 1 INTRODUCTION Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 92 Asea Uninet Scientific and Plenary Meeting 2016 | 93 From the study of Indonesian Internet Service Provider Association (APJII), internet users in Indonesia has reached 71.19 million people in 2013 with internet penetration rate of 28% (PKKUI & APJII, 2015). ICT infrastructure development is still not evenly distributed, and concentrated in Java and several other major cities. Although the number of internet users is increasing, the Indonesian Human Development Index is still relatively low. The gross participation rate of higher education in Indonesia is also in similar condition. Based on the description above, it can be concluded that at present there are three things of the nation's problems, namely: 1) deployment of qualified human resources are not evenly distributed, 2) the level of participation of college entrance is still low, 3) the development of ICT infrastructure unequal so that access to information is limited. To overcome these problems, it is necessary to implement the breakthrough in the teachinglearning process in education, namely the use of online learning system to support the teaching and learning process. Distance Education is not a new in Indonesia. A few decades ago, Universitas Terbuka (Open University in Indonesia), has started conducting distance education and has many distance education program units (i.e., technical implementation units in many regions). At that time, limited distance education programs were carried out using printedversion of learning modules. Now, distance education programs in Indonesia can be conducted using ICTs after the Ministerial Regulation was signed. Although, online learning initiatives and their implementation are not new in Indonesia (e.g., Cenka, 2012; Cenka, 2013; Hasibuan & Santoso, 2005; Hasibuan, 2012), there are still limited approaches of how to provide relevant resources and instructional strategies to specific learners. In educational settings, facilitator needs to consider learners’ characteristics. Facilitate individual characteristics in a traditional learning environment needs huge efforts. In contrast, it can be conducted automatically within online learning environment through the implementation of personalization feature. The aim of the present paper is to propose an adaptive and multi-channel access of learning objects retrieval system to facilitate personalized learning using the Indonesia Open Educational Resources platform. 2 2.1 RELEVANT LITERATURE REVIEW Online Learning Implementation in Indonesia The initiatives of online learning have been proposed and implemented in Indonesia. While some of them are conducted directly by the government, other initiatives are implemented by higher education institutions. In 2006 the government also released a development program of information systems and networks around the universities in Indonesia known as INHERENT (Indonesian Higher Education Network). The main target of the program is to connect all universities in Indonesia to encourage the exchange of knowledge and equitable access to education in Indonesia (Solichin, 2010). A MOOC-like program has been released and followed by hundreds to thousands participants across Indonesia. The program is called: Pembelajaran Daring Indonesia Terbuka dan Terpadu (PDITT). The lecturers are professors from top universities in Indonesia, such as Institut Teknologi Bandung, Universitas Gadjah Mada, Universitas Indonesia, etc. 94 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 1. The Homepage of PDITT (http://kuliahdaring.dikti.go.id) Morever, many Higher Education Institutions in Indonesia have already developed and implemented online learning at their own institution by using learning management system. They also used different communication tools, either synchronous or asynchronous tools. For example, University of Indonesia implemented Student Centered e-Learning Environment (SCELE). At Universitas Gadjah Mada, they used e-Learning System for Academic Community (eLisa). 2.2 Indonesia Open Educational Resources (I-OER) The Indonesia Open Educational Resources (I-OER) framework has been developed by the Asosiasi Pendidikan Tinggi Informatika dan Ilmu Komputer (APTIKOM) (Indrajit, 2014). It consists of three components: Open Content (OCT), OpenCourseWare (OCW), and Open Education (OED). Currently the prototype of I-OER platform is developed by a team at one reputable university in Indonesia. Those three components are described below. Figure 2. APTIKOM OER (Indrajit, 2014) Asea Uninet Scientific and Plenary Meeting 2016 | 95 Open Content –Open Content is a portal that stores and organizes learning contents. Individuals as well as organizations can share their contents (e.g., slides, articles, technical reports, etc.) in the OCT. To make any contributions, the individuals or organizations are required to registers to the system, upload their contents, and maintain them. The contents in the OCT can be accessed and downloaded by the public. Searching is an important feature in the OCT portal. To facilitate searching and sharing the learning objects, ontology learning object is developed by adopting the idea of the previous research (e.g., Ashley, Davis, Pinsent, 2008; Banlue, Arch-int, & Arch-int, 2010). By following the idea of ontology (Paramartha, Santoso, & Hasibuan, 2014), the contents in the OCT are stored in the local database as the primary data layer. Furthermore, they are mapped into OWL/RDF-based ontology as a secondary data layer. The advantage of doing this is, the contents that are already mapped into the ontology can be reused by other systems. It can be done by applying semantic web technology that supports OWL/RDF format. In addition, the ontology-based learning object searching technique applies semantic web technology. Search results contain learning contents stored in the OCT. The system also displays the sub-material corresponding to the keywords entered by the user. By applying semantic web technology, a material or sub-materials can also be displayed by the system based on the keywords entered by the user. OpenCourseWare –Massachusets Institute of Technology (MIT) is the first institution that proposed the OpenCourseWare and open its contents to public. MIT Open Courseware was only providing the courseware, but not the education service (Pisutova, 2012). Many academicians (i.e., lecturers) obtained benefits from this initiative. They can learn and use the syllabi and resources gathered from the system. The resources published in Open Content (OCT) is still in separate files. The resources are not organized in a specific learning structure. In OpenCourseWare (OCW), the learning resources are arranged into an organized structure that represents an instructional strategies. The resources are available in text, audio, or video. The resources in the OCW can be can be accessed without any registration or payment. Open Education –Compared to Open Content and OpenCourseWare, the Open Education in the Indonesia Open Education Resources provides learning environment that not only stores resources, but also facilitates interaction between lecturer and learners. The learning environment can also facilitates assessment activity. Furthermore, communication among learners or between lecturer and learners can occur synchronously or asynchronously. At the end of each course, the learner receives a certificate of completion reflect their competence in the course. 2.3 Personalized Learning Personalization concept was originally applied to e-commerce related to ordering products. This can assist customers in choosing products which they proffered offer of goods that are similar to other customers with similar profiles to him (Lee & Lu, 2002; Resnick, & Varian, 1997; Balabnovic & Shoham, 1997). In the context of education, Martinez (2002) argues that personalized learning can facilitate the provision of complex instructions and make the learning process much simpler manner display only specific information in accordance with specific needs of learners. According to Ghallabi, Essalmi, Jemni, & Kinshuk (2013), the courses in personalized e-learning systems are prepared to adapt to the learner’s characteristics. Moreover, personalization in the context of learning activities deals with selection and 96 | Asea Uninet Scientific and Plenary Meeting 2016 customization of learning content, activities and learning sequences to suit the needs of particular learner (Keeffe, Staikopoulos, Rafter, Walsh, Yousuf, Conlan, Wade, & Okeeffe, 2012; Selviandro, Suryani, & Hasibuan, 2014; Sfenrianto, 2013; Suryani, Santoso, & Hasibuan, 2014). In sum, the learning model could be based on learners’ prior knowledge and learning styles (e.g., Graf, Kinshuk, & Liu, 2008). Therefore, coursepage can be personalized by presenting: (1) learning content, and (2) learning scenario. Personalized Learning Based On Learning Contents –Learners may need guidance in selecting learning objects that suits them. Some learners may find it difficult to decide which LO are suitable for their learning processes, since they do not have sufficient knowledge (Chen, Niu, Zhao, & Li, 2014; Suryani, et al., 2014). Many techniques enable learner to learn content that suit their preferences. Besides the simple tagging in content, artificial intelligent methods are also used in content selection (Chen, Niu, Zhao, & Li, 2014; Suryani, et al., 2014). Personalized Learning Based On Learning Scenario –The system utilizes learner model to provide the appropriate learning scenario for the learners. Many techniques have been proposed and used to deal with different levels of learners’ prior knowledge and learning styles. Gamalel-din (2014) identified learner’s learning style to be used as a reference for relevant learning units. Laksitowening and Hasibuan (2015) also proposed a personalized learning architecture in a standard-based education. 3 3.1 DEVELOPMENT OF ADAPTIVE AND MULTI-CHANNEL ACCESS OF LEARNING OBJECTS RETRIEVAL SYSTEM Development and Evaluation of Indonesia Open Educational Resources Platform As mentioned above, the Indonesia Open Educational Resources Platform consists of three components: Open Content (OCT), OpenCourseWare (OCW), and Open Education (OED). The framework is used as a reference to develop the I-OER platform. The portals of OCT, OCW, and OED are shown below (Figures 3, 4, & 5): Figure 3. Open Content Asea Uninet Scientific and Plenary Meeting 2016 | 97 Figure 4. Open CourseWare Figure 5. Open Education The evaluation of the I-OER prototype has been conducted by using usability testing technique. The usability testing was conducted to ensure the I-OER prototype comply to interaction design principles, for example Shneiderman and Plaisant (2010)’s Eight Golden Rules. 3.2 Proposed Architecture of Adaptive and Multi-Channel Access of Learning Objects Retrieval System The adaptive platform can facilitate students with different characteristics, such as prior knowledge, needs, and learning styles, by providing different learning objects. Ontologybased learning object searching technique is also applied. Moreover, the platform is designed to address learning objects retrieval from different platforms and accessibility of learning learning objects from any digital communication devices (multi-channel access). Figures 6 and 7 show the architecture of adaptive and multichannel access of learning object retrieval system and also the multiaccess application, services, and data repository. 98 | Asea Uninet Scientific and Plenary Meeting 2016 PRESENTATION LAYER ADAPTIVE AND MULTI-CHANNEL ACCESS APPLICATION LAYER Indonesia Open Educational Resources Portal DATA LAYER Open Content Individual OpenCourseWare Open Education School University Figure 6. The Architecture of Adaptive and Multichannel Access of Learning Object Retrieval System Figure 7. Multiaccess Application, Services, and Data Repository (Budi, Rubhasy, Mindara, & Hasibuan, 2011) Asea Uninet Scientific and Plenary Meeting 2016 4 | 99 CONCLUSION AND FURTHER WORK The use of Open Educational Resources (OER) is one of potential ways to increase the participation rate and quality of educational services. The way how contents and instructional strategies presented is an open issue. The current paper proposed an adaptive and multi-channel access of learning objects retrieval system to facilitate personalized learning using the I-OER platform. There are several works that need to be conducted from the proposed system. First, usability testing –the purpose of the activity is to understand users’ experience while using the proposed system. At least ten repondents will be invited to evaluate the system through usability testing technique. Second, algorithm improvement –the prototype of searching technique using ontology and semantic web technology has been conducted. Testing and improvement efforts are still need to be conducted to yield a better searching feature in the Open Content portal. REFERENCES Ashley, K.., Davis R., & Pinsent, E. 2008. Significant properties of e-learning objects. Retrieved from http://www.jisc.ac.uk/media/documents/programmes/preservation/spelos_report.pdf Balabnovic, M., & Shoham, Y. (1997). Fab: Content-based, collaborative recommendation, Communications of the ACM, 40(3), 66-72. Banlue, K., Arch-int, N., & Arch-int, S. (2010). Ontology based metadata integration approach for learning resource interoperability. Paper presented at the 6th International Conference on Semantics Knowledge and Grid, Beijing, China, IEEE, pp. 195-202. Budi, I., Rubhasy, A., Mindara, G. P., & Hasibuan, Z. A. (2011, July). A multidimensional approach in content -based multimedia information retrieval system. The 2011 International Conference on Computer Engineering and Applications (ICCEA 2011), Haikou –China. Cenka, B.A.N. (2012). Educational Services Integration based on Cloud Technology.Thesis. Faculty of Computer Science, Universitas Indonesia. Depok, Jawa Barat, Indonesia. http://lontar.cs.ui.ac.id/Lontar/opac/themes/ng/detail.jsp?id=37767&lokasi =lokal Cenka, B.A.N. (2013). Enhancing Educational Services Using Cloud Technology. IEEE International Conference of Information and Communication Technology. (Bandung - West Java, Indonesia, March 2013. Chen, W., Niu, Z., Zhao, X., & Li, Y. (2014). A hybrid recommendation algorithm adapted in e-learning environments. Springer - World Wide Web, vol. 17, pp. 271–284. Gamalel-din, S. A. (2012). An Intelligent eTutor-Student Adaptive Interaction Framework. Paper presented at the 13th International Conference on Interacción Persona-Ordenador. Ghallabi, S., Essalmi, F., Jemni, M., & Kinshuk. (2013). Toward the reuse of ELearning personalization systems. Paper presented at the IEEE 2013 Fourth International Conference on Information and Communication Technology and Accessibility (ICTA). 100 | Asea Uninet Scientific and Plenary Meeting 2016 Graf, S., Kinshuk, & Liu, T. (2008, July). Identifying learning styles in learning management systems by using indications from students behaviour. Paper presented at the IEEE International Conference on Advanced Learning Technologies (ICALT 08), Santander, Spain. Hasibuan, Z.A. (2012). ICT Based Learning Resources Sharing in Open Education. Inaugural Speech. Universitas Indonesia-Depok. Hasibuan, Z.A., Santoso, H.B. (2005). The Use of E-Learning towards New Learning Paradigm: Case Study Student-Centered E-Learning Environment at Faculty of Computer Science - University of Indonesia. Fifth IEEE International Conference on Advanced Learning Technologies (pp. 1026-1030). Taiwan: IEEE. Indrajit, R.E. (2014). APTIKOM Open Education Architectural Framework. Retrieved from http://conference.oeconsortium.org/2014/wpcontent/uploads/2014/02/Paper_38-APTIKOM.pdf Keeffe, I. O., Staikopoulos, A., Rafter, R., Walsh, E., Yousuf, B., Conlan, O., Wade, V., & Okeeffe, I. (2012). Personalized Activity Based eLearning. Paper presented at the 12th International Conference on Knowledge Management and Knowledge Technologies. Laksitowening, K. A., & Hasibuan, Z. A. (2015). Personalized e-Learning architecture in standard-based education. ICSITECH. Lee, L., & Lu, T. C. (2002). Intelligent agent-based systems for personalized recommendations in Internet commerce. Expert Systems with Applications, 22, 275-284. Martinez, M. (2002). Designing learning objects to personalize learning. In D.A. Wiley (Ed.) The Instructional Use of Learning Objects, Agency for Instructional Technology, Bloomington, pp.151–173. Paramartha, A.A. G. Y., Santoso, H. B., and Hasibuan, Z. A. (2014). Ontologybased Learning Object Searching Technique with Granular Feature Extraction. Paper presented at the 16th International Conference on Information Integration and Web-based Applications & Services, Hanoi, Vietnam, ACM, pp. 395-400. Pisutova, K. (2012). Open Education. 10th IEEE International Conference on Emerging e-Learning Technologies and Applications. Slovakia. Pusat Kajian Komunikasi Universitas Indonesia (PKKUI) & Asosiasi Penyelenggara Jasa Internet Indonesia (APJII) (2015). Profil Pengguna Internet Indonesia 2014. Retrieved from http://www.apjii.or.id/upload/statistik/Survey%20APJII%202014%20v3.p df Resnick, P., & Varian, H. R. (1997). Recommender systems. Communications of the ACM, 40, 56-58. Solichin, A. (2010). Design of Information Technology Based on Cloud Computing for Higher Education in Indonesia. Thesis. Faculty of Computer Science, Universitas Indonesia. http://lontar.cs.ui.ac.id/Lontar/opac/themes/ng/detail.jsp?id=32484&lokasi =lokal Asea Uninet Scientific and Plenary Meeting 2016 | 101 Selviandro, N., Suryani, M., & Hasibuan, Z. A. (2014). Enhancing the Implementation of Cloud-Based Open Learning with E-Learning Personalization. Journal-ICACT-TAC-Global IT Research Institute. Sfenrianto, S. (2013). An Approach of Triple-Factor Learning Types in e-Learning Process as a Basis for Learning Recommendation and Personalization. Doctoral Dissertation, The Faculty of Computer Science, University of Indonesia. Shneiderman, B., & Plaisant, C. (2010). Designing the User Interface: Strategies for Effective Human-Computer Interaction (5th ed.). Addison-Wesley Publ. Co., Reading, MA. Suryani, M., Santoso, H. B., & Hasibuan, Z. A. (2014). Learning Content Personalization Based on Triple-Factor Learning Type Approach in Elearning. Paper presented at the ICACSIS 2014. Jakarta, Indonesia. AN EVALUATION OF SOME FIREFLY-INSPIRED SYNCHRONICITY METHODS IN WIRELESS SENSOR NETWORKS Misbahuddin misbahuddin@ui.ac.id Riri Fitri Sari riri@ui.ac.id, Department of Electrical Engineering, Faculty of Engineering, University of Indonesia, Kampus Baru UI, Depok 16424, Indonesia Abstract synchronicity is one of most essential requirements in wireless sensor networks (WSNs). Synchronicity is the ability to arrange simultaneously collective action in the WSNs. This paper presents an evaluation of some synchronicity methods based on a mutual interaction of firefly in a synchronously firing event. The requirement of a robust synchronicity that is simple, fast, low energy consumption, self-configuration, and high scalability are the challenges to achieve it. Therefore, it needs to study in the advance of the performance of every synchronicity method in order to improve them. Among of the methods that will be considered in our study are the synchronicity of pulse-coupled biological oscillators (M&S model), Selective Pulse Coupling Synchronicity Algorithm (SCSA), the Reachback Firefly Algorithm (RFA), and RFA with Late sensitive Window (RFA-LSW). In the literature study, we found that M&S and SCSA model is still a primitive model that reacts immediately to each firing message and also has not yet considered the realistic radio effect and communication latency. Therefore, the SCSA model tries to improve the algorithm of the M&S model. Similarly, the RFA-LSW model tries to enhance the RFA model in the overshooting of the firing event. In this study, we evaluated the rate of convergence in the number of periods to two groups of the synchronicity methods, which is implemented in a language of technical computing (Matlab). The results show that in the first group, the SCSA model can achieve the synchronicity faster than the M&S model. However, in second group the RFA-LSW model has not been able to improve significantly the RFA model in order to achieve the convergence. Thus, the prospective study still requires a lot of essential issues in the WSNs synchronicity in considering the limited energy, communication latency, scalability, and approach to broadcast the periodical firing event as our future work. Keywords: synchronicity, wireless sensor network, firefly algorithm Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 102 Asea Uninet Scientific and Plenary Meeting 2016 1 | 103 INTRODUCTION Wireless Sensor Networks (WSNs) is a set of nodes deployed over a particular area with a distributed infrastructure. A node is a device that has a computation-limited processor, communication and sensing capabilities. The application of the WSNs requires several basic functions such as time synchronization(Lamonaca, Gasparri, Garone, & Grimaldi, 2014), synchronicity (Gielow, Jakllari, Nogueira, & Santos, 2015), self-localization (Kyungmi, Hyunsook, & Youngchoi, 2009; Wei, Zhen, & Haifeng, 2013), and self-configuration (Araujo, de Castro, & Holanda Filho, 2010). There are many natural phenomena in the world that can be an inspiration by scientists to solve various real problems both in the engineering area and more specific in Wireless Sensor Networks (WSNs). One of the most important basic problems in the WSNs is synchronization or synchronicity. Both of the problems are a mutually complementing requirement in the WSNs. The synchronicity is an ability to adjust the internal clock of the nodes in a network to align their time based on a global time in order to conduct simultaneous collective actions. In contrary, the synchronicity is a way to arrange the phase alignment of the internal clock of the nodes to perform synchronously collaborative actions. The synchronization protocol used widely for the Internet is the Network Time Protocol (NTP) (Mills, 1991). This protocol is designed specifically for fixed network and unsuitable for WSNs. Furthermore, there are several synchronization methods that have been used for WSNs among other TPSN (Ganeriwal, Kumar, & Srivastava, 2003), RBN (Elson, Girod, & Estrin, 2002), and FTSP (Maróti, Kusy, & Lédeczi, 2004). However, these methods require a tree-structured or hierarchical-structured network, which need a special root node as a reference node to synchronize the nodes in the network. Such network structures may fail due to additional loads. In addition, in these approaches each node requires a unique ID, which is unsuitable for a large-scaled network. It means that all these limitations can reduce the scalability of the networks (Lin & HongPeng, 2009). This paper describes the transformation from the mechanism of behavior of the firefly swarm flashing synchronously to become a synchronicity algorithm that is suitable to be implemented in the distributed systems like the WSNs. Moreover, it also evaluates the performance of the observed synchronicity methods adopting from a mutual interaction of firefly in a simultaneously firing event. All models are presented on a Graphical User Interface (GUI) of Matlab with providing a number of choices according to the requirements of the models such as algorithm type, and parameter setting. Moreover, the GUI shows a network topology of a set node deployed uniformly. The rest of our paper is organized as follows: Section 1 presents the observed synchronicity algorithms that are begun from a basic concept toward some advanced algorithms based on the firefly-inspired algorithms. Simulation results of the synchronicity methods to evaluate the performance of the algorithms are described in Section 2. Finally, Section 3 concludes this paper and states our future works. 2 FIREFLY-INSPIRED SYNCHRONICITY METHODS The pulse-coupled biological oscillator, which is introduced by Mirollow and Strogatz (Mirollo & Strogatz, 1990), is a basic model of the firefly-inspired algorithm for synchronicity in the WSNs. This model, which is called as M&S model, is described through two oscillators. Each oscillator is characterized by a state function of the oscillator’s phase f(ø) that increases monotonically toward a threshold at f(ø) = 1 as shown in Figure 1. Every time f(ø) reaches the threshold, the oscillator fires and returns 104 | Asea Uninet Scientific and Plenary Meeting 2016 immediately to zero. When one of the oscillators fires, another oscillator responds to the firing event by adjusting its own phase. As a result, a new phase ∅𝑛𝑒𝑤 is obtained through a jump in a strength coupling ɛ. The new phase can be obtained using a following equation (Mirollo & Strogatz, 1990). (1) ∅𝑛𝑒𝑤 = min(1, 𝑓 −1 (𝑓(∅) + 𝜀)) where 𝑓(∅) = 1 . 𝑙𝑛(1 + 𝑏 [𝑒 𝑏 − 1]. ∅) and the parameter b is a dissipation factor. f(Φ) 1 f(Φ1)+ɛ f(Φ1) ɛ ΔΦ 0 Φ1 Φnew 1 Phase Figure 1 The state function of the M&S model The M&S model has still several simple features in algorithm and communication, so that it has several problems that violate the practice in WSNs. A firing event is responded instantaneously by the neighbor nodes without considering an unpredictable delay prior to transmission because of the channel contention. Therefore, Reachback Firefly Algorithm (RFA) introduced by Allen et al. (Werner-Allen, Tewari, Patel, Welsh, & Nagpal, 2005) proposed several practical improvements in the realistic radio effects: estimating of the delayed time of a message before being broadcasted, using the notion of reachback to avoid a node that receives the firing messages out of date, utilizing the pre-emptive message staggering to overcome the worst case in channel contention, and simplifying of the computation of the firing function. The new phase in the RFA model is computed simply in following equation. ∅𝑛𝑒𝑤 = min( 1, (1 + 𝜀)∅) (2) and the total of the phase jumps at beginning of the next period can be calculated by the following equation (Werner-Allen et al., 2005). ∆(∅) = min( 1, 𝜀∅) The pre-empty message staggering intends that a node broadcasts its firing event along with several random time offsets before reaching the cycle end. Moreover, the time information of all neighbor nodes in a period is recorded in a lower probability of message collisions. The timestamps of all received firing messages recorded by the reachback response are used to compute an overall phase jump at the cycle end. Then, it is applied at the beginning of the next period. This principle is shown in Figure 2. (3) Asea Uninet Scientific and Plenary Meeting 2016 | 105 ∅ ∅2 1 ∆(∅𝟐 ) (a) ∆(∅𝟏 ) ∅1 1 t1 t2 t ∅ ∅𝟐 𝟏 (b) ∅𝟏 𝟏 ∆(∅) t1 t2 t Figure 2 (a) the phase jump in M&S model, (b) the phase jump in RFA model The third model is the Selective Coupling Synchronicity Algorithm (SCSA) (Yu et al., 2008). The SCSA proves that in the pulse-coupled model, not all firing messages received from the neighbor nodes can have a potential to approach a convergence. Therefore, only the potentially firing message that accelerates the convergence will be received as a jump action. This model uses the state function of the M&S model with the dissipation factor b = 1. Thus, its state function is simpler than that of the M&S model as following equation (Yu et al., 2008). 𝑓(∅) = ln(𝑒 − 1) . ∅ + 1 (4) The node will jump at a new phase using the following equation (Yu et al., 2008): ∅𝑛𝑒𝑤 = { 𝑓 −1 (𝑓(∅) + 𝜀), 0, 𝑓 −1 (𝑓(∅) + 𝜀) < 1 𝑜𝑡ℎ𝑒𝑟𝑤𝑖𝑠𝑒 (5) The last model is the Reachback Firefly Algorithm with Late Sensitive Window (RFA with LSW). This model is assumed that there is a delay of the firing message. Therefore, each time a node fires, it assigns a waiting time W to receive the delayed messages before it processes the firing events in the queue. In this case, W<<T, and the processing time is assumed as very short time, so that it can be neglected in the algorithm. When node i achieves the phase state ∅𝑖 = 1 (T), it fires and calculates the time jump adjustment based on the received firing message in the previous cycle. Thus, the new phase can be calculated using the firing function with adding LSW in the following equation (Lin & Hong Peng, 2009). ∅ ≤ 𝐿𝑆𝑊 × 𝑇 𝑎𝑛𝑑 (1 + 𝜀)∅ ≥ 𝑇 0 (6) ∅2 = {(1 + 𝜀)∅ ∅ ≥ 𝐿𝑆𝑊 × 𝑇 𝑎𝑛𝑑 (1 + 𝜀)∅ < 𝑇 1 𝑜𝑡ℎ𝑒𝑟𝑤𝑖𝑠𝑒 where 𝐿𝑆𝑊 ∈ [0,1]. The equation (6) that adds a LSW factor can avoid the calculation of the firing message coming so early in the period that push nodes a far way which is an important cause for the unstable points. 106 | Asea Uninet Scientific and Plenary Meeting 2016 Furthermore, both M&S and RFA utilize the mechanism of phase advance. The phase advance model is very unpractical because it generates a lot of firing messages in initial phase of the synchronicity: the shorted phase will trigger more and more advanced flashed which quickly overload the network. The LSW can reduce the extent that phase being shorted, thus reduce the frequency of flashed. As a result, the overload of broadcasting message would be reduced. 3 SIMULATION RESULTS AND DISCUSSION The simulation of the firefly-inspire synchronicity methods to evaluate the performance of each method uses the following specification: 1) 2) 3) A computer that has a processor Inter(R) Core(TM) i3-2330M CPU@2.20 GHz, and installed RAM 4.00 GB. Operating System 64-bit Microsoft Windows 7 The Language of technical computing (Matlab) version 7.8.0.347 (R2009a) The network topology is a set of nodes that deployed uniformly on a rectangular area sized 100 x 100 m2 as shown in Figure 3. In this study, the number of nodes used is 50 nodes. Figure 3 the network topology The parameter setting used to evaluate the performance of these methods is the number of periods in achieving the convergence. It is tested in the variety of the strength coupling in range 0.005, 0.01, 0.02, 0.05, 0.07, 0.1, 0.15, and 0.2. In this evaluation, there are two groups of the testing, (1) the group of M&S and SCSA model, and (2) the group of RFA and RFA-LSW model. We divide two groups of the testing because each group has a different capability. The first group is a synchronicity method that only exhibits the synchronicity mechanism based on the firing event of firefly, but it has not considered the communication delay yet. Similarly, in second group it not only considers the realistic communication but also the simplification of the firing function. In first testing as shown in Tabel 1, we can see that the average of the number of periods in achieving convergence in the SCSA model is smaller than those of the M&S Asea Uninet Scientific and Plenary Meeting 2016 | 107 model. Moreover, Figure 4 shows that the SCSA algorithm is better than the M&S model except at beginning and two last of the range of strength coupling. Next, Table 2 that is the second testing shows that the average of the number of periods the RFA-LSW model is smaller than those of the RFA model. However, generally both methods are almost same except in the first of the range of testing. Table 1 Comparison between M&S and SCSA model SCSA M&S Strength Coupling 0.005 0.01 0.02 0.03 0.05 0.07 0.1 0.15 Number of periods Methods 0.2 Average 245 63 16 17 8 6 6 9 8 42 233 116 20 21 17 10 7 5 6 48 Table 2 Comparison between RFA and RFA-LSW model RFALSW RFA Number of periods Methods Strength Coupling Average 0.005 0.01 0.02 0.03 0.05 0.07 0.1 0.15 0.2 138 55 37 22 19 11 15 17 15 37 325 55 37 22 19 11 15 17 15 57 350 Number of periods Number of periods 250 200 150 250 200 RFA RFA-LSW M&S 150 SCSA 100 100 50 50 0 0 0.005 0.01 0.02 0.03 0.05 0.07 0.1 Strength Coupling Figure 4 Comparison between M&S and SCSA model 4 300 0.15 0.2 0.005 0.01 0.02 0.03 0.05 0.07 0.1 0.15 0.2 Strength Coupling Figure 5 Comparison between RFA and RFA-LSW model CONCLUSIONS To evaluate the performance of the synchronicity methods, we divide them in two groups. The first group is the M&S model and the SCSA model, and the second group is the RFA model and the RFA-LSW model. The performance of both groups can be concluded that in the first groups, the SCSA model can achieve the synchronicity convergence faster than the M&S model. Similarly, the average of the number of periods the RFA-LSW model is smaller than those of the RFA model. However, it has not yet been able to improve significantly the RFA model in order to achieve the convergence. 108 | Asea Uninet Scientific and Plenary Meeting 2016 The prospective study still requires a lot of essential issues in the WSNs synchronicity in considering the limited energy, communication latency, scalability, and approach to broadcast the periodical firing event as our future work. REFERENCES Araujo, H., de Castro, W. L. T., & Holanda Filho, R. (2010). A proposal of selfconfiguration in Wireless Sensor Network for recovery of broken paths. In Sensors Applications Symposium (SAS), 2010 IEEE (pp. 245–250). http://doi.org/10.1109/SAS.2010.5439391 Elson, J., Girod, L., & Estrin, D. (2002). Fine-grained network time synchronization using reference broadcasts. SIGOPS Oper. Syst. Rev., 36(SI), 147–163. http://doi.org/10.1145/844128.844143 Ganeriwal, S., Kumar, R., & Srivastava, M. B. (2003). Timing-sync protocol for sensor networks. Proceedings of the 1st International Conference on Embedded Networked Sensor Systems. Los Angeles, California, USA: ACM. http://doi.org/10.1145/958491.958508 Gielow, F., Jakllari, G., Nogueira, M., & Santos, A. (2015). Data similarity aware dynamic node clustering in wireless sensor networks. Ad Hoc Networks, 24, Part A(0), 29– 45. http://doi.org/http://dx.doi.org/10.1016/j.adhoc.2014.07.008 Kyungmi, K., Hyunsook, K., & Youngchoi, H. (2009). A Self Localization Scheme for Mobile Wireless Sensor Networks. In Computer Sciences and Convergence Information Technology, 2009. ICCIT ’09. Fourth International Conference on (pp. 774–778). http://doi.org/10.1109/ICCIT.2009.140 Lamonaca, F., Gasparri, A., Garone, E., & Grimaldi, D. (2014). Clock Synchronization in Wireless Sensor Network With Selective Convergence Rate for Event Driven Measurement Applications. Instrumentation and Measurement, IEEE Transactions on, 63(9), 2279–2287. http://doi.org/10.1109/TIM.2014.2304867 Lin, C., & HongPeng, W. (2009). Reachback Firefly Synchronicity with Late Sensitivity Window in Wireless Sensor Networks. In Hybrid Intelligent Systems, 2009. HIS ’09. Ninth International Conference on (Vol. 1, pp. 451–456). http://doi.org/10.1109/HIS.2009.93 Maróti, M., Kusy, B., Gyula Simon, & Lédeczi, Á. (2004). The flooding time synchronization protocol. Proceedings of the 2nd International Conference on Embedded Networked Sensor Systems. Baltimore, MD, USA: ACM. http://doi.org/10.1145/1031495.1031501 Mills, D. L. (1991). Internet time synchronization: the network time protocol. Communications, IEEE Transactions on, 39(10), 1482–1493. http://doi.org/10.1109/26.103043 Mirollo, R. E., & Strogatz, S. H. (1990). Synchronization of pulse-coupled biological oscillator. SIAM Journal on Applied Mathematics, 50(6), 1645–1662. Wei, L., Zhen, Y., & Haifeng, H. (2013). A new variant of sum-product algorithm for sensor self-localization in wireless networks. In Communications in China (ICCC), 2013 IEEE/CIC International Conference on (pp. 628–632). http://doi.org/10.1109/ICCChina.2013.6671189 Werner-Allen, G., Tewari, G., Patel, A., Welsh, M., & Nagpal, R. (2005). Firefly-inspired sensor network synchronicity with realistic radio effects. Proceedings of the 3rd International Conference on Embedded Networked Sensor Systems. San Diego, California, USA: ACM. http://doi.org/10.1145/1098918.1098934 Asea Uninet Scientific and Plenary Meeting 2016 | 109 Yu, N., d’Auriol, B. J., Xiaoling, W., Jin, W., Jinsung, C., & Sungyoung, L. (2008). Selective Pulse Coupling Synchronicity for Sensor Network. In Sensor Technologies and Applications, 2008. SENSORCOMM ’08. Second International Conference on (pp. 123–128). http://doi.org/10.1109/SENSORCOMM.2008.59 AN SDR-BASED TESTBED FOR EVALUATION OF RADAR WAVEFORMS FOR VARIOUS RADAR APPLICATIONS Gamantyo Hendrantoro gamantyo@ee.its.ac.id* Prasetiyono Hari Mukti prasetiyono@elect-eng.its.ac.id Puji Handayani puji@ee.its.ac.id Devy Kuswidiastuti devy@ee.its.ac.id Institut Teknologi Sepuluh Nopember Surabaya, Indonesia Abstract This paper reports the development of a radar testbed as an evaluation tool that can be used in future studies on new radar technology. The development of the testbed is based on the programmability of software-defined radio (SDR) technology, which is important in evaluating new radar concepts that involve new waveforms and/or signal processing techniques. In our case, the testbed would be beneficial in trying out radar systems to be used in detection and classification of migrating birds from the micro-Doppler effects generated by the birds' moving wings. We build a testbed around a software-defined radio (SDR) platform in the form of National Instrument's USRP, equipped with additional RF modules and antennas. The USRP at the transmitter can be programmed to send different waveforms at any desired carrier frequency, whereas at the receiver a variety of processing techniques can be applied to obtain the desired objectives. The received baseband samples obtained from the processing are subsequently stored in a computer for further processing and analysis. As such, a wide range of waveforms can be tested and their performance evaluated. We have successfully used the testbed to assess the adoption of PN sequence-modulated carrier, FMCW (frequency-modulated continuous carrier wave), and OFDM (orthogonal frequency division multiplexing) waveforms and the required signal processing for radar detection of distance and velocity of objects. Keywords: Radar, testbed, software-defined radio, waveform, signal processing. 1 INTRODUCTION Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 110 Asea Uninet Scientific and Plenary Meeting 2016 | 111 Radars have taken important roles in many civil and military applications. Examples include automotive radars for smart cars (Schipper et al, 2015), radar detection of illegal weapons in public areas (Ahmad and Amin, 2010), or bird migration radars for bird monitoring and classification, the latter being planned for a potential collaboration between ITS and TU Graz. Such a variety of applications might require different waveforms and signal processing techniques. For example, automotive radars that require detection of range and velocity might employ FMCW or OFDM-based waveforms (Sturm et al., 2009), while for others pseudo-noise (PN) sequence might be preferable. In addition, signal processing methods required for certain purposes like micro-Doppler detection might be needed for radar systems aimed at identification and classification of objects. Field trials of new waveforms and signal processing techniques require a programmable radar testbed for performance evaluation. We build a testbed around National Instrument's USRP, a software-defined radio (SDR) platform based on FPGA technology. The platform is equipped with additional RF modules and antennas. The USRP at the transmitter can be programmed to send different waveforms at any desired carrier frequency, whereas at the receiver a variety of processing techniques can be applied to obtain the desired objectives. The received complex baseband samples obtained can be processed further once they are stored in the attached computer. Real-time processing can also be executed through the LabView-based GUI. As such, a wide range of waveforms can be tested and their performance evaluated. The testbed has successfully demonstrated radar systems employing PN sequencemodulated carrier, FMCW (frequency-modulated continuous carrier wave) (Khakim et al, 2015), and OFDM (orthogonal frequency division multiplexing) (Kuswidiastuti et al, 2015) waveforms and the required signal processing for radar detection of objects in the distance and Doppler velocity domains (Kuswidiastuti et al, 2015, Prasetyo, 2016). Further development can be made by employing multiple transceivers and receivers in MIMO configuration to support detection capability in the angular domain. The testbed would be useful to demonstrate new concepts and techniques in radar technology, including, for example, its use in detecting and classifying flying birds by exploiting their micro-Doppler signatures (Chen et al, 2006). In the following, we describe the development of the testbed and its future use and improvement, especially related to possible research collaboration within the ASEA-UNINET framework. Accordingly, this paper is both research-based and conceptual in nature as it reports the development of the testbed as evaluation tool for new radar techniques and its future role in evaluation of techniques for realization of birddetecting and classifying radar systems. 2 2.1 TESTBED DEVELOPMENT AND TESTING System Design and Development The testbed design as shown in Fig. 1 consists of the transmit and receive subsystems, equipped with a computer, a power amplifier for the transmitter, a low-noise amplifier for the receiver and antennas for both subsystems. The core of the system is a pair of National Instrument's USRPs (Universal Software Radio Peripheral), one for each of the transmit/receive subsystems. It is an FPGA-based SDR platform that, as commonly found in other SDR platforms, provides flexibility in adjusting the modulation scheme, symbol rate, sampling rate, and so on, making it a powerful tool to evaluate various communication and radar systems with different waveforms and processing techniques. The USRP at the transmitter side is fed by the computer that supplies the waveform programmed through a user interface like Matlab or LabView. The waveform signal is subsequently generated in 112 | Asea Uninet Scientific and Plenary Meeting 2016 the USRP main board according to the previously specified symbol rate and sampling rate, which is then up-converted to the desired radio frequency by a daughter board. The radio wave is radiated by the transmit antenna to an object that will reflect it to the receive antenna. In our design, we separate the transmit and receive antennas to eliminate the need for a duplexer or a switch, which might complicate the testbed design. To mitigate the mutual coupling between them, an aluminum board is placed vertically between them. The mutual coupling effect has been measured and found to be less than -55 dB. At the receiver, an LNA is employed to amplify the received signal. Next, the USRP at the receive side performs the down-conversion with the help of its own daughter board as well as processing of the received signal in real time. If necessary, additional, nonreal-time, more complex processing steps can be carried out off-line to the recorded version of the complex signal, i.e. the in-phase (I) and quadrature (Q) signals. The realization of the testbed and an illustration of its typical use in radar demonstration and evaluation are presented in Fig. 2. USRP Transmitter Subsystem Baseband/IF Signal Generator Computer Waveform Modulator / Up-Converter Power Amplifier Target Receiver Subsystem Target Information Baseband/IF Signal Processor Demodulator / Down-Converter Low-Noise Amplifier Fig. 1 The block diagram of the USRP-based radar testbed. (a) (b) Fig. 2 The radar testbed: (a) the realization and (b) an illustration of how it is used in an evaluation of a radar system. 3 TESTING The testbed has been tested to realize three types of radar waveform, namely, PN-sequence modulated carrier, linear frequency modulation (LFM) and OFDM. Each of these Asea Uninet Scientific and Plenary Meeting 2016 | 113 waveforms is set up in Matlab or LabView on the computer. The USRP generates each of them according to the specified symbol and sampling rates. The PN sequence tested is an eighth-order (255-bit) maximal-length sequence generated at sampling rate of 50 MS/s with 8 bits/sample resolution. This leads to a range resolution of approximately 6 m, which is relatively large for a short-range radar, but will suffice for the purpose of radar system testing and evaluation. The object range estimate can be obtained by correlating the original PN-sequence and the copy received by the receiver subsystem. In our case, the correlation process is performed off-line upon the recorded complex baseband. The LFM is generated in the form of a sinusoidal signal with frequency that is linearly increasing with time, producing a chirp signal over a period of time (and a range of spectrum). When a copy of the LFM signal is received by the radar after reflection off an object, the copy has experienced a delay proportional to twice the range of the object from the radar. When the delayed copy is mixed with the LFM signal synthesized by the receiver USRP working in synchronism with the transmitter USRP, the result is a sinusoidal wave with the beat frequency, i.e., the frequency difference between the radar's LFM and the delayed copy. Consequently, the distance of the object from the radar can be estimated from the beat frequency. Fig. 3 depicts the form of the received LFM signal copy of a radar, the fundamental shape of which still show a waveform with increasing frequency, although with a time-varying amplitude. The object range estimate can be found from the beat frequency obtained by multiplying this signal with the radar-generated LFM. The computation of the beat frequency and the distance estimate can be done either in real time or off-line. Fig. 3 The received LFM signal reflected off an object 6 m from the radar. Lastly, an OFDM signal is tested with 1024 subcarriers generated at a sampling rate of 50 MS/s centered at 2.4 GHz. For an OFDM radar, the object distance can be estimated by analyzing the subcarriers, whereas the velocity can be deduced from the multiple symbols reflected back by the object (Sturm et al, 2009). Fig. 4 shows the frequency spectrum of the USRP generated OFDM waveform and that of the reflected waveform received by the radar. As before, the processing of the received waveform, e.g. the removal of cyclic prefix, as well as the analysis to obtain the object range and velocity is done off-line. 114 | Asea Uninet Scientific and Plenary Meeting 2016 (a) (b) Fig. 4 The OFDM waveform spectrum: (a) generated by the transmitter USRP and (b) received by the radar receiver after reflection by an object. 4 POTENTIAL USE IN FUTURE RESEARCH With the radar testbed available, radar systems with various waveforms and signal processing techniques can be evaluated in advance of their realization. One of the examples of interest is a radar system with capability of detecting micro-Doppler signature of an object. Moving objects like cars, helicopters or birds, when returning a radar signal can produce Doppler shift due to the velocity of their movement. In addition to that, the rotation of the car engines, that of the helicopter rotating blades, or the motion of the flapping wings of the birds can produce smaller Doppler spread occupying both positive and negative Doppler spectrum. This phenomenon known as micro-Doppler might represent the characteristics of the object and therefore is usually deemed as the object signature (Chen et al, 2006). Fig. 5 illustrates the Doppler spectrum from a target moving at relative velocity v with a micro-Doppler portion symmetrical around the zero frequency. Doppler shift MicroDoppler 0 fv f Fig. 5 An illustration of Doppler spectrum consisting a Doppler shift due to the object steady motion and a micro-Doppler double-sided segment due to movement of some parts of the object. In this case, the complexity involved includes the extraction of the signature from the signal received by the radar and the matching of the signature with those in the database. The former might necessitate the adoption of time-frequency analysis (Thayaparan et al, 2007), whereas the latter becomes complex whenever the database is large and the matching criteria show some similarity or correlation among different entries. Due to these processing complexities, the availability of the radar testbed becomes important. Not only should the radar waveform and the corresponding processing algorithms be optimized to Asea Uninet Scientific and Plenary Meeting 2016 | 115 better capture the range, Doppler and micro-Doppler information, but also the method to find the best estimate of the object identity has to be developed and tested. In the future, we hope that experiments on the bird radar can be well supported by the testbed. The radar itself would be beneficial for monitoring the population of migrating birds transiting regularly at certain locations, e.g., the mangrove beach in Surabaya, Indonesia, periodically visited by birds migrating between the northern and the southern parts of the hemisphere. The implementation would also require the involvement of biologists, especially for identification and characterization of various species of the birds with respect to their respective flaps. REFERENCES Ahmad, F., Amin, M. G. (2010) "Radar Waveform Design for Detection of Weapons", International Workshop on Cognitive Radar Processing. Chen, V. C., Li, F., Ho, S.-S., Wechsler, H. (2006) "Micro-Doppler Effect in Radar: Phenomenon, Model, and Simulation Study", IEEE Transactions on Aerospace and Electronic Systems, 42(1). Khakim, N., Mukti, P. H., Kuswidiastuti, D., Hendrantoro, G. (2015) "Preliminary Results on S-Band LFM Radar Development for Submarine Surveillance", IEEE International Conference on Advanced Mechatronics, Intelligent Manufacture, and Industrial Automation, Surabaya, Indonesia. Kuswidiastuti, D., Handayani, P., Hendrantoro, G., Widjiati, E., Ligthart, L. P. (2015) "OFDM Waveform Design Parameters for Submarine Radar", IEEE International Conference on Aerospace Electronics and Remote Sensing Technology, Denpasar, Indonesia. Prasetyo, R. H. (2016) personal communication. Schipper, T., Schlichenmaier, J., Ahbe, D., Mahler, T., Kowalewski, J., Zwick, T. (2015) "A Simulator for Multi-User Automotive Radar Scenarios", IEEE MTT-S International Conference on Microwaves for Intelligent Mobility,. Sturm, C., Reichardt, L., Zwick, T., Wiesbeck, W. (2009) "Evaluation of Beam-Forming Algorithms for Automotive OFDM Signal Based Radar", European Radar Conference, Rome, Italy. Thayaparan, T., Abrol, S., Riseborough, E., Stankovic, L., Lamothe, D., Duff, G., "Analysis of Radar Micro-Doppler Signatures from Experimental Helicopter and Human Data", IET Radar Sonar Navigation, 1(4), 289-299. ASSESSING ADAPTABILITY IN OLD BUILDINGS Tanti S.R. Nasution t.nasution@arch.its.ac.id* Kirami Bararatin q.ramy.b@gmail.com Department of Architecture, Institut Teknologi Sepuluh Nopember Susetyo Firmaningtyas yayas.sf@gmail.com Laboratory of Housing and Human Settlement, Department of Architecture, Institut Teknologi Sepuluh Nopember Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract Building adaptability is an idea related to the capability of a building to be transformed and adapted based on the evolving needs of its user. A theory suggested that the assessment can be conducted by disintegrating building into layers, i.e.: site, structure, services, space plan, and stuffs. Those layers are based on each of their permanence: site as the most permanent to stuffs that can be changed weekly or even daily. Previous researches have shown that in urban and sub-urban areas, one of historical areas experiencing rapid change is Chinese settlement, which is interesting because generally Chinese houses have fixed form and space layout. Therefore, this research will be focused on Chinese settlement located in sub-urban area considering that original building can be explored and the adaptability can be assessed. The area considered to be the location of this research is Chinese settlement in Lasem. By using descriptive qualitative method, the adaptability of the building will be assessed by collecting samples with different level of physical changes: buildings with a few changes, buildings with changes in particular component, and buildings with substantial changes. Each will be observed by disintegrating it into six layers to find which building component is the most heavily changed and how far the changes can be traced. The output expected is to generate information about the capability of old buildings to adapt with changes and how it can be used to generate new knowledge about design method that involve adaptability as one of its aspect. Keywords: adaptability, Chinese settlement, old buildings Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 116 Asea Uninet Scientific and Plenary Meeting 2016 1 | 117 INTRODUCTION The importance of designing with consideration of adaptability lies in the idea that the building has its own lifetime that are directly related to durability and feasibility. The lifetime of a building is commonly associated with structural systems and materials applied to the building. A certain structural system will bring different effect with other structural systems, as well as the material. There are materials that can last a long time with minimal maintenance, but there are also materials that need to be replaced within a short time frame. Not only those two considerations, every single thing applied directly on the building will give impacts on the durability of the building. Adaptability is also related to how far a building can adapt itself to the changing environmental context in many aspects, especially in the non-physical aspects such as culture, technology, and even demographics. These changes will bring about a change in perspective occupants treat their space. Occupants may change specific parts of the house that used to have important cultural values since they no longer apply the culture in his generation. Occupants can also change the building because of the need for higher practicality, for example: replacing the wooden doors with automatic doors, and so on. Another example that occupants do is to change the building which was a single-family housing into multi-family housing because of the market opportunities and the need for it. Old buildings located in city are those experienced most changes since the time of its construction until today. Change given in these buildings often adjust the functions imposed on them, even though the function is not necessarily the same as the original. Moreover, older buildings are generally built with special functions and their designs are not flexible to accommodate a variety of functions. This causes any changes made will greatly affect its original form. Such changes are not only costly, but at one point will also pose technical risks on the building. The research developed will be focusing on adaptability related to the physical aspects of the building. Physical aspects in question are visible parts of the building and can be observed directly. In this study, changes made to the building will also be studied, especially those carried out as a result of changes in building function, either in a certain space of the building or changes in the building function as a whole. However, things that are not directly related to changes in the building - the history, beliefs, and cultures - will only be used as a background for the changes and will not be discussed in detail. Through this research, it is expected that adaptability in old building can be investigated in depth. Results of the study are used to get the possibilities of its use in the future or otherwise: find the cause of why the old building is difficult to use. In addition, the results will also be used as a basis to find a new design method that involves adaptability as an aspect. By considering the adaptability, the design produced is expected to be used in a variety of functions without complex intervention on the building. 2 2.1 THEORITICAL REVIEW AND RESEARCH METHOD Defining adaptability Douglas (2006) stated that change, as well as death, is an inevitable thing, and the nature and pace of change continues to increase, especially with the development of technology. Building adaptation is basically about how a building respond the changing needs. Adaptation is thus an effort associated with managing and controlling change in the context of function and physical properties of the building. Such changes, can be classified into three scales, namely: 118 | Asea Uninet Scientific and Plenary Meeting 2016 (a) (b) (c) Small scale, is a change in the low level and this change usually involves only a small improvement on façade, improving the quality of fittings, and smallscale expansion, for example: replacement of tiles, doors, adding a terrace/balcony, etc. Medium scale, is a change in a more substantial level. The types of adaptations made already started to involve changes in building function, a major change on the surface and building elements, utility rejuvenation, and structural modification. Examples of this scales include: vertical expansion of the building, changing building function from a house into an office and vice versa, the removal/addition of a wall, etc. Large scale, is a form of adaptation to the drastic changes that include remodelling works, the reconstruction of a new building behind the main wall, up to large-scale changes in the structure of the building to expand/reduce the building area related to building capacity or change its function, for instance: the restoration of the ruins, the strengthening of the facade, etc. Another opinion regarding adaptability was proposed by Towers (2005) who stated that adaptability is a form of proper action in urban renewal for buildings that can still be retained and improved. Furthermore, he mentioned that adaptability is a principle which gives opportunity for the occupants to reshape their house from time to time to meet the ever changing needs. Meanwhile, Oliver (2006) suggests that for those who live in suburban, freedom to provide individual value on their dwelling is one of the reasons that led to the housing area being more resilient than high-rise buildings for mass housing. The opportunity for the occupants to keep individualizing their dwelling would ensure their appropriateness to express values of the new century. 3 CHANGES IN BUILDINGS AND ITS DEGREE In terms of change in buildings, Douglas (2006) put building changes in several forms: changes in function, changes in size, and changes in performance. Duffy (1993 in Douglas, 2006) said that building adaptation is the process by which they are made to respond to their historical, temporal and physical contexts. In physical aspect of a building, further explanations about changeability in buildings is explained by Brand (1994) through his theory about shearing layers of change as explained on Table 2 and illustrated in Figure 1. Table 2. Brand's shearing layers of change Shearing layers Site Description Typical lifespan eternal/permanent Space plan Geographical setting, urban location, legally defined lot Foundation and load-bearing elements Exterior surfaces/ envelope The working guts: wiring, MEP, HVAC, utilities, etc. Interior layout Stuff Furniture and equipment Structure Skin Services 30 - 300 years about 20 years 7-15 years 3 years, up to 30 years in special cases daily to monthly, less than 3 years Asea Uninet Scientific and Plenary Meeting 2016 | 119 Figure 1. Shearing layers of change (Brand, 1994 from Douglas, 2006) The shearing layers of change shows different lifespan of each building component which means different component may require maintenance, repair, or adaptation at different time or phase with another component. This shearing layers can also be used as a base to determine changeability in a building. The more permanent the layer, the harder it is to be adapted. Meanwhile, the cycle of maintenance, repair and adaptation to a building depends primarily on several factors (Brand, 2006): (a) (b) (c) (d) (e) the purpose or function of the building (e.g. farm buildings are generally of a lower construction standard than dwellings); the quality of the building (e.g. its condition and architectural importance); the use, misuse and abuse the building is subjected to; statutory requirements, especially those relating to health and safety; the requirements and expectations of the users/owners. From the theories above, it can be learnt that adaptability on building depends highly on the building type, scope, basic function, and other contexts which affect its existence. The adaptability rate and process are also differed by the consideration of the intended adaptation scale and lifespan of each building components. 4 RESEARCH METHOD 4.1 Research parameters In this research, physical aspect of every building will be measured by using Brand's shearing layers of change which include: site, structure, skin, services, space plan, and stuff. Its change will be observed by Douglas' scale of adaptation: small, medium, and large scale. These information will be used to find which 120 | Asea Uninet Scientific and Plenary Meeting 2016 physical aspect of a building most likely to be adapted and in what scale the adaptation took place. 4.2 Samples The samples taken will be old buildings in historical area. Since historical areas in either urban or sub urban areas in Indonesia are large and divided into smaller areas, this research will be focused on Chinese settlement area. According to history, after the Chinese traders settled in the areas by the river or seas, the trading activity is increased and the settlement area became increasingly crowded. The area began to grow and several types of Chinese building began to appear: courtyard houses, row houses, house of worship, and shop-houses (Nasution, Faqih, Silas, 2012). The area where shop-houses concentrated became a pioneer for a city centre. Based on this idea, the Chinese settlement is chosen since there will be various building type in this area. This variety is expected to provide a range of adaptation took place and resulted in a comprehensive understanding about adaptability. Chinese houses also have a tendency to have gradual, incremental change instead of an extreme or major ones that make the changes and adaptation processes traceable. 4.3 Proposed research stages As the research samples have been determined, each sample will be observed by using Brand's shearing layers of change. The information gathered are expected to be able to define what type of buildings most likely to be adapted and which building layer most likely to have change. Each of the six layers then be observed based on Douglas' adaptation scale to gather information about the scale of changes occurred in each layer and find out its adaptation phase. The adaptation phase is related to whether the change was done either incrementally or extremely. Since the purpose of this research is to generate information about the capability of old buildings to adapt with changes, this information is sufficient for each sample in each location. Further research will duplicate this method in other old buildings in historical areas to make a comparison between each location. After several research in different locations, the data gathered can be used to construct a general ideas of adaptability in old houses, especially Chinese houses in urban/suburban areas in Indonesia. Each physical aspect (layer) is observed based on its adaptation scale Each sample is observed through its physical aspects (layers) Shearing layers of change Adaptation scale Site Sample: House; Shop-house etc. Structure Small Skin Medium Services Large Space plan Stuff Information gathered: 1. Types of buildings most likely to be adapted 2. Which layers most likely to be changed Information gathered: 1. In what scale changes in each layer occurred 2. Adaptation phase (incremental or extreme change) Figure 2. Proposed research stages Asea Uninet Scientific and Plenary Meeting 2016 5 5.1 | 121 FINDINGS AND DISCUSSION Previous study: Chinese settlement in Pekalongan, Central Java Study about changes in Chinese settlement had been done in 2014 with focus on acculturation process between Chinese and Javanese settlement in Pekalongan (Nasution, 2014). During the research process in 2012, another result emerged while tracing changes in Chinese houses. A lot of houses in the area changed its function several times since the initial development. Based on observation in 2012 which included 31 samples of old buildings, there are 5 types of building adaptation occurred in Chinese Settlement in Pekalongan (Nasution, Faqih, Silas, 2012) as shown below. Table 3. Result of observation about old buildings adaptation in Chinese settlement in Pekalongan (Nasution, Faqih, Silas, 2012) Type Type 1 Type 2 Type 3 Type 4 Type 5 Description Old buildings which physical features and functions are preserved Old buildings that were preserved physically but given a new function Old buildings that were modified in order to be able to fulfil their original function Old buildings that were modified and given new function Entirely new buildings settled by demolishing the old buildings Amount 4 5 14 5 3 The observation result shows that majority of surveyed old buildings were modified in order to fulfil its original function. It means that old buildings in the area were retained and along with the evolved needs of the dweller, the building needs to be adjusted. However, basically, it can be said that old buildings in this area were adaptable. The fact also shows that only a small number of old buildings demolished to build a new one. Figure 3 and 4 shows samples from each type. Figure 3. Left to right: adaptation Type 1, Type 2, and Type 3 (Nasution, Faqih, Silas, 2012) 122 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 4. Left to right: adaptation Type 4 and Type 5 (Nasution, Faqih, Silas, 2012) 5.2 Lasem, the old Chinatown The first area observed in this research is Chinese houses in Lasem, a small district in Kabupaten Rembang, Central Java. Lasem has a long inseparable history with Chinese sojourners and their stories for centuries. In statistics, Lasem has an area of 45.04 km2 with population of 47.868 as of 2005. Figure 3 shows Lasem location and the research context. Figure 5. Location of Lasem. White line shows the national road connecting Tuban and Rembang, blue line shows River Lasem. Area shaded with pale yellow shows the centre of Lasem, and the orange shaded shows the area where Chinese settlement concentrated Lasem was one of the oldest port for Chinese traders who come into Nusantara dated back to the 14th century. The settlers first come to Lasem and make a settlement along the River Lasem to ease their trading activities. In the 19th century, Lasem was well known as a place for opium trading. A house called rumah candu (opium house) is opened for public to see the place where they distributed opium at that time. Settlement in Lasem was spreading from along the river to west and up to the market at the east part of Lasem mainly caused by the arterial road or postweg built by Daendels in 19th century. Chinese houses also concentrated in Desa Karangturi where most houses are courtyard houses. These houses are not directly adjacent to the river. Instead, it is located Asea Uninet Scientific and Plenary Meeting 2016 | 123 on the east side of the river. Courtyard houses in this area generally have gates. There are two kinds of gates that can be found, i.e. the gatehouse and the small gate. This gate is an entrance of a compound belonged to a family which encloses the front yards of the compound to the public street. After the Dutch move the regency capital to Rembang, sold alun-alun to the Chinese where they began to build their shophouses there. The alun-alun, embellished with Chinese shophouses, was gradually transformed into market which became new centre for trading activity (Pratiwo, 2002). Today, those Chinese shophouses can still be seen around this area. 5.3 Chinese building types in Lasem Courtyard house (dwelling) Courtyard house is common in Lasem which make this Chinese settlement is distinctive from those in urban area where land is limited thus it is quite hard to have a compound. In Lasem, a compound is bordered with a gate as the main entrance. This dwelling type is commonly found both along the river or at the inner settlement (desa). Figure 6 shows courtyard houses that is only used as a dwelling unit. The upper pictures show parts of opium house which is still dwelled by the descendants of the family. When the family is rich, the compound may consist of several building units and it even have its own graveyard. Courtyard house which was only acted as a dwelling may have its own limitation on being adapted. There were not many changes occurred in these houses which means that either the house can fulfil today's need properly or the house was left to deteriorate. Those two conditions shows different polar. When a building can fulfil its occupants needs, in a sense it can be said the building is flexible, if not adaptable. It means that the building has already had necessary requirement for future use. However, it is going to be a problem when a building was not changed because its occupant want it to deteriorate. This could bring an understanding that old houses is uninhabitable. 124 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 6. Upper pictures: parts of rumah candu (opium house), lower pictures: courtyard houses in Karangturi Asea Uninet Scientific and Plenary Meeting 2016 | 125 Courtyard house (dwelling and HBE) Figure 7. Courtyard houses functioned as dwelling and batik workshop. A special feature in Lasem, as in other north coast area of Java, is its peculiar batik which is known as batik pesisir. Even though it has similar name with batiks from Pekalongan or Cirebon, it has distinctiveness in motifs and colouring methods. In Lasem, it's not unusual to find batik made a Chinese. In fact, some Chinese houses are also a batik workshops, and some of the owners are prominent among other batik makers. In this house type, the workshop is in separated pavilion from the living area. The workshop is equipped with necessary space to conduct the whole process of batik making. Some houses even provide space for gallery or showroom inside their house. Since there are designated space for each activity, the adaptability of this house type cannot be confirmed yet. It should be known in advance whether the workshop was designed together with the house or after the house was built. This information is essential because if the workshop space was designed together with the house, it means that the workshop has no direct connection to adaptability of the house. On the contrary, if it was an additional feature to the compound, it means that courtyard houses, especially those located in a compound, have possibilities on being adapted by adjusting land and space inside the compound. Shop-house Shophouses in Lasem are concentrated in market area and along the artery road. Shophouse is the type of buildings that have the most changes and adaptation in its physical feature such as changes in door used. The original door was possibly made from wood but as the requirement for safety as well as the material lifetime, the door was changed into accordion doors made from metal. Figure 8 shows two shophouses where one is a one-story (Fig.8 left) and the other is a two-story (Fig.8 right). The first shophouse is seen to have retained more original feature that the other one. The building form including the roof is retained as well as its original material. On the other hand, the two-story shophouse is seen to have more changes, such as: the door in the first story and new material applied in the facade. However, this building is also retaining a part of its original structure as seen from the side gable. Some other shop houses in this corridor even have more extreme changes in its form. Besides its form, shophouses rarely have functional conversion. Since its original function is for both living and dwelling, the function itself has been quite flexible for the user. 126 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 8. Shophouses in Lasem. Left: one-story shophouse. Right: two-story shophouse (Google) House of worship Figure 9. Cu An Kiong Temple. Most physical aspects of this building is still in its original state. As a prominent port for Chinese traders in early years, it is easy to find Confucian temple (kelenteng) around Lasem. The oldest one is Cu An Kiong which faces River Lasem directly. Another temple can be found near Desa Karangturi and along the artery road. Kelenteng is usually prioritizing to retain its space layout since it is related to their belief. And when it is possible, the structure and other aspects are retained in regards of the history of the temple and the community. Cu An Kiong, as an example, shows that it is possible to maintain the original state of the temple. However, because of several racial incidents a few decades ago, the temple decided to add expandable metal trellis in front of its front door. Besides repainting, the temple management claimed to have never change anything else. It is understandable since temple has its own specific function that made it nearly possible to be adapted into new function thus there will be unnecessary to have extreme change unless the temple is about to be expanded or such. Obsolescence, deterioration, and depreciation In historical area, especially in developing country, old buildings are at risk of obsolescence, deterioration, and depreciation. Deterioration comes with the ageing process of the building but it can be controlled through appropriate maintenance and adaptation. Obsolescence may come together with deterioration although it is harder to predict obsolescence even through adaptation. Both deterioration and obsolescence will bring depreciation in old building since its value will be reduced (Ashworth, 1999 in Douglas, 2006). From the preliminary observation, old buildings in Lasem shows a tendency of deterioration and obsolescence. The deterioration is observed through the decays and damages in those buildings. Decays and damages are mainly caused by the nature of the material as well as climate and geographic condition. For example, the wooden door gets Asea Uninet Scientific and Plenary Meeting 2016 | 127 mouldy but the cost to replace it with the same material is high thus the owner let the decays. This seems to legitimate the argument that old buildings have high maintenance cost. Meanwhile, the obsolescence can be seen from the number of vacant buildings in the area. This in fact is similar to Chinese settlement condition in Pekalongan where a lot of buildings are left empty since the owner and their family moved into urban areas. The houses are only visited on special occasions and resulted in obsolete environment for most of the time. Although this observation has not find any causal factor for the vacant buildings, but it is possible that demographic plays a role. However, as stated before, adapting old buildings may bring advantages in rejuvenating life in historical area when the approach is precise. The challenge for Chinese houses in this area lies is the adaptability of courtyard house. While the shophouses is easily adapted and changed since its basic function and form are flexible, the opposite occurred in courtyard houses. Courtyard houses in Lasem have had a specific function, owned and maintained by generations of a certain family and usually it is taboo to sell the house. Besides, adapting a group of building will have different approach than a single building in a defined lot. However, there are possibilities to utilize these houses in other function. The first step, though, is to analyze which physical aspect of the house that can easily be adapted and changed. Assessing adaptability in old buildings: what's next? All of the above statements are the results of preliminary research through an overview survey in building's physical aspect. The next stage of this research should involved indepth observation, not only into the building but also to its occupants in order to discover the changes took place over time as well as the reasons for those changes. In the future, this research can have range of development: the similar method can be used to gather more information about adaptability in houses in another area, the result can be used as a basic for Lasem development plan, or the research can be expanded to create an assessment tool for old buildings in historical area in terms of its adaptability in conservation process. A design method in which adaptability comes as an aspect is also possible to be developed by using this research as a basis. Some literatures have brought examples on how to adapt an existing building, either it is to create new functions or to retain the original ones. Unfortunately, designing a new building with considerations of adaptability has not been much developed. Using the result from this research which involved Brand's shearing layers, a new point of view about a building can be generated about which part should be left permanent and which part should be flexible and changeable. Seeing a building as small parts that unified and cohere rather than as a large chunk of something composed of many parts will carry two kinds of designs which may be entirely different. The first may bring a design that at first seem to have no specific function and possibly have little uniqueness but actually can accommodate a lot of different functions for different occupants while the latter will bring us a design that is specifically made for a certain function that make it unique. Eventually, this research will only add options and insights for users and occupants on how to create an ideal place to conduct their activity as well as to fulfil their needs. 128 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES Brand, S. (1994). How buildings learn. New York, NY: Viking. Douglas, J. (2006). Building adaptation. Amsterdam: Butterworth-Heinemann. Nasution, T. (2014). Akulturasi pada Permukiman Masyarakat Cina, Studi Kasus: Kawasan Pecinan di Kota Pekalongan (Master degree). Institut Teknologi Sepuluh Nopember. Nasution, T., Faqih, M. and Silas, J. (2012). Chinese Settlement through the Ages, Case Study: Chinese Settlement in Pekalongan, Central Java. In: CIB W104 Open Building Implementation 18th International Conference of Open Building. Beijing, pp.132-138. Oliver, P. (2006). Built to meet needs: Cultural issues in vernacular architecture. Amsterdam: Architectural Press. Pratiwo. (2002). The Chinese Town Lasem. In P. Nas, The Indonesian Town Revisited (1st ed., pp. 147-171). Singapore: Institute of Southeast Asian Studies. Towers, G. (2005). An introduction to urban housing design: At home in the city. Oxford: Architectural Press. CLASSICAL OPTIMIZATION METHODS FOR WATER RESOURCES MANAGEMENT Nadjadji Anwar nadjadji@gmail.com* Nastasia Festy Margini Danayanti Azmi Dewi Saptarita Kusumawati Civil Engineering Department, Institut Teknologi Sepuluh Nopember (ITS), Surabaya Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract Limited amount of water in a river basins are in the contrary of supplying water to reach water demand. Man’s quest for a better use of the available water is as old as mankind itself, therefore scientific allocation of water resources is needed (Buras, 1975). Hydrosystems descibe collectively the technical areas of hydrology, hydraulics, and water resources including the application of economics, optimization, probability, statistics, and management (Mays and Tung, 1992). The requirement to fulfill water for irrigation, domestic, municipal and industry, as well as hydropower plant have been studied before. As an example Brantas River, a major river in East Java, Indonesia, having approximately 12.000 km2 basin area and 320 km length has been optimized by using a mixed integer linear programming (ILP) approach at 4 large serial dams named Sengguruh, Karangkates, Wlingi and Lodoyo for the puspose of supllying combination of hydropower and irrigation water (Anwar, Kusumawati and Pangestuti, 2013; Gandhi, 2014; Anwar and Kusumawati, 2015). Other study has also been done by goal programming approach to analyse three parallel reservoirs named Singolatri, Kedawang and Lider, in addition to Porolinggo Spring, were intended to be interconnected to suply paddy fields through out irrigation schemes at Kabupaten Banyuwangi, East Java, Indonesia (Anwar, Kusumawati and Margini, 2014). This research emphasis on classical optimization methods, such as linear programming, integer linear programming, goal programming, etc, to be applied as decision making tools especially for water resources problems in river basins. Results of this research have a chance to enrich knowledge of optimization methods through the experiences using real data. Keywords: optimization, linear programming, goal programming, water resources, river basin, irrigation, hydropower. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 129 130 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION Water scarcity, especially in dry seasons in Indonesia, always become worrying problem for water resources management such as conservation of excess water in rainy seasons which will be used later in dry seasons. Water balance approach could be the solution to optimize availability of water to be used effectively and efficiently. There are two examples of research project analysis have been done previously in East Java considering Upper Brantas River Systems and Irrigation Schemes at Kabupaten Banyuwangi which are done by Anwar, Kusumawati and Pangestuti (2013), Gandhi (2014), Anwar and Kusumawati (2015), in addition to Anwar, Kusumawati and Margini (2014). These research projects are basically using linear programming and its combinations. 2 METHODS OF OPTIMIZATION Rao (2009) classified method of operations research to be traditional (mathematical or optimization, stochastic process and statistical) and modern techniques. Table 1 shown summary of the methods. Some one else may say that the traditional techniques is classical optimization method, on the other hand, modern techniques are more heuristical optimization method. This paper consider only the classical optimization method especially for water resources management purposes. Table 1. Method of Operations Research (Rao, 2009) Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 | 131 CASE OF CASCADE DAMS AT UPPER BRANTAS RIVER Background Brantas River is a major river in East Java, Indonesia, having approximately 12.000 km2 basin area and 320 km length. The river became the main water sources in the area through 4 large cascade dams at the upstream, which are Sengguruh Dam, Karangkates Dam, Wlingi Dam, and Lodoyo Dam. Either Integer Linear Programming (ILP) or Mixed Integer Linear Programming (MILP) method have been introduced as optimization methods (Anwar, Kusumawati and Pangestuti, 2013; Gandi, 2014; Anwar and Kusumawati, 2015). The data to be used in the model is ten-day-period (decade) of discharge data from December 2011 to November 2012 to be converted to seasonal data. The aim of the optimization is to maximize the profit of the farm (irrigation) in Lodagong Irrigation Area to gain the energy production in Sengguruh Dam, Karangkates/Sutami Dam, Wlingi Dam, and Lodoyo Dam (hydro power plant) that are currently installed numerous power generatos consecutively 2x14,5MW, 3x35MW, 2x27MW and 1x4.5MW. One reservoir belongs to Karangkates Dam, actually in a pair with Lahor Reservoirs connected by tunnel, with the total capacity of 175 million cubic meter. This reservoir is purposed to conserve water for irrigation as well as municipal and industry supplies combined with flood control. See Figure 1 Brantas River Systems and Study Locatiobs. Table 2 for the name, location and function of Dams and. The data to be used in the model is ten-day-period (decade) of discharge data from December 2011 to November 2012 to be converted to seasonal data. Figure 1. Brantas River Systems and Location of Study (Source: PJT) Table 2. Name, Location and Function of Dam (Source: PJT) No 1. Name of Dam Sengguruh 2. KarangkatesLahor Location Village of Sengguruh, Kepanjen, 24 km south of Malang Village of Karangkates, Sumber-pucung, Malang. Lahor is 1.5 km north of Karangkates Function Elevtricity power generator 2x14.5 MW, control sediment entering Karangkates Flood control, irrigation, municipal and industry water supply, electricity power generator 3x35 MW 132 | Asea Uninet Scientific and Plenary Meeting 2016 3. Wlingi Village of Jegu, Kutojayan, Blitar 4. Lodoyo 7 km downstream of Wlingi Dam 3.2 Glood Control, sediment control, flood control and electricity power generator 2x27 MW Electricity power generator 1x4.5 MW and sediment control from Wlingi Dam Governing Formula The use of MILP formula, the objective equation aims to maximize both electricity energy and farm production benefits as Equation 1. The benefit (Z) is the summation of unit power benefit (number of turbines operated and irrigation for cropping patern area). Max Revenue Z = Ʃ bti.Tik + Ʃ baj.Ajk Subject to: Power generator: pik.Tik Farm area: Ʃ Ajk Water balance: qt1.T1k qt2.T2k – Vk + Vk+1 + Sk qt3.T3k + Ʃ qajk.Ajk - Sk qt4.T4k + Ʃ qajk.Ajk - Sk Reservoir at Karangkates: V1 Vk Non negativity Tik Ajk, Vk, Sk ≤ Pik ≤ Atotal ≤ Q1k = Q2k ≤ Q3k ≤ Q4k = Vinitial ≤ Vcapacity ≥ 0 and Integer ≥ 0 and Real , i = 1 to 4, k = 1 to 3 , j = 1 to 2, k = 1 to 3 , k = 1 to 3 , k = 1 to 3 , j = 1 to 2, k = 1 to 3 , j = 1 to 2, k = 1 to 3 , k = 2 to 3 (Eq.1) Where: i = 1 (Sengguruh), 2 (Karangkates), 3 (Wlingi), 4 (Lodoyo) j = 1 (Rice crop), 2 (Corn crop) k = 1 (Rainy season), 2 (1st Dry season), 3 (2nd Dry season) Tik : Number of turbine at i-Dam and k-Season Ajk : Area of irrigation for j-Crop and k-Season (Ha) Vk : Volume of water at Karangkates reservoir in k-Season (m3), V1= initial volume at first season Sk : Spill out discharge at Karangkates reservoir in k-Season (m3) bti : Unit benefit of turbine at i-Dam (Rupiah/Turbine) baj : Unit benefit of j-Crop (Rupiah/Ha) pik : Unit power production (Megawatt) qti : Unit discharge for turbine operation (m3/season/turbine) qajk : Unit discharge for irrigation (m3/season/Ha) Then the Mixed Irrigation Linear Programming (MILP) will be: Objective 1 Maximizing Both Irrigation and Energy: Max Z = ( 377.0496 TS1 + 377.0496 TS2 + 377.0496 TS3 + 377.0496 TK1 + 377.0496 TK2 + 377.0496 TK3 + 377.0496 TW1 + 377.0496 TW2 + 377.0496 TW3 + 377.0496 TL1 + 377.0496 TL2 + 377.0496 TL3 + 19.65 AR1 + 19.65 AR2 + 19.65 AR3 + 8.868 AC1 + 8.868 AC2 + 8.868 AC3 ) x 106 Asea Uninet Scientific and Plenary Meeting 2016 | 133 Subject to Constraints: 14.5 TS1 14.5 TS2 14.5 TS3 35 TK1 35 TK2 35 TK3 27 TW1 27 TW2 27 TW3 4.5 TL1 4.5 TL2 4.5 TL3 AR1 + AC1 AR2 + AC2 AR3 + AC3 54328.32 TS1 54328.32 TS2 54328.32 TS3 14826.24 TK1 - V1 + V2 + S1 14826.24 TK2 - V2 + V3 + S2 14826.24 TK3 - V3 + S3 52565.76 TW1 + 123109 AR1 + 76364 AC1 - S1 52565.76 TW2 + 123109 AR2 + 76364 AC2 - S2 52565.76 TW3 + 123109 AR3 + 76364 AC3 - S3 111974.4 TL1 + 123109 AR1 + 76364 AC1 - S1 111974.4 TL2 + 123109 AR2 + 76364 AC2 - S2 111974.4 TL3 + 123109 AR3 + 76364 AC3 - S3 V1 V2 V3 TS1, TS2, TS3, TK1, TK2, TK3, TW1, TW2, TW3, TL1, TL2, TL3 AR1, AR2, AR3, AC1, AC2, AC3, V1, V2, V3, S1, S2, S3 ≤ 29 ≤ 29 ≤ 29 ≤ 105 ≤ 105 ≤ 105 ≤ 54 ≤ 54 ≤ 54 ≤ 4.5 ≤ 4.5 ≤ 4.5 ≤ 12499 ≤ 12499 ≤ 12499 ≤ 643.6031 x 106 ≤ 670.5556 x 106 ≤ 286.5378 x 106 = 962.7508 x 106 = 1002.721 x 106 = 458.187 x 106 ≤ 1384.319 x 106 ≤ 1385.102 x 106 ≤ 588.4799 x 106 ≤ 1851.886 x 106 ≤ 1893.865 x 106 ≤ 697.0769 x 106 = 175 x 106 ≤ 175 x 106 ≤ 175 x 106 ≥ 0 and Integer ≥ 0 and Real (Eq.2) By using the same constraints, the programs also execute for 2 other objectives, that are as follows: Objective 2 Maximizing Irrigation: Max Z = (19.65 AR1 + 19.65 AR2 + 19.65 AR3 + 8.868 AC1 + 8.868 AC2 + 8.868 AC3 ) x 106 (Eq.3) Objective 3 Maximizing Energy: Max Z = ( 377.0496 TS1 + 377.0496 TS2 + 377.0496 TS3 + 377.0496 TK1 + 377.0496 TK2 + 377.0496 TK3 + 377.0496 TW1 + 377.0496 TW2 + 377.0496 TW3 + 377.0496 TL1 + 377.0496 TL2 + 377.0496 TL3) x 106 (Eq.4) 3.3 Calculation and Result From the optimization modeling, mentioned in Table 3 and Table 4, based on water allocation obtained that maximum benefits from both irrigation area and energy generation is IDR 903.92 billion; which is the best value comparing with optimization modeling based on the maximizing irrigation benefits of IDR 883.58 billion and based on maximizing energy benefits which is IDR 841.03 billion. 134 | Asea Uninet Scientific and Plenary Meeting 2016 Table 3. Result of Operations Schedule at Each Season (Anwar and Kusumawati, 2015) Alternatives Uni t Maximize Both Rainy st 1 Dry Maximize Irrigation 2nd Dry Rainy Number of Turbines Operated at Dam 1 Sengguruh Unit 2 2 2 2 Karangkate 2 Unit 3 3 3 3 s 3 Wlingi Unit 2 2 2 2 4 Lodoyo Unit 1 1 1 1 Cropping Pattern (Irrigated Area) at Lodagung Scheme 12.49 12.49 9.92 12.49 1 Rice Ha 9 9 2 9 2 Crop Ha 0 0 0 Water Conservation at Karangkates Reservoir x 1 Storage 106 175 0 175 m3 x Release/Spi 2 106 1.138 828 633 ll m3 st 1 Dry 2nd Dry Maximize Energy Rainy 1st Dry 2nd Dry 2 2 2 2 2 3 3 3 3 3 2 1 0 1 2 1 2 1 2 1 12.49 9 9.92 2 12.49 9 12.49 9 1.696 0 0 0 0 0 10.53 0 175 0 175 175 0 0 1.138 828 633 1.138 1.002 458 Table 4. Trade-off Irrigation and Energy Benefits (Anwar and Kusumawati, 2015) Type of Benefit Irrigation Benefit (Rupiah) Energy Benefit (Rupiah) Total Benefit (Rupiah) 4 4.1 Maximize Both Strategy Objective Maximize Irrigation Maximize Energy 686.178.000.000 686.197.650.000 623.281.590.000 217.746.144.000 197.385.465.600 217.746.144.000 903.924.144.000 883.583.115.600 841.027.734.000 CASE OF PARALLEL DAMS IN BANYUWANGI Background Kabupaten Banyuwangi has many spring water with significant discharge flowing to the rivers, i.e. Kali Baru, Kali Kedawang and Kali Setail, see Figure 2 and Figure 3. Those three springs water supplies to reservoirs. Kali Baru for Singolatri Reservoir, Kali Kedawang for Kedawang Reservoir and Kali Setail for Lider Reservoir. Three reservoirs are interconnected by lateral supply channel in order to support deficit of water between basins whenever surplus water at other reservoir. Asea Uninet Scientific and Plenary Meeting 2016 | 135 Figure.2 Location of Study (Anwar, Kusumawati and Margini, 2014) K. BARU K. KEDAWANG K.SETAIL W. SINGOLATRI W. KEDAWANG W. LIDER S.A. POROLINGGO DI. KEDAWANG 148 Ha DI. LIDER 6346 Ha DI. POROLINGGO S1 4031 Ha DI. SETAIL S3 4869 Ha S2 DI. BARU 14071 Ha S4 DI. BLAMBANGAN 1523 Ha DI. WATUMLOSO 1169 Ha DI. KALI SETAIL 8312 Ha Waduk Sumber Air Sungai Saluran Suplesi Saluran Pembuangan Saluran Irigasi SAMUDERA INDONESIA SELAT BALI DI S Daerah Irigasi Suplesi Figure 3. River Systems (Anwar, Kusumawati and Margini, 2014) Optimizing of interconnection supply channels need to be analysed before execution plan in the year of 2020. Decade (10-day) Interval discharge data available for 10 years from 1997 to 2006. The analysis regarding irrigation for 29,735 Ha paddy fields, while cropping plans are divided into three periods annually, namely as (1) Cropping Period 1 (CP-1) during rainy season about November of previous year to Februari, (2) Cropping Period 2 (CP-2) during early dry season from March to June, and (3) Cropping Period 3 (CP-3) during late dry season from July to October. 4.2 Governing Formula Linear Programming (LP) formulae was developed to maximize cropping plantation intensity for 8 irrigation areas, which are as follow, Maximize Z = X11+X21+X12+X22+X13+X33+X14+X24+X15+X25+X16+X26+X17+X27+X18+X28 Subject to : 136 | Asea Uninet Scientific and Plenary Meeting 2016 Maximum irrigation area: X11 + X21 ≤ A1 X12 + X22 ≤ A2 X13 + X23 ≤ A3 X14 + X24 ≤ A4 X15 + X25 ≤ A5 X16 + X26 ≤ A6 X17 + X27 ≤ A7 X18 + X28 ≤ A8 Availability of water: T1 – S1 ≤ Q 1 T1 – S 1 + K 11.X 11 + K21.X 21 ≤ Q 1 T1 – S 1 + K 11.X 11 + K21.X 21 + S 4 ≤ Q1 T1 – S 1 + K 11.X 11 + K21.X 21 + S 4 + K12.X 12 + K22.X 22 ≤ Q 1 K 13.X 13 + K23.X 23 ≤ Q 2 K 13.X 13 + K23.X 23 + S 1 + S 2 ≤ Q 2 T3 + K14.X 14 + K 24.X 24 ≤ Q3 T4 + K15.X 15 + K 25.X 25 ≤ Q4 T3 + K14.X 14 + K 24.X 24 + T 4 + K15 .X 15 + K 25.X 25 ≤ Q3 + Q 4 T3 + K14.X 14 + K 24.X 24 + T 4 + K15 .X 15 + K 25.X 25 + K16.X 16 + K 26 .X 26 ≤ Q3 + Q4 T3 + K14.X 14 + K 24.X 24 + T 4 + K15 .X 15 + K 25.X 25 + K16.X 16 + K 26 .A26 + S 3 - S 2 ≤ Q3 + Q 4 T3 +K 14 .X 14 +K24.X 24+T4 +K15.X 15 +K 25 .X 25 +K16.X 16 +K 26 .X 26 +K 17. X 17 + K27.X 27 ≤ Q 3 + Q4 S 4 + S 3 – K18.X 18 – K 28.X 28 ≥ 0 Non negativity X 11, X 21, X 12, X 22, X 13 , X 23, X 14 , X 24, X 15 , X 25, X 16 , X 26, X 17, X 27, X 18 , X 28, T 1, T 3, T4 , S 1, S 2 , S 3, S4 ≥ 0 (Eq.1) Where, Z : Objective value Xij : Irrigation area (Ha) for cropping i at irrigation area j i = 1 for rice paddy i = 2 for crop plant j = 1, 2, 3, ……. up to 8 Ki : Water requirement at unit area (m3/Ha) for cropping i i = 1 for rice paddy i = 2 for crop plant T1 : Volume of Singolatri Reservoir T3 : Volume of Kedawang Reservoir T4 : Volume of Lider Reservoir S1 : Suppletion discharge from Watershed Porolinggo to Watershed Baru S2 : Suppletion discharge from Watershed Porolinggo to Watershed Setail S3 : Suppletion discharge from Watershed Setail to Watershed Blambangan S4 : Suppletion discharge from Watershed Baru to Watershed Blambangan Aj : Irrigation Area (Ha), i = 1, 2, 3, ....... up to 8 Q1 : Discharge at Baru River (m3/det) Q2 : Discharge at Porolinggo River (m3/det) Q3 : Discharge at Kedawang River (m3/det) Q4 : Discharge at Setail River (m3/det) Goal Programming (GP) formulae was developed in order to reach goals of irrigation areas for rice paddy and crop plant, to reach maximum capacity of reservoirs and to reach amount of available water uses by minimizing deviation from each goal. The GP as follow, Maximize : P1d1+, P2d2+, P3d3+, P4d4-, P5d5-, P6d6+, P7d7-, P8d8-, P9d9-, P10d10-, P11d11-, P12d12-, P13d13-, P14d14-, P15d15+, P16d16-, P17d17-, P18d18+, P19d19+, P20d20+, P21d21+, P22d22+, P23d23+, P24d24+, P25d25+, P26d26+ Asea Uninet Scientific and Plenary Meeting 2016 | 137 Subject to, X11 + X12+ X13+ X14 + X15 + X16 + X17 + X18 + d1- - d1+ = 188577 X21 + X22+ X23+ X24 + X25 + X26 + X27 + X28 + d2- - d2+ = 36049 T1 + d3- - d3+ = 196751 T3 + d4- - d4+ = 36480 T4 + d5- - d5+ = 126242 X11 + X21 + d6- - d6+ = 14071 X12 + X22 + d7- - d7+ = 1169 X13 + X23 + d8- - d8+ = 4031 X14 + X24 + d9- - d9+ = 148 X15 + X25 + d10- - d10+ = 6346 X16 + X26 + d11- - d11+ = 4869 X17 + X27 + d12- - d12+ = 8312 X18 + X28 + d13- - d13+ = 1523 -S 1 + T1 + d14- - d14+ = Q1 K 11.X 11 + K21.X 21 – S 1 + T 1 + d15- - d15+ = Q1 K 11.X 11 + K21.X 21 – S 1 + S 4 + T 1 + d16- - d16+ = Q 1 K 11.X 11 + K21.X 21 + K 12 .X 12 + K 22.X 22 – S 1 + T1 + S 4 + d17- - d17+ = Q 1 K 13.X 13 + K23.X 23 + d18- - d18+ = Q 2 K 13.X 13 + K23.X 23 + S 1 + S 2 + d19- - d19+ = Q2 K 14.X 14 + K24.X 24 + T 3 + d20- - d20+ = Q 3 K 15.X 15 + K25.X 25 + T 4 + d21- - d21+ = Q4 K 14.X 14 + K24.X 24 + K 15.X 15 + K 25.X 25 + T 3 + T 4 + d22- - d22+ = Q 3 +Q4 K 14.X 14 + K24.X 24 + K 15.X 15 + K 25.X 25 + K16.X 16 + K 26 .X 26 + T 3 + T 4 + d23- - d23+ = Q 3 + Q 4 K 14.X 14 + K24.X 24 + K 15.X 15 + K 25.X 25 + K16.X 16 +K 26.X 26 -S 2 +S 3 +T3 +T4 +d24- -d24+ = Q 3 +Q 4 K 14.X 14+K 24.X 24 +K 15 .X 15 +K25.X 25+K 16.X 16 +K26.X 26 +K17.X 17+K 27 .X 27–S 2 +S 3 +T3+T4 +d25--d25+ =Q 3 +Q4 - K18.X 18 – K28.X 28 + S 3 + S 4 + d26- - d26+ = 0 Non negativity X 11,X 21,X 12,X 22 ,X 13 ,X 23 ,X 14,X 24 ,X 15 ,X 25 ,X 16 ,X 26,X 17,X 27,X 18,X 28,T1,T3,T4,S 1, S 2,S 3,S 4 ≥ 0 (Eq.2) Where, all symbols are the same as LP model, with addition to P n is the priority of goals, while dn+ and dn- are surplus and slack variables for the desired goals. 4.3 Calculation and Results First step is the analysis of LP model. After analysing LP model by using software application QM for Windows III, the optimum result is the planting period should be started (awal tanam) at third decade of November (Nov-III) with the maximum Z is 121,407 hectares or crop intensity 300% from the total of irrigation area 40,469 hectares as mentioned in Table 5. The optimum cropping pattern is rice-crops-crops. This result is better than the existing crop plan with the same starting at third decade period of November (Nov-III) which has crop intensity only 206% because using different crop plan which are rice-rice-rice. Table 5. Result of Linear Programming (LP) Model – First Step (Anwar, et al, 2014) Decade to start planting No. 1 Subject Existing Irrigated Area (Ha) Existing Intensity (%) Nov-I Nov-II Nov-III Dec-I Dec-II 80.128 82.152 83.366 81.747 81.342 198 203 206 202 201 Cropping Pattern rice-rice-rice 138 | Asea Uninet Scientific and Plenary Meeting 2016 2 Existing Irrigated Area (Ha) 110.769 117.510 121.407 113.916 113.357 274 290 300 281 280 Existing Intensity (%) rice-cropscrops Second step is the analysis of GP Model. By using the above LP result, there are 5 conditions to be analysis with GP Model and will be found the best solution, as follow: 1) 2) 3) 4) Existing condition. Alternative plan 1 : Without reservoirs, but build interconnection channels. Alternative plan 2 : Build 1 reservoir (Singolatri) with interconnection channels. Alternative plan 3 : Build 2 reservoirs (Singolatri and Lider) with interconnection channels. Alternative plan 4 : Build 3 reservoirs (Singolatri, Lider and Kedawang) with interconnection channels. 5) Model has been formulated in 3 goals : 1) To reach maximum irrigation areas. 2) To reach volume of reservoir capacity. 3) To reach the use of availability or dependable flow. It has been mentioned above, there are three cropping period that are period during rainy season (CP-1), first dry season (CP-2) and second dry season (CP-3). Strategy after filling reservoir during CP-1, will be released 100% amount of reserved water at CP-2 and 0% at CP-3, with the interval of 10%, varies to the opposite that 0% at CP-2 and 100% at CP-3. Therefore we have 11 scenarios of release water. Final result of GP model as mentioned in Table 6. Table 6. Result of GP Model – Second Step (Anwar, et al, 2014) Pla n Seas on Area (Ha) Crop Area (Ha) rice Exis ting Alt 1 Intensity (%) crops seas on total 205. 56 Wate r (106m 3) Suppletion (106 m3) Rservoir Capacity (m3) S S S 1 2 3 272.9 1 0 0 0 0 0 0 0 S4 T1 T2 T3 CP-I 4046 9 24,4 48 0 60.41 CP-II 4046 9 29,4 65 0 72.81 252.4 1 0 0 0 0 0 0 0 CP-III 4046 9 29,3 17 0 72.44 201.2 7 0 0 0 0 0 0 0 CP-I 4046 9 25,9 71 6,03 8 79.10 272.9 1 0 0 0 75.5 0 0 0 0 CP-II 4046 9 30,9 88 1,16 9 79.45 252.4 1 0 0 0 71.3 0 0 0 0 CP-III 4046 9 30,8 40 1,16 9 79.10 201.2 7 0 0 0 69.2 0 0 0 0 237. 65 Asea Uninet Scientific and Plenary Meeting 2016 Alt 2 Alt 3 Alt 4 CP-I 4046 9 30,8 40 1,16 9 79.10 CP-II 4046 9 16,7 69 16,7 63 CP-III 4046 9 30,8 40 CP-I 4046 9 CP-II 241. 05 | 139 272.9 1 0 0 0 75.5 0 196,7 51 0 0 82,86 252.4 1 0 0 0 0 177,0 76 0 0 1,16 9 79.10 201.2 7 0 0 0 2.24 196,7 51 0 0 33,8 69 6,60 0 100.0 0 272.9 1 0 0 0 75.5 0 196,7 51 0 36,4 80 4046 9 25,0 81 15,2 40 99,63 252.4 1 0 0 0 0 137,7 26 0 25,5 36 CP-III 4046 9 39,1 52 1,16 9 99,63 201.2 7 0 0 0 2.24 177,0 76 0 36,4 80 CP-I 4046 9 33,6 64 6,80 5 100.0 0 272.9 1 0 0 0 75.5 0 196,7 51 126,2 42 36,4 80 CP-II 4046 9 39,3 00 1,16 9 100.0 0 252.4 1 0 0 0 71.3 0 196,7 51 126,2 42 36,4 80 CP-III 4046 9 39,3 00 1,16 9 100.0 0 201.2 7 0 0 0 69.0 0 196,7 51 126,2 42 36,4 80 299. 27 300. 00 The development of this irrigation systems, according to the above analysis, are as follow: 1) 2) 3) 5 Not recommended to build suppletion channel S1, S2 and S3 Recommend to build suppletion channel S4 with capacity of 75,500,000 m3/season or in average discharge of 7.28 m3/second Recommend to build 3 reservoirs T1 (Singolatri) = 196,751 m3, T3 (Kedawang) = 126,242 m3 and T4 (Lider) = 36,480 m3. CONCLUSION From 2 cases that have been mentioned above, the use of Linear Programming (LP), Integer Linear Proggramming (ILP), Mixed Integer Linear Programming (MILP) and Goal Programming (GP) in optimization analysis for water resources management as decision analysis tools. Those method are methematic classical or traditional method that are very simple and easy to be understood. Some practical people in the field want to have this kind of thing in the purpose to manage water effectively. A research group may be composed for this area, a mathematical method with the possibility to expand to other method, i.e., more stochastical or statistical methods for water resources development projects sung as irrigation, hydro power energy production, municipal and industrial water supply, etc. 140 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES Anwar, N. and Kusumawati, S., 2015. Water Allocation Optimization for Combined Users of Energy Generation and Irrigation Demand at the Upstream Brantas River Reach using Mixed Integer Linear Programming Method. 26th Euro-mediterranean Regional Conference and Workshops: Innovate to improve Irrigation performances, International Commission on Irrigation and Drainage (ICID), 12-15 October 2015, Montpellier, France. Anwar, N., Kusumawati, S. and Margini, N.F., 2014. Goal Programming Approach for Irrigation Interconnection Schemes of Singolatri, Kedawang and Lider Reservoirs Including Porolinggo Springs at Banyuwangi, East Java, Indonesia. The Third International Conference on Numerical Analysis and Optimization: Theory, Methods, Applications and Technology Transfer. 5-9 January 2014, Sultan Qaboos University, Muscat, Oman. Anwar, N., Kusumawati, S. and Pangestuti, D., 2013. Optimization of Serial Large Dams for Electricity Production by Using Integer Linear Programming at Upper Brantas River, East Java, Indonesia. Proceedings of 2013 IAHR World Congress, Chengdu, China. Buras, N., 1975. Scientific Allocation Of Water Resources. American Elsevier Publising Company, Inc. New York. Chong, E.K.P. and Zak, S.H., 2001, An Introduction to Optimization, second edition, A Wiley-lnterscience Publication, John Wiley & Sons, Inc., New York. Gandhi, D.R., 2014. Analisa Optimasi Operasional Bendungan di Sungai Brantas Hulu (Optimation Analysis of Reservoir Operation at Upper Brantas River). Master Thesis, Civil Engineering Department, Institut Teknologi Sepuluh Nopember (ITS), Surabaya, Indonesia. Mays, L.W. and Tung, Y.K., 1992. Hydrosystems Engineering and Management. McGraw-Hill, Inc. New York. Rao, S.S., 2009, Engineering Optimization: Theory and Practice, Fourth Edition, John Wiley & Sons, Inc., New York. COAL PREPARATION USING DENSE MEDIUM CYCLONE TECHNOLOGY Retno Aita Diantari retno_aita@yahoo.co.id Isworo Pujotomo isworop@yahoo.com Lecturer, School For Engineering of PLN’s Foundation (Foundation for Education & Welfare PT. PLN (Persero)) Jakarta, Indonesia Abstract Coal is a kind of conventional energy resource with the largest reserves and the most widely distributing in the world. The key to reduce coal pollution are the development of clean coal technology. Coal-fired plant pollution is due to the release into the atmosphere of the hot flue gasses produced from the combustion of coal. Dust from power plants has been linked to cancers, while SO2 and NOx have both been identified as acid rain precursors. NOx has also been associated with the production of photochemical smog. Various pollutant control systems have been developed over the past several decades and are continually evolving. However, even with these systems in place, coal-fired plants still produce significant levels of emissions, and certainly carry this stigma with them. Dense Medium Cyclones are key processing units in many coal preparation plants for density separation of energy or cooking coal from rock. A slurry of crushed coal containing unwanted rock is mixed with a dense medium and continuously fed into a DMC at a coal preparation plant. The high centrifugal force due to the swirling flow preferentially separates rock particles with higher specific gravity than the dense medium to the walls of the chamber, where they are discharged as underflow (reject) at the tapered apex. Using technology, dense medium cyclone, ash from coal lignite and sulpur reduced from 18.82% to 11.70% and 0.91% to 0.88% Keywords: Decreased ash and sulphur, cyclone, magnetite 1 INTRODUCTION Coal, as mined (often termed run-of-mine or ROM coal), rarely has the necessary properties to meet either the physical and/or chemical quality requirements of its targeted industrial end-use in boilers cement kilns, blast or furnaces and coke ovens. This is particularly the case for coals destined for the export market. Coal preparation, can be broadly defined as the deliberate modification of the physical and/or chemical properties of the as-mined coal as it psses through the chain from the pit t industrial utilization so as to meet the end-use qualityspecifications and the constrains of the transportation and handling systems. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 141 142 | Asea Uninet Scientific and Plenary Meeting 2016 The overall aim of physical coal preparation is to produce saleable products of consistent, specified quality at production rates and in relative proportions which result in the best use of the mining company’s resource and a reasonable financial return. Specific objectives for achieving this overall aim are : 1) 2) 3) 4) 5) 1.2 to maximize the proportions (yields) of saleable products as a percentage of the as-mined coal; to generate saleable products within quality specifications; to minimize the loss of carbonaceous material to reject; to achieve sufficient plant throughput to meet planned production rates; and to minimize costs Coal Washing: What is it all about ? Before mine mechanization coal was separated from stone by hand-sorting. Mechanisation and the working of friable and highly-banded coal seams made hand sorting impractical and encourage the development of coal washers capable of economically upgrading the lower quality, finer, as-mined coal. The first coal washers were hand-operated jigs which had been developed for mineral processing. Jigs involve separation of particles of different density under the force of gravity, with relative downward movement of the denser particles enable by a pulsating water movement which expands a bed of coal particles being processed. The result is a continuous gradation in the bed according to density. (See Figure.1) Figure 1. Principle of coal washing – jigs In contrast to a dense medium separation, there is no clear separation of product-grade and reject-grade particles in a jig, which made efficient separations impossible for coal which Asea Uninet Scientific and Plenary Meeting 2016 | 143 had a high proportion of particles close to the targeted separation grade and for coal of small particles sizes. 1.3 Basic Principles: Why is it so ? As-mined coal generally consists of a range of particles sizes from several hundred mm top size to sub-micron dust. There is also a range of particle compositions from virtually “pure” carbonaceous material to “pure” mineral matter. The two most important physical properties of a raw coal which affect all aspect of coal preparation are its size distribution and washability characteristic as it is processed in the plant. A day-to-day knowledge of the plant feed size distribution and washability characteristics is required for short term optimization of plant operation, particularly when the source(s) of the raw coal changes on a daily basis. 2 THE DENSE MEDIUM CYCLONE (DMC) Coal beneficiation primarily makes use of gravity separation in coal washing . It is explained that dense medium separation (DMS), specifically the dense medium cyclone (DMC), is the main processing unit used for cleaning coal, beneficiating nearly 55% of coal that is washed worldwide The United States makes use of the DMS process for 65% of its washed coal. It can be determined from the data collected that 98% of the 53 coalpreparation plants in South Africa are making use of the DMC as their beneficiating unit. A cyclone consists of a truncated cone with a cylindrical section at the wide end (Figure 2) and a tangensial inlet for the feed in the cylindrical section (Figure 3). The feed stream is divided by the cyclone into two streams, an overflow and an underflow. The overflow is collected in a centrally located tube called a vortex finder, which passes through the wide end of the cyclone. The underflow is discharged through an opening in the narrow end of the conical section. This discharge point is referred to as the spigot, the orifice, the apex, or the underflow nozzle. (a) 144 | Asea Uninet Scientific and Plenary Meeting 2016 (b) Figure 2. View of Dense Medium Cyclone The DMC's function is to separate the coarse reject material from the coarse coal (product). This is achieved by pumping the coarse material at a high velocity into the cyclone with a mix of water and magnetite, which creates a dense medium slurry. Once the coal and dense medium slurry are pumped into the cyclone together, the material is exposed to centrifugal forces within the cyclone, combined with the specific gravity of the dense medium slurry, the heavier material (reject) is discharged out the bottom (it sinks) of the DMC and the lighter material (coal product) is discharged out the top (it floats). Raw coal (raw coal) with a suitable size range, pumped or supplied from the head tank (feed) into the cyclone inlet as a suspension in the flow of solid-containing magnetite. Clean coal is transported into the vortex and released in the flow faster. Materials rejected (non-coal) flows through the body towards the vortex of stoppers and out through the low flow. Figure 3. View of a Dense Medium Cyclone (top) Asea Uninet Scientific and Plenary Meeting 2016 | 145 A lump of coal in the round (with the assumption that these objects exist), with mass m and volume v If the mass of the lump of coal is less than the mass of liquid with the same volume, then the object will not be submerged in the liquid (Fig. 4.) Lump of coal in power is mg, where g is the increase in speed / acceleration caused by gravity which is also represented by gdv, where d is the density (density) of coal. This is because m = dv, v the volume of fluid was removed and has mass will be equal to the volume of coal chunks of v. If the coal has been sunk, but the fluid is generating upward thrust, which is called buoyancy. Therefore, the sphere will not be drowned if gdv = gDv, and thus velocity will be zero. Because of the difference between gdv and gDv widened, round object will settle at a rate of speed that was increasingly growing. So that the speed s is proportional to this difference, namely: s  gdv – gDv (1) In actual circumstances, coal fragmens were not round, not even a smooth and lump coal would not meet with resistance from the effects of buoyancy. In an effort to further moves down, the coal has faced resistance R which should also be deducted from downward traction to deliver the fastest s  gdv - gDv - R. Rounded coal will continue to accelerate until the increase in R (which occurs when the spheres are bertembah speed) reduces the attractiveness of the net down to zero. At this stage, the sphere of coal will reach speeds in which the object is moving up to reach the bottom of the vessel containing the liquid (assuming the liquid is a homogeneous liquid or viscous liquids are stable). A whirlpool or air core which is often formed when a pool or tub washer emptied hand. When water moves into the opening in the stopper, the water is spinning faster, the speed increases while the radius decreases. Rotating speed of the water causes a higher centrifugal force at the center of the vortex. In a vortex, centrifugal forces have probably twenty times earth's gravitational force on the vortex wall near the pit entrance at the top of the cylinder-shaped vortex, but could increase to more than 700 times Earth's gravity near the central air core. Because all solid objects must leave the vortex near the central axis, solid objects are all must pass through areas with high centrifugal forces. If a particle rotates in a circle like a whirlpool, then the acceleration sentrifugalnya are: g  S2 r Where: S = particle velocity around the circle r = radius of the circle (2) 146 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 4. Resources that affect the deposition of the coal vein. Equation (2) This explains why when choosing the direction of particle vortex center, the velocity becomes larger, because r is continuously growing small and S increase. The principle of floating and sinking, ie the relative values of d and D are not affected, but because of the centrifugal acceleration is much larger than Earth's gravity, the speed at which everything happens, whether floating or submerged, much faster. Thus, the vortex is comparatively a small piece of equipment, has a high flow capacity because the power of a much bigger push, making everything take place much faster than if done in a pond with a solid flow. So, from Figure (4b.), if s is negative, is floating lumps of coal. And the power which regulates the speed of the sphere settles s coal in a vortex becomes: 2 2 s  S vd  S vD  R r r (3) Organic liquids such as water and the solution is rarely used in separating solid medium and therefore the properties of viscous liquid of fine particles of solids which are of great importance in using the process commercially. Relative density (density) of solid medium is the most important thing that can be used. Particle size of solids that will determine the stability of viscous fluid is to be used as a means of separation. Thus,  gc (d-D)-R if the speed settles, where g acceleration due to gravity, v is the volume of medium particles, d is the relative density of the particle medium, D is the relative density of liquids containing solid medium, ie water = 1 and R is the resistance factor, the association showed that the rate of sediment can be reduced and thus stability can be improved by having: (a) small particles, namely low-v; Asea Uninet Scientific and Plenary Meeting 2016 (b) (c) solid medium with relatively low density, ie d; or high resistance to the motion of fluid R is high. | 147 particles, ie This situation is realized in practice because: facilities crushed solids to a size which is usually very smooth, thick liquid that contains megnetit usually stabilized by maintaining the ratio of clay mud; all this mud while reducing v, also adds to the density of infrastructure, thereby increasing R. However, if the resistance is too heavy as a result of piling mud, the facilities will be against the movement of coal and broken rock and unefficiently will arise in the separation. This should be corrected with a 'clean' means that by removing excess clay from the coal washing machine. Most of the coal washing process industry standard in the world using a thick porridge made from fine solid magnetite. Fine magnetite suspended in water is used to clean coal by creating an average specific gravity (heavy medium) between that of coal and its associated impurities so that a separation is effected. The magnetite must be reclaimed and cleaned to prevent the build-up of impurities in the cleaning circuit. Advances in the cleaning of finer coal sizes require. Dense Medium Cyclones (DMCs) are key processing units in many coal preparation plants for density separation of energy or coking coal from rock. A slurry of crushed coal containing unwanted rock is mixed with a dense medium and continuously fed into a DMC unit, which is basically a cylindrical steel (or ceramic-lined) chamber with a central feed, tapered at one of the two discharge ends. Magnetite, a natural mineral foundation for the cleaning of coal, while the siliconiron or a mixture of magnetite and silicon iron ore mines for the separation of large density. Magnetite is usually used to have 1:35 g/cm3 density, the density is below the stability will disappear quickly, thereon up to about 1.80 g/cm3, viscosity will be a problem. Magnetite has a cubic crystal structure, into the family of spinel with the formula Fe 2+ Fe23+O4. Its chemical structure is based on the cubic lattice of oxygen in a tightly packed. Fe2+ and Fe3+ is greater than that of oxygen ions Fe2+ and Fe3 + is suitable for the hole (or locus) on the lattice oxygen. General specifications magnetite world is as follows: - Relative density: 4.9 to 5.2 g/cm3; - 95% by weight.- Magnetic material content: - Chemical analysis in particular: Fe P S SiO2 Al2O3 Cu Ti Na + K H2O Other : 68,00 % min : 0,09 % maks : 0,05 % maks : 2,50 % maks : 0,60 % maks : 0,03 % maks : 0,23 % maks : 0,13 % maks : 10,00 % maks : 0,15 % maks 148 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 5. Magnetite Excess flow of coal washing technology navel thick magnetite slurry compared with coal washing technology Baum jig plant, lies in its ability to wash coal of various sizes with good results, because this technology uses a thick porridge magnetite separation media that the density can be adjusted with the density of coal. 3 RESEARCH METHOD In the coal washing process, there are three stages of the process that must be experienced by the coal. As for the third stage of the process are:[9][10] 1) 2) 3) The process of equating the size (sizing); coal mining will have the results from the size and shape varied, there is a chunk of large, medium, small size of sand or coal (coal fines). In this process coal is expected to be ready to be washed will have the 50mm - 100mm) so will be able to be supplied intosame maximum size (the washing machine coal). The process of leaching (washing); in this process will occur the separation between the material instead of coal (coal reject) with the materials of coal (clean coal). Drying process (drying); coal out of the washing process will go into the dryer and ready for use. Asea Uninet Scientific and Plenary Meeting 2016 | 149 Figure 6. Coal washing process; ((a), (b): the process of sizing), ((c): the process of washing), ((d): reject coal), ((e): clean coal) Figure 7. Flowsheet of cyclone plant Of the three stages of the coal washing process, washing process is the most important processes and determine the quality of clean coal produced. The DMC's function is to separate the coarse reject material from the coarse coal (product). This is achieved by pumping the coarse material at a high velocity into the cyclone with a mix of water and magnetite, which creates a dense medium slurry. Once the 150 | Asea Uninet Scientific and Plenary Meeting 2016 coal and dense medium slurry are pumped into the cyclone together, the material is exposed to centrifugal forces within the cyclone, combined with the specific gravity of the dense medium slurry, the heavier material (reject) is discharged out the bottom (it sinks) of the DMC and the lighter material (coal product) is discharged out the top (it floats). 4 RESULTS AND DISCUSSION Factors that may affect the quality of coal washing when transported from the mines to the user are:       Means of transportation between the mines and coal washing plant; Treatment of coal, such as splitting and separation of coal and non-coal; Landfill, the uniform washing and mixing at the plant; The washing process; Stockpiling, homogenization and mixing of coal after washing; Stockpiling, homogenization and mixing with the coal after washing from elsewhere in the terminal end of the coal; Transportation of coal after being washed from the factory to the user laundering.As is known coal with higher calorific value and lower pollution can obtained by first washing process.  In writing this kind of washed coal is Lignite and derived from the village of Asam Asam Kalimantan Timur. And in table 1., Can be seen ash content, coal and water sulpur lignite and lignite coal washing. Table 1. Ash content, and water sulpur lignite and lignite coal washing COAL Ash content Concentration sulpur MONTH Coal lignite Coal lignite washing (ton) (ton) Sept’00 110530 90599 Okt’00 96345 70076 Nop’00 95115 68898 Des’01 Januari' 01 34269 26517 100184 80115 Peb’01 74837 58772 lignite washin lignit g (%) 21,1 9 23,1 0 26,5 3 24,9 8 23,8 8 23,3 7 Water content lignit lignite washing lignit lignite washing (%) (%) (%) (%) (%) 11,96 1,29 1,15 28,13 28,27 12,05 1,16 0,98 27,74 27,85 11,89 1,07 0,83 28,95 29,01 11,87 1,17 0,87 28,1 28,13 11,26 1,21 0,82 28,2 28,26 10,86 1,09 0,79 28,65 28,71 Asea Uninet Scientific and Plenary Meeting 2016 Maret' 01 121903 99170 April' 01 115513 93616 Mei' 01 99314 77719 Juni' 01 114276 90032 23,4 7 24,0 1 24,3 7 24,8 6 11,88 1,04 0,80 28,45 28,53 11,57 1,23 0,88 28,29 28,39 11,84 1,20 0,81 28,2 28,27 11,78 1,12 0,84 27,74 27,85 28,25 28,33 96228,6 23,9 75551,40 11,70 1,16 0,88 0 8 Source: Prepared according to Table Production Report of PT BHPMI[6] Averages | 151 From table 1,[1] can be seen that the lignite coal with an average weight of 75551.40 tons having distributed the average ash content of (75551.40 / 96228.6) x 23.98% = 18.82%. or weighing 14218.8 tons. Lignite coal ash washing average amounted to 11.70% or 8839.51 weighing tons, so there is a reduction in ash content of coal: (18.82 to 11.70)% = 7.12%, or weight reduction: (14 218 , 8 to 8839.51) ton = 5379.29 tons. Lignite coal with an average weight of 75551.40 tons will have content Distributed sulpur mean equal (75551.40 / 96228.6) x 1.16% = 0.91% or weighing 687.52 tons. Sulpur grade lignite coal washing an average of 0.88% or weighing 664.85 tons, so there is a reduction in levels of coal sulpur: (from 0.91 to 0.88)% = 0.03% or a reduction in weight: (687, 52-664.85) ton = 22.67 tons. Lignite coal with an average weight of 75551.40 tons will have a mean equal distribution of water content (75551.40 / 96228.6) x 28.25% = 22.18% and moisture content of lignite coal washing an average of 28.33 % 5 CONCLUSION A Coal Preparation Plant (CPP) is a facility that washes coal of soil and rock, preparing it for transport to market. The main parameters of coal as a fuel fired power plant is the amount of ash and sulpur. Coal washing technologies using cyclone and magnetite media used to produce salable coal products consistently, specifically to improve the quality of production and the relatively comparable to the cost and results that have been issued by the mining company. Dense Medium Cyclones (DMCs) are key processing units in many coal preparation plants for density separation of energy or coking coal from rock. A slurry of crushed coal containing unwanted rock is mixed with a dense medium and continuously fed into a DMC unit, which is basically a cylindrical steel (or ceramic-lined) chamber with a central feed, tapered at one of the two discharge ends. The washability characteristics of a coal reserve are provided by obtaining liberation data on the raw coal. Liberation refers to the amount of physical breakage required to separate material of different material densities. Low density material is clean coal whereas high density material is reject (rock). 152 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES Archie W. Culp, (1991), Prinsip-Prinsip Konversi Energ”, cetakan ketiga, Erlangga, Jakarta Australian Coal Industry Research Laboratories, (2003), Dense Medium Cyclone Circuit Operator Training, New South Wales, Australia, 14 – 17 May. Barry Davidson, (1993), Clean Coal Technologies For Electricity Generation, Power Engineering Journal, December, page 257-264 Dr Steven Spencer, Yi Liu, (2005), Statistical Signal Processing Methods For Acoustic Emission Monitoring of Dense Medium Cyclones, CSIRO Minerals, IEEE, Sydney, Australia G.J. Korte,(2002), Dense-Medium Beneficiation of Fine Coal Revisited, The South African Institute of Mining and Metallurgy, SA ISSN 0038-223X/3.00, SAIMM Conference XIV International Coal Preparation Congress and Exhibition, March, Pretoria, South Africa PT Broken Hill Proprietary Minerals Indonesia, Data of Table Production Report, (2000). Steven Spencer, Yi Liu, (2005), Statistical Signal Processing Methods For Acoustic Emission Monitoring OF Dense Medium Cyclones, CSIRO minerals, Lucas Heights Science and Technology Centre, IEEE, Sydney, Australia, S.Batkhuyag, Sh.Davaakhuu, (2008), Clean Coal Technology, IEEE, Power Engineering and Resource-Saving, page 507-510 Thomas J. Ratajczak and Mohammad Shahidehpour, (2006), Emerging Technologies For Coal-Fired Generation, ECE Department, IEEE, Illinois Institute of technology, Chicago, IL 60616, World Energy Council, (2001), Indonesia General Features of Energy Economy, Extract from The International Energy Data Report 1998, Copyright 1999-2001 DESIGN AND SIMULATION OF MEMS CAPACITIVE PRESSURE SENSOR USED IN BLOOD PRESSURE MONITOR Diem N. Ho diemhn@uit.edu.vn Faculty of Computer Engineering, University of Information Technology – VNU-HCM, Ho Chi Minh City, Vietnam Hanh-Dang Ngoc Vietnam hanhdn@hcmut.edu.vn Department of Telecommunications Engineering, Ho Chi Minh City University of Technology – VNU-HCM, Ho Chi Minh City, Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract In this paper a MEMS (Microelectromechanical System) capacitive pressure sensor is designed for measurement of absolute pressure from 0 KPa to 50 KPa that is in the range of human blood pressure. Design parameters like sensor diaphragm shape, dimension, thickness, and the selection of the diaphragm material are analyzed and simulated using COMSOL software. The purpose is to select a set of effective design parameters for the sensor structure. The pressure sensor of square diaphragm with edge dimension 500 µm, thickness 5 µm, the gap between plates 5 µm are shown to be suitable for the applied pressure. The simulation result also shows that polysilicon diaphragm yields the highest sensitivity compared to diaphragm made of silicon or silicon carbide. This sensor design is capable to be used in a human blood pressure monitor. Keywords: MEMS, capacitive pressure sensor 1 INTRODUCTION MEMS pressure sensor has many advantages compared to conventional pressure sensor due to its low weight, low cost, reliable, smart function and occupies less space. Many commercial pressure sensor use piezoresistive sensing technique [1][2][3]. Piezoresistive pressure sensor is preferred because the properties of silicon material has been fully defined and the current silicon foundry facility can be used for mass production. Pieoresistive sensor has high coefficient of measurement but it also has high temperature coefficient. This limits the operating temperature and require temperature compensation circuit. In spite of complex signal conditioning circuit, capacitive pressure sensor occupies more advantages over the piezoresistive one: low power consumption, low noise, high sensitivity, less affected by temperature, and good long-term stability. Advances in silicon micromachining techniques have also helped in the miniaturization of the capacitive pressure sensors. With small size and low energy consumption, capacitive pressure sensor Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 153 154 | Asea Uninet Scientific and Plenary Meeting 2016 fits for medical application, especially for the devices implanted in the body or be used consistently in a long time. The pressure sensor in this work aims to operate in a blood pressure measuring device at the wrist. This blood pressure monitor may include an LCD display to show measurement result. The machine can measure continuous blood pressure, thus less power consumption is one of the essential characteristics of the device. This device is suitable for patients requiring continuous blood pressure monitoring throughout the day. Besides, that the device is worn at the wrist and is continuously used demands a compact device. This work chooses to design the sensor of type capacitive pressure sensor regard to its advantages in medical application as mentioned earlier. The objective of this work is to carry out an analysis on the centre deflection of sensor diaphragm and capacitance sensitivity to point out the design parameters most suitable for to measure the human blood pressure in the range 0-50KPa (equivalent 0-375mmHg) The paper is organized as follow. Section 2 discusses mathematical analysis on the deflection of the diaphragm membrane and capacitance sensitivity for sensor. In section 3, the proposed capacitive absolute pressure sensor are described in section 3. Section 4 presents the simulation results and makes discussion. Finally, section 5 concludes the work. 2 MATHEMATICAL ANALYSIS OF THE SENSOR Generally, a capacitive pressure sensor includes two parallel plates acting as electrodes of a capacitor. The upper plate is usually moveable (diaphragm) and the lower one is fixed as illustrated in Figure 1. External pressure applies on the diaphragm and move the upper electrode, resulting the capacitor between the plates will be changed. As a result, the capacitor changes are used for pressure sensing. The sensitivity of the sensor is related to the capacitive changes. More changes cause the higher sensitivity. Figure 1. Cross section view of a typical capacitive sensor The governing differential equation for the deflection of thin plate is given by [4] (1) Asea Uninet Scientific and Plenary Meeting 2016 | 155 where P is the applied pressure, D is the flexural rigidity, given as: (2) by solving with boundary condition, where all sides of the sensor diaphragm are built in, that is: (3) where n is the normal vector direction along the sides of the sensor diaphragm. For square diaphragm, the maximum stress at the midpoint of each edge is as follow: (4) And the maximum displacement of the diaphragm occurs at the centre of the plate: (5) where h is the diaphragm thickness, a is the length of the square edge, E is the Young”s Modulus The capacitance between two parallel electric conductive plates can be written as: (6) where c is capacitance, is dielectric constant of vacuum is the dielectric constant of material. A is area of electrode plate and d is the gap between two electrode plate. Based on Hooke”s law, the change in thickness in the dielectric layer is proportional to the pressure and original thickness (Eq. (7)). As a result, the relationship between the applied pressure and the capacitance change can be expressed as Eqs.(7) and (8) (7) (8) Where ∆d is thickness change of dielectric layer, d0 is original thickness of dielectric layer. ∆P is applied external pressure, C0 is original capacitance when pressure is not applied and ∆C is capacitance change when pressure is applied. 156 | Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 PROPOSED CAPACITIVE PRESSURE SENSOR Sensor layout Firstly the appropriate shape for the diaphragm should be chosen. Square and round diaphragms are frequently used in MEMS devices. It is also possible to use rectangular shape. But there is non- uniform stress distribution on rectangular diaphragm due to lack of symmetry of the structure, then decreasing the sensor sensitivity. Besides, no clear advantage between square and circular diaphragm with the same area under the same load is presented by Goodall [5]. Moreover, the silicon crystal structure has anisotropic nature, thus a square diaphragm can be fabricated more easily and accurately. As a result, it was decided to utilize a square diaphragm instead of a circular one. The cross-section diagram of the proposed absolute pressure capacitance pressure sensor in undeformed condition is shown in Figure 2. The diaphragm membrane with edges built in, suspended over a sealed cavity on a silicon substrate. The thin membrane is held at a fixed potential. The membrane is seperated from a ground plane by a chamber sealed under vacuum. The sides of the chamber are insulating to prevent a connection between the membrane and the ground plane (for simplicity, the insulating layer is not modeled explicitly in the simulation software—this approximation will have little effect on the results of the study). Figure 2. 2D cross section of the capacitive pressure sensor Thickness of the diaphragm membrane decides the pressure level, thicker is suitable for high- pressure application and vice-verse. With low pressure to be measured, diaphragm which has large area and small thickness would result in better sensitivity. Besides, diaphragm thickness and gap should be chosen to prevent the collapse of diaphragm on bottom electrode. 3.2 Material Three materials are selected for diaphragm material, Si, PolySi and SiC. Silicon and silicon compounds are widely used in the fabrication of micro pressure sensor. Recently the application of polymer material has increased due to various advantages like structural stability, more flexible, good electrical and thermal characteristics with a limitation in high temperature application. Asea Uninet Scientific and Plenary Meeting 2016 | 157 Table 1. Physical properties of Silicon, Polysilicon and Silicon carbide 4 SIMULATION RESULTS AND DISCUSSION In this part, the modeling of capacitance and sensitivity of the clamped square diaphragm will be presented using COMSOL software. The COMSOL model takes advantage of the symmetry in the geometry and models only a single quadrant of the device. The selected side length of square diaphragm to simulate is 500 µm. The thickness of the diaphragm and the height of air gap will be varied. The purpose is to find out a set of design parameters to give the best sensor sensitivity. In general, the high pressure sensitivity of the sensor is achieved by increasing diaphragm size, reducing diaphragm thickness, and decreasing gap between plates. This work does not vary the diaphragm size, but concentrate on finding other parameters best fit with the selected side length. The purpose of the analysis is to verify the deflection of the diaphragm due to mechanically applied force and the capacitance between the diaphragm and the back plate. Figure 3. Simulation model geometry. Left: the symmetric device geometry. Right: only quadrant is modeled 4.1 4.1 Displacement sensitivity The values of the diaphragm thickness to be simulated include 3µm, 5µm, 7µm and 10µm. At first the distance (gap) between plates is chosen as 5µm. The variation of gap between plates has little effect on the diaphragm displacement. With diaphragm thickness 3µm, Figure 4 shows the diaphragm displacement at different positions under the pressure 50KPa. As can be seen from the figure, the maximum displacement is at the centre of 158 | Asea Uninet Scientific and Plenary Meeting 2016 diaphragm; for safe operation, this maximum displacement should be smaller than a half of the air gap [6] Figure 4. Displacement of diaphragm at different positions under pressure 50Kpa Figure 5 illustrates the applied pressure vs. centre deflection changes with the variation of the thickness of the diaphragm. From this figure , it can be observed that diaphragm of thickness 3 µm have the maximum centre deflection. The centre deflection increases from 1.75x10-11m at 0KPa to 4.66x10-6m at 50KPa. The result gives the displacement sensitivity of the sensor (dw/dP) is about 93nm/KPa. With diaphragm thickness 5 µm, 7 µm and 10 µm, this sensitivity is respectively 40.6nm/KPa, 16nm/KPa and 5.6nm/KPa. Figure 5. Centre displacement vs applied pressure on different diaphragm thickness Diaphragm thickness plays an important role in designing the pressure sensor. When thickness of diaphragm is minimum then deflection is maximum and when deflection is maximum then change in capacitance is also maximum. It means sensor sensitivity depends upon the thickness of the diaphragm. Sensitivity decreases with increasing thickness of diaphragm. But maximum pressure handling capability can be increases by Asea Uninet Scientific and Plenary Meeting 2016 | 159 changing diaphragm thickness. Higher diaphragm thickness means it can with stand with high amount of pressure. 4.2 Capacitance sensitivity Figure 6 shows the distribution of electric potential between plates for the diaphragm dimension 500µmx500µm, thickness 3µm, distance between plates 5µm under the pressure 50KPa. Due to the deformation of the diaphragm, the potential is nonuniformly distributed in the plane. The electric potential is highest at the centre of membrance and smaller when going from the center. Figure 6. Electric potential distribution The capacitance output depends on diaphragm dimension and thickness. Diaphragm with larger area and smaller thickness results in larger capacitance output and higher sensitivity. Besides, the gap between plate also plays an important role in calculating the capacitance. Figure 7 and Figure 8 present the change in capacitance output of the sensor versus the applied pressure on different diaphragm thickness and distance between plates. Figure 7. Plot of capacitance vs. applied pressure for square diaphragm of different thickness (distance between plates 5 µm) As illustrated from Figure 7, when pressure applies from 0 to 50KPa, the capacitance of the sensor increases from 110fF to 235fF for the diaphragm thickness 3µm, gap 5µm. So the total variation of the capacitance is 125fF, which yields the capacitance sensitivity 160 | Asea Uninet Scientific and Plenary Meeting 2016 (dC/dP) of 2.48fF/KPa. In the same way, the capacitance sensitivity can be calculated for different diaphragm thickness and gap and be displayed in Table 2. Figure 8. Plot of capacitance vs. applied pressure for square diaphragm of different thickness (distance between plates 10µm) Table 2. Capacitance sensitivity of the sensor of different diaphragm thickness and gap Capacitance sensitivity Gap 3µm (fF/KPa) 5µm 7µm 10µm Diaphragm thickness 3µm x 2.48 0.67 0.25 5µm 7µm 10µm 1.44 0.38 0.18 0.08 0.37 0.12 0.06 0.028 0.12 0.04 0.02 0.01 Diaphragm of thickness 3µm always give the highest sensor sensitivity compared to other diaphragm thickness. However, as presented above, with diaphragm thickness 3µm, the centre displacement of this diaphragm under pressure 50Kpa is 4.66µm. This displacement value requires the distance between places should be more than twice the diaphragm thickness. With this requirement, the gaps 3µm, 5µm, 7µm are not suitable for diaphragm thickness 3µm. Similarly, the gap 3µm should not be used when the diaphragm thickness is 5µm. For the diaphragm with thickness 3µm and gap 3µm, the gap is smaller than the maximum defletion of the diaphragm thickness 3µm, so the value of sensor sensitivity for this case is not calculated in the table. It can be seen from Table 2 that for a certain value of diaphragm thickness, the capacitance or sensor sensitivity will decrease as the gap between plates increases. Among the accepted sets of diaphragm thickness and gap, the diaphragm of thickness 5µm and the gap between plates 5µm gives the best sensor sensitivity which is 0.38fF/KPa. This is the set of design paramters most suitable for the diaphragm dimension 500µmx500µm. The sensor with this set of design parameters will be characterized aboutt material next. All the results above are for diaphragm made of Silicon material. Now, different material as Silicon carbide and Polysilicon are selected to compare with Silicon. Figure 9 and Figure 10 demonstrate the maximum diaphragm deflection and change in capacitance vs applied pressure for different materials. Asea Uninet Scientific and Plenary Meeting 2016 | 161 Figure 9. Change in centre diaphragm deflection for diaphragm of different material Figure 10. Change in sensor capacitance for diaphragm of different material Figure 9 and Figure 10 show that for a particular applied pressure, polysilicon and silicon diaphragms have the maximum displacement and sensor capacitance approximately close, and much greater than SiC. It results in higher sensor sensitivity for polysilicon and silicon diaphragm, in which polysilicon diaphragm gives the best sensitivity. Deflection of diaphragm depends on young’s modulus, and deflection of diaphragm decreases when young’s modulus increases. Based on this, changes in capacitance also low for high Young’s modulus materials. It also points out that Polysilicon material is more suitable for low pressure sensing application. 5 CONCLUSION A high sensitive MEMS capacitive pressure sensor to be used in blood pressure monitor has been designed and simulated. Capacitive pressure sensor with diaphragm dimension 500µmx500µm, thickness 5µm, and the distance between plates 5µm yields the best sensitivity. The polysilicon diaphragm membrane shows high sensitivity on centre deflection and capacitance, on comparing with silicon and silicon carbide. The design also has good linear variation of deflection and capacitance over the working range of pre---ssure. This sensor is suitable for measurerement of human blood pressure which is in the range 0-50KPa. 162 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES L. L. a. W. Yun, “MEMS Pressure Sensors for Aerospace Applications,” em Proceedings of Aerospace conference, March 1998. S. S. David s. Eddy and Douglas R, “Application of MEMS Technology in Automotive Sensors and Actuators,” em Proceedings of the IEEE, August 1998 e. Aini hussian, “Characterization of MEMS automotive sensor for tire pressure monitoring system,” Journal of applied science, , pp. 810-815, 2006. S. T. a. S. Woinowsky-Krieger, Theory of Plates and Shells, New York: McGraw-Hill, 1959.5. G. A. Goodall, “Design of an implantable micro-scale pressure sensor for managing glaucoma,” Michigan State University, Department of Mechanical Engineering, 2002. Thomsen, J. R. E. V. Piezo Resistive MEMS Devices: Theory and Applications, Department for Micro and Nano Technology, DTU. PCR USING HYPERSENSITIVE REACTION AND PATHOGENICITY SPECIFIC PRIMER PAIR OF SEVERAL INFECTED HORTICULTURAL PLANTS Retno Kawuri mycrobiologylaboratory@yahoo.com* Made Pharmawati pharmawati@hotmail.com Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia *Corresponding Author Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract Hypersensitive reaction and pathogenicity (hrp) gene involved in plantpathogen interaction. This gene codes basic pathogenic function responsible for disease occurrence. This research aimed to evaluate primer pair RS80 and RS81 in amplification of hrp gene from infected horticultural plants collected from Jembrana, Bedugul and Kintamani, Bali, Indonesia. DNA extraction was done directly from infected organs using CTAB method. DNA amplification was done using primer RS80 and RS81 specific to hrp gene that can be used to identify pathogen including Ralstonia sp. Ralstonia sp. caused wilt disease in many horticultural plants in Bali. Results showed that amplification occurred in pseudostem of cavendish banana plantain, ginger root, strawberry fruit and fruit of zucchini. However, the amplifications were not specific and resulted in multi bands pattern. This may indicated that primer RS80 and RS81 not specifically amplify pathogen using uncultured bacteria. Keywords: horticultural plants, hrp gene, Ralstonia sp. 1 INTRODUCTION Horticultural plants such as potato, tomato, chilli, eggplant and banana often susceptible to diseases. One of plant disease that commonly attack is bacterial wilt caused by soil bacteria Rasltonia solanacearum (Tahat & Sijam 2010). The symptoms showed by this disease are yellowish leaf, necrosis and yellow vein (Swanson et al. 2005). Control of R. solanacearum is not always effective because the strains are unidentified (Lamessa et al. 2010). Therefore identification and information on genetic diversity of R. solanacerum are useful in designing control strategy. Bacterial wilt desease was caused by Ralstonia solanacearum, has attact some horticulture plantation such as banana , chilli and tomato in Penasan village, Klungkung regency Province of Bali. Furthermore the same disease has attact chilli , banana and tomato plantation in Pengotan village, Bangli regency and Gerogak village, Buleleng Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 163 164 | Asea Uninet Scientific and Plenary Meeting 2016 regency Provincy of Bali. Therefore this pathogen has several host range and wide disease distribution in Bali. Genetic diversity identification can be done using PCR technique. One of gene with high sequence variation for detecting variation in R. solanacearum is hrp gene. Hypersensitive reaction and pathogenicity (hrp) gene is gene that is required by pathogen to induce disease symptoms in susceptible host (Wilis et al. 1991). Gene of hrp commonly is organized in 23 – 25 kb DNA group which has several operon and is divided to group I (Erwinia and Pseudomonas ) and group II (Xanthomonas and Ralstonia ) based on DNA homology (Prasannath, 2013). Gene of hrp has been used to identify strain of R. solanacearum for example in potato and eucalyptus (Fouché-Weich et al., 2006). Gene of hrp was also used to detect genetic diversity of 120 strain R solanacaerum from Africa, America, Brazil, Swedia, India, Australia and Japan (Poussier et al. 1999). Primers for amplification of hrp gene have been developed. Three primer pairs are available including RS20 (5′-GCTCGTGGTCCTGCTCGTGT-3′) and RS201 (5′CTCACCGCCACTGCCCATTA-3′), RS600 (5′-TTTCTCCATCCTGCCCGCCA-3′) and RS61 (5′-CCAGGGCGAAGTAGATGTTT-3′), RS80 (5′TTGAAAGAGCAGGTGAAGCA) and RS81 (5′-CGATGATGTTGGACGGATTG-3)′ (Fouché-Weich et al. 2006). In this study, primer pair RS80 and RS81 was tested. The aim of this study was to evaluate the ability of primer pair RS80 and RS81 in detecting Ralstonia sp. from infected horticultural plants in Bali 2 MATERIALS AND METHODS Samples were collected from Jembrana, Bedugul and Kintamani, Bali, Indonesia. Samples collected were part of plants that were predicted to be infected by R. solanacearum. The samples included pseudostem of banana plantain, ginger root, strawberry fruit, zucchini fruit and fruit of chilli. DNA was extracted using CTAB method (Doyle & Doyle 1990). As many as 0.1 g infected plant organ was ground using mortar and pestle. After grinding, 1 ml CTAB buffer was added and tube was incubated at 65oC for 30 minutes and centrifuged for 5 minutes at 14.000 rpm. Supernatant was transferred to new tube and chloroform:isoamyl alcohol (24:1) was added. Centrifugation was performed for 5 minutes at 14.000 rpm. Supernatant was transferred to a new tube an 2/3 volume cold isopropanol was added. Samples were incubated for 1 hour at -20C followed by centrifugation for 3 minutes at 14.000 rpm. Pellet was washed in 70% ethanol, then tube was centrifuged for 3 minutes at 14.000 rpm. Pellet was air dried and 100µl sterile water was added. After that 3ul RNase (1mg/ml) was added and incubated at 37oC for 30 minutes. The samples were then stored at -20oC. DNA visualization was done using agarose gel electrophoresis using 0.8% in TAE buffer. Gel was stained using ethidium bromide and observed with uv transiluminator. Gene of hrp in R. solanacearum was amplified using RS80 (5′TTGAAAGAGCAGGTGAAGCA) and RS81 (5′-CGATGATGTTGGACGGATTG-3)′ (Fouché-Weich et al. 2006). Total volume of PCR reaction was 20 µl consisted of 1 U taq polymerase (BD Bioscience), 1 x PCR buffer (BD Bioscience), 1.5 mM MgCl2, 200µM dNTP and 0.5 µM primer and H2O to achieve 20 µl. PCR was done based on cycle as follow: initial denaturation for 5 minutes at 95oC, 35 cycles consisted of denaturation for 1 minutes at 95oC, annealing at 60°C for 1 minute, elongation for 2 minutes at 72°C. Final extension was done for 1 cycle at 72oC for 10 minutes. PCR products were visualized using 1% gel agarose electrophoresis. PCR products were cut and DNA was extracted from agarose using Qiagen gel extraction kit Asea Uninet Scientific and Plenary Meeting 2016 | 165 according to manufacturer instruction. Samples were sent to sequencing facility for base identification. 3 RESULTS AND DISCUSSION PCR using primer pair RS80 and RS81 resulted in multi bands product (Figure 1). It is predicted that there are several varian of Ralstonia sp. in each sample since it was reported that primer RS80 and RS81 are specific to Ralstonia. There is also possibility that the primer amplify other organism because of PCR condition used. Based on Figure 1, there were several bands in each sample. Sample 1 and 3 were not amplify, and it is predicted that no bacterial infection in the two samples. Sample 2 and 4 resulted in PCR products of small size (100 bp–180bp). In small size of PCR product, the product is not enough for sequencing. Figure 2 explained that several bands were cut and re-amplified using similar primer pair. Figure 1. Gel Electrophoresis of PCR Products of Primer RS80 and RS81. Numbers above figure indicate horticultural plants and location of samples. 1=fruit of chilli (Kintamani), 2= cavendish banana plantain pesudostem (Jembrana), 3= badak ginger root (Jembarana), 4=bali ginger root (Jembrana), 5 and 6= banana pseudostem (Jembrana), 7=fruit of strawbery (Bedugul) and 8= fruit of zucchini (Bedugul) 166 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 2. Gel Electroforesis of PCR Products using Primer RS80 and RS81 (Left) and Reamplification Products of PCR Using Primer RS80 and RS81 (Right). Arrows indicate PCR products selected for re-amplification. 5 and 6= banana pseudostem (Jembrana), 7=fruit of strawbery (Bedugul) and 8= fruit of zucchini (Bedugul). Those four bands in Figure 2 were sent to sequencing facility (1stBase, Singapore). The sequences are shown in Table 1. Analyses using BLAST at NCBI website do not identify Ralstonia sp. (Table 2). Table 1. Sequences of Bands Amplify using Primer RS80 and RS81 S a m p l e 5 1 6 2 7 3 8 1 Sequence AGGAAAATCGATGTCTGACTAGTACGGGGCACAACATTTCAACCTCCCGACAGCTGCTTCACCTGCT CATTGAATCTCAGCTCTTTTAACCTCTCCGACGCGCTCCTCGTTCTGCCTCCGGGCACCCTCGCTGCCC CCTCCCTCGACCCGCGGGAGAAGCACCGTCTGAGACGTTTTCGGCTGTGCCGAGTAGTACCTCCCCTC CGCTCTTTTGACACAATATGGGTTGGCCAATTCTTATGGGATTTTCACTAGTTCAGCACATTTCTATCA ACGTGACCGGTGAGCTCTTCGGTCTGATTGCAGAGTGCTAGATAATGAATTAAAAAAAGATACAGTC CGCTATTGGGGGGAGAAATGGGGAGGTGTAGTCGAAATCTGGATCTGGGATCCGGGAACATCAGAC GCGGACCCCCAATCCCTTACACCCGTCCTCCCTCCTTGTGCTTATTATATCGGGGAGTGGTACTAAAA TATAATTTTTTTGTAGTTTGGTGGCTAGTGTGAATGAGAACGAAAAGAGCGTGAA TAGGAAGTCGCGAGAGCGTCATTAAAGCTACCTACTCGGATGTATGCGCTGATGTCTATGGACGTCT CGTGCTCTCACATACCGCCCAGCGTCTCCTAGGCAGCTTGTGGGGCTGGAGGCTGCACGGGGCCCCC GCCCCAGATAAATCCCAGGGCGGCGCTCCTCGACTCGTGCGAGGCGCTCTCCAAGTGGGTACTCATC GGGGGGCCCAGCTCCTCCTCGTACAAGTCTTCCGACTCCATGGCTCAGTTAGAGTTCTCGCAGGATGG ACAACTGTCGTGCCACCTGCATTAATGAATCGGACAGCGCGCGGGGAGAGGAGGTTTGCGTATTGGG CGCTCTTCCGCTTCCTCGCTCACTTAGTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC TCACTCAAAGGCGGTAATACGGTTAACAATATA TTTGCAGCCCCCGCGAGTTTGGTTGTTCCCTGGCAGCTATTTTGCAAAAACAGCTGGGTGATTTATTT GGGCAAGGATGCAACCCGCCGGGGATGTTGAAATGTACCGATGGGACGGGATGTTTTTTGTTTTCTC ANACTGGGGAGATTTTGACTTAATCGCATAATCAACTTTTGCCTACTATGGCTTGGATTCAACATCAT GGAGACCGGNNGACNNCGGCAATGCATGCCCCGGAGGGGGCTATGTTTACCACCGGCACTTGTATTC AATGGCTGCGAGATGGAGTTAAATTGATTGATTCTGCGGCGGAAACTGAAGGATTGTGGCGCCAGAT CAATGAGACTAATGCACTTTATTTTGGGCAATACAAAAAAAGTTTGGGAGCCCCTCACTGGGATATG AGTGCCCCCGGTCCTTGTTTGGGCATTAATGGGGGAGTACAGCGACAAAATTTGGTGCGATCGGATT TGGAGTCGATTGCTTATCAAGTCGGTGACGTCCTGCAC TTTAAGCCCCGGAAAGAAATCCANCCGACCGGGAGCGTTTCATCCGNAGTTTGGCTTGTAGNGTGGG NNTTGGATAAGAGAGCCGCTTTTGTTACTGCCGGGTATGGTTNATGATGTCTGTCAAAGAATATANCT GGTGATGTAACGATTCCACAACTTAATTTATGCCGCCNAAGACTTCGATGAGGATTACNCCGCCAGA AATCCGGAATTTTGCAACTGCCCAAGCNTGATTAGTAATATAATGTCAACGGACTTCTATTCCAAGGC AACGAGATGGGATATATTCGAAATCGACTTTCTCATAGAAANAANGGTNCTAAATTNTGGTAATTGA AACTTTCCCTCTTGGTCATCGCCGGATTATATAGGACTGGGTTATCGTGTTCCTAGATTTTTCGGGGAT GAGTGGGGCTATGGACATTAAGAAGAGTGTTCATTTTCGATGTTTTTTNCCAGAAACTTATTATTCCA CCGGCCCTTTACGTTCCATCTGTTTTTTAAGGATCCGNAAAGGACTCCGNANCGACATTGAATACTGA TGAAAGCTGTTGGCAACGGTTCTAAAAATGCTTTCCGAAGACGCTTTCCAGCTCATTTAACAGAAAA ACAAGAGTTGGACACGCTAGTTTCGAGAGCTACCGATCGAGGTGGAGTTCGAGAAGCCCGGTT Table 2. BLAST Search, Accession Number, and Organism Identified Name 5-1 6-2 Band Size based on Gel Agarose 1250bp 490bp Size of Readable Sequence 672bp 509bp Organism Sequence Identity E-value Uncultured Staphylococcus sp. gene for 16S ribosomal RNA, partial sequence, clone: DhA4-193 95% 8e-65 Asea Uninet Scientific and Plenary Meeting 2016 7-3 450bp 437bp 8-1 720bp 529bp Arthrospira sp. str. PCC 8005 - | 167 85% 2e-148 - - Ralstonia sp was not identified in four DNA sequences. DNA band no 6-2 from banana pseudostem (Jembrana) was identified as Staphylococcus. Staphylococcus was reported as one endophyte genus in horticultural plants (Surette et al. 2003, Vendan et al. 2010). According to Prithiviraj et al. (2005) Staphylococcus aureus can act as pathogen in plants. Another study reported that in Ralstonia metallidurans and Staphylococcus aureus genomes, there was a homologous operon,which produce the polycarboxylate siderophore staphyloferrin B (Bhaat & Deny 2004). Arthrospira or Spirulina especially Spirulina platensis is cyanobacteria that able to sinthesise crystallized silver nanoparticles that can inhibit plant growth (Mahdieh et al. 2012). R.solanacearum has hrp gene which is expressed by HrpB regulator of plant cells. This activation needs physical interaction between the bacteria and the plant cells (Brito et al. 2001). In this research identification R.solanacearum using Primer RS80 and RS81 was not succesfull eventhough sample was taken with the plant cells. Furthermore Aldon et al.(2000) reported that strong induction of hrp regulatory gene expression is triggered during the contact between R.solanacearum and plant cells. Amplification occurred in pseudostem of cavendish banana plantain, ginger root, strawberry fruit and fruit of zucchini. However, the amplifications were not specific and resulted in multi bands pattern. This may indicated that primer RS80 and RS81 not specifically amplify pathogen using uncultured bacteria. REFERENCES Bhaat, G & Deny, TP 2004, ‘Ralstonia solanacearum iron scavenging by the siderophore staphyloferrin B is controlled by PhcA, the global virulence regulator’, Journal of Bacteriology, vol. 186, pp. 7896-7904 Doyle, JJ & Doyle, JL 1990, ‘Isolation of plant DNA from fresh tissue’, Focus, vol. 12, pp. 13–15 Fouché-Weich, J, Poussier, S, Trigalet-Demery, D, ·Berger, D, & Coutinho, T 2006, ‘Molecular identification of some African strains of Ralstonia solanacearum from eucalypt and potato’, Journal of Genetic and Plant Pathology, vol. 72, pp. 369– 373 Lemessa, F, Zelle, W, & Negeri, D 2010, ‘Genetic diversity among strains of Ralstonia solanacearum from Ethiopia assessed by repetitive sequence-based polymerase chain reaction (rep-PCR)’, EJAST, vol. 1, pp. 17-26 Mahdieh, M, Zolanvari, A, Azimee, AS. & Mahdieh, M 2012, ‘Green biosynthesis of silvernanoparticles by Spirulinaplatensis’, Scientia Iranica, vol. 19, pp. 926–929 Poussier, S, Vandewalle, P, & Luisetti, J 1999, ‘Genetic diversity of African and orldwide strains of Ralstonia solanacearum as determined by PCR-Restriction Fragment Length Polymorphism analysis of the hrp gene region’, Applied and Environmental Microbiology, vol. 65, pp. 2184-2194 Prasannath, K 2013, ‘Pathogenicity and virulence factors of Phytobacteria’, Scholars Academic Journal of Biosciences, vol. 1, pp. 24-33 Prithiviraj, B, Bais, HP, Jha, AK, & Vivanco JM 2005, ‘Staphylococcus aureus pathogenicity on Arabidopsis thaliana is mediated either by a direct effect of salicylic acid on the pathogen or by SA-dependent, NPR1-independent host responses’, Plant Journal, vol. 42, pp. 417-32. 168 | Asea Uninet Scientific and Plenary Meeting 2016 Surette, MA, Sturz, AV, Lada, RR, & Nowak, J 2003, ‘Bacterial endophytes in processing carrots (Daucus carota L. var. sativus): their localization, population density, biodiversity and their effects on plant growth’, Plant Soil, vol. 253, pp. 381–390 Swanson, JK, Yao, J, Tans-Kersten, J, & Allen C 2005, ‘Behavior of Ralstonia solanacearum race 3 biovar 2 during latent and active infection of geranium’, Phytopathology, vol. 95, pp. 136-143 Tahat, MM & Sijam, K 2010. ‘Raslatonia solanacearum: the bacterial wilt causal agent’, Asian Journal of Plant Sciences, vol. 9, pp. 385-393 Willis, DK, Rich, JJ, & Hrabak, EM 1991. ‘hrp genes of Phytopathogenic bacteria’, Molecular Plant-Microbe Interactions, vol. 4, pp. 132-138 Vendan, RT, Yu, Y, Lee, S, & Rhee Y 2010. ‘Diversity of endophytic bacteria in ginseng and their potential for plant growth promotion’, Journal of. Microbiology, vol. 48, pp: 559–565 GROWTH HORMONE GENE POLYMORPHISM OF BALI CATTLE AT VILLAGE BREEDING CENTRE, NUSA PENIDA Besung INK kertabesung@yahoo.co.id Suwiti NK Yulita H Suardana IW The Faculty of Veteriner,Udayana University Watiniasih NL Yowani C The Faculty of Mathematics and Basic Science,Udayana University Abstract A Research has been conducted to investigate the gene polymorphism of growth hormone of bali cattle raised at Village Breeding Centre (VBC), Nusa Penida, Bali. Fifty whole blood samples were collected form jugularis vein of bali cattle, in which the DNA was extracted. The polymorphism of the genes was identified employing the Polymorphism Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP), using 5’-TAGGGGAGGGTGGAAAATG GA-3’ and 5’-GACACCTACTCAGACAAGCG -3’ primer and HaeIII restriction enzyme. The result showed that the length of allele of growth hormone gene of bali cattle was 404 bp, with one restricted region, resulting in 179 bp and 225 bp of DNA fragments. The gene of growth hormone of bali cattle at Village Breeding Centre Nusa Penida consisted of a single allele with the frequency of 1.0 and PIC marker was valued at 0.000. It can be concluded that the growth hormone gen of bali cattle was monomorphic, so it can be use as a gen marker in bali cattle at VBC, Nusa Penida. Keywords: growth hormone gen, Bali cattle, PCR-RFLP, HaeIII enzime 1 INTRODUCTION Nusa Penida is an archipelago located in Klungkung Regency, Bali Province, which has little rain fall so categorized as critical lands. Nusa Penida designated as bali cattle purification breeding areas (pure breed). Bali cattle reared in Nusa Penida adapted to dry environmental conditions for its survival, wich may drive the process of evolution and natural selection. Bali cattle body size in Nusa Penida was smaller than bali cattle reared in other areas in Bali (Saka et al., 2012; Suwiti et al., 2014 ). The growth of bali cattle was affected by external factors, such as geographical conditions, the availability of food resources, and the technique of maintenance, and the internal factor such as the level of growth hormone. The level of bali bovine growth hormone in Nusa Penid was lower (1200.8 pg/ml) compared to the bali cattle reared in other districts in Bali, which the highest value was Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 169 170 | Asea Uninet Scientific and Plenary Meeting 2016 1927.64 pg/ml (Suwiti et al., 2014 ). Noor (2002) found that, one gene can express more than one form of morphological, physiological status and growth of a species, in respons to environmental changes, known as phenotypic plasticity. Growth hormone secretion is influenced by growth hormone (GH) gene. One gene that potential encoding morphological characteristics related to growth, such as body weight, shoulder height, body length, and chest circum ference is a growth hormone (Unanian et al., 2002). Growth hormone gene that encodes a growth hormone known to play an important role in the growth, lactation and mammary gland development, gluconeogenesis, lipolysis activation and triggering incorporation of amino acids in muscle proteins (Burton et al., 1994). Growth hormone gene has been mapped located in chromosome 19, which located in q26-qtr (Hediger et al., 1990). Genetic variations may occur due to differences in genes coding regions, but not due to mutations (Sofro, 1994). All natural genetic variations caused by the changes in the nucleotide sequence of the DNA. The importance role of growth hormone gene in a species of an animal, therefore, it is necessary to investigate the characteristics of the growth hormone genes, in terms of its polymorphism. Furthermore, the results of this study can be used as genetic marker of bali cattle reared in Nusa Penida. 2 2.1 METHODS Sample Collections Samples of whole blood bovine were collected from 10 Village Breeding Centre (VBC), those were Tanglad, Batukandik, Batumadeg, Sakti,Klumpu,Toya Pakeh, Suana, Pejukutan, Sekartaji, and Batununggul, at the Sub-district of Nusa Penida, District of Klungkung, Bali Province. A total of 100 samples were collected, then its DNA was extracted. The growth hormone gene was isolated using Polymerase Chain Reaction Restriction Fragment Long Pholimorphisme (PCR - RFLP) methods. 2.2 Growth Hormone Gene Amplification The growth hormone genes were extracted and amplified using the primer of 2F:5’TAGGGGAGGGTGGAAAATGGA-3’ (forward) and 2R: 5’GACACCTACTCAGACAATGCG-3’ (reverse) following Yao et al. (1996). The amplification reaction carried out in 25 ml mixed reaction, which contain of: 1 ml of DNA template, 10 μM of forward and 10 μM of reverse primer, 12.5 ml of Master Mix (GoTaq® Green Master Mix Promega) and 9,5 μl nuclease - free water. Amplification was conducted in a device Applied Biosystems Veriti 96 Well Thermal Cycler for 35 cycles. Each cycle consists of denaturation of template DNA at 94°C for 15 seconds, annealing at a temperature of 64°C for 45 seconds, and extension at 72 °C for 59 seconds. The cycle began in pre-heating at 94°C for 2 minutes, and ending with post extensions on the temperature of 72 °C for 5 minutes. Visualization was conducted in 15% agarose gel stained with GelRed ™ and Nucleic Acid was evaluated using UV transiluminator. 2.3 Growth Hormone Gene Restriction The restriction enzyme used was HaeIII enzyme, to restrict GG'CC regions (Unanian et al., 1994). Five μl DNA template was mixed with 3.5 units of restriction enzymes HaeIII, 1 ul H2O, and 0.7 × 10 ul buffer.The mixture was then incubated at 37 °C for 3 hours.The result of DNA restriction, then electrophoresed on an 8% polyacrylamide gel, stained with GelRed ™ Nucleic Acid, and visualized with UV transluminator. The length of fragment Asea Uninet Scientific and Plenary Meeting 2016 | 171 as the result of restriction enzyme was measured as a migration distance of each fragmens, then comparing them with the migration of marker. 2.4 DataAnalysis The analysis of growth hormone gene polymorphism, restricted HaeIII enzymes include the allele frequency and Informative Polymorphic Content (PIC). Allele frequency was calculated following Nei (1987) : 𝑿𝒊 = 𝟐𝒏𝒊𝒊 + ∑𝒋≠𝒊 𝒏𝒊𝒋 𝟐𝑵 Notes : Xi = the allele frequency at the ith at the locus X Nii = number of individual with genotype homozygous alleles i nij = number of individuals with the genotype heterozygous allele i N = number of samples The Polymorphic Content Informative (PIC) is calculated using the formula (Bolstein et al., 1980) : 𝑛 𝑃𝐼𝐶 = 1 − ∑ 𝑝𝑖2 𝑖=1 𝑛−1 𝑛 − ∑ ∑ 2 𝑝𝑖2 𝑝𝑗2 𝑖=1 𝑗=𝑖+1 Notes : pi = i-th allele frequency pj = j-th allele frequency n = number of alleles per marker 3 3.1 RESULTS AND DISCUSSION Results Growth hormone gene amplified at 404 bp is presented in Figure 1. The HaeIII restriction enzymes produced the patterns consisting of two fragments, with a base length of 179 bp and 225 bp, and had the AA genotype (Figure 2).This means that, the area of intron IV, exon V, and 3' regions of growth hormone gene restricted in HaeIII was not vary or monomorphic. 172 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 1. Growth Hormone Gene Amplification of bali cattle in 1.5 % agarose gel (M ; marker 100 bp, 1-8 : sample ) Figure 2. Visualization of Growth hormone in H PCR – RFLP, restricted in HaeIII enzyme, and in polyacrylamide gel 8 % ( M ; marker 100 bp , 1-4 ; GH gene amplification , R1 - R4 ; HaeIII restriction GH gene ) Allele frequency restricted with HaeIII enzyme, produced two DNA fragmens that is 179 bp and 225 bp ( Figure. 2 ) with genotype of AA ( Table 1 ) Asea Uninet Scientific and Plenary Meeting 2016 | 173 Table 1. Number genotype and allele frequencies of bali cattle - Bali Nusa Penida Genotype Alelle Sample collection Type Frequency Type Frequency AA 50 A 1.00 VBC at Nusa Penida ( n=50 ) The value of Polymorphic Informative Content (PIC) was used as a parameter to determine the usefulness of a marker and to determine the polymorphism of alleles. The results of GH HaeIII marker are presented in Table 2. Table 2.The value of Polymorphic Informative Content ( PIC ) of bali cattle from Nusa Penida. 3.2 Sample Number of sample PIC Value Nusa Penida-Bali 50 0.000 Discussion The results showed that different genus of cattle hs different GH gene. In Ongole cattle the GH gene marker was located in FF ( 0.96 ) and EF ( 0:04 ) allele in the exon V and 3 regions, so the allele are monomorphic (Unanian et al., 2002; Paputungan et al., 2012), while Garcia (2010) found that the GH gene of charolais cattle were polymorphic, characterised by allele variation of CC (0.47), CG (0.47), and GG (0.06). There was no allele variation in genotype LL (1.0) found in Aceh cattle, which its genes were extracted from intron IV, exon V, and 3’ regions (Sari, 2012), whereas in charolais cattle in similar genotype was found allele polymorphism, that were in CC (0,57), CG (0,36), dan GG (0,07) (Garcia, 2010). Rahmani et al. (2004 ) stated that there are many factors that can affect types of alleles, frequencies and genotypes, namely species of cattle, number of samples, the sex of cattle, the gene regions (exon, intron, region 3’ and region 5’), and the method and the enzyme used for the analysis. The allele frequency of A was found high (valued 1), while a allele was not detected. Hartl and Clark (1997) suggests, a polymorphic locus characterized by one allele frequencies of less than 0.95. Polymorphic loci can be expressed as the number of alleles present in the locus of more than one (Spencer et al., 2000). Therefore, this research found that the GH gene HaeIII of bali cattle in VBC Nusa Penida is monomorphic . Bali cattle in the islands of Nusa Penida have a genetic variation that is different from other areas. This region wa geographically separated from the mainland of Bali, so the sea (Badung Strait) is an effective barrier in conserving its genes at Nusa Penida (Baker et al., 1990). Restrictions in gene flow may have an effect of homogenizing the population, and reduce gene variation intra-population by adding a new allele or alleles replacement through drift (Slatkin, 1985). Research on Hereford cows and Composite in Wokalup Research Station in Western Australia suggests that variations in the gene GH significantly affect the variation of the mean growth (Sutarno et al., 1996; Sutarno, 1998). 174 | Asea Uninet Scientific and Plenary Meeting 2016 GH gene genotype which was cutted with enzyme showed monomorphic. It means that, there was no genetic variation of gene GH in bali catlle raised at Nusa Penida breeding centre (Suwiti et al., 2015). Gene frequencies was influenced by selection, mutation of the gene, the mixing populations that has different gene frequencies, inbreeding, outbreeding and genetic drift (Yuniarsih et al., 2011). The presence of inbreeding increases the frequency of homozygotes, and ultimately increase the isolation between individuals and populations (Charlesworth, 2003). The value of Polymorphic Informative Content (PIC) is a measure of determining the polymorphism of allele found that bali cattle has low allele polymorphism in GH HaeIII loci (PIC= 0.000). According Botstein et al. (1980) the PIC values were categorised into three groups. The value of allele polymorphism is high if the value of PIC ≥ 0.5, medium if 0.25 > PIC <0.5 , and low if PIC ≤ 0:25. 4 4.1 CONCLUSION AND RECOMMENDATION Conclusion The length of allele of growth hormone gene of bali cattle raised in Nusa Penidawas 404 pb, which is monomorphic allele. 4.2 Recomendation Further research is very important to be conducted by identifying more loci on growth hormone gene, therefore can be refered as gene selection for stockbreed selection of bali cattle. REFERENCES Baker, A.J., Dennison, M.D., Lynch, A., and Grand, G.L. 1990. Genetic Divergence in Peripherally Isolated Populations of Chaffinches in the Atlantic Islands. Evolution, 44:981-999. Burton, J.L., McBride, B.W., Block, E., and Glimm, D.R. 1994.A Review of Bovine Growth Hormone. Can J AnimSci, 74: 167-201. Bolstein, D. White, R.L., and Skolnick, M. 1980. Construction of Genetic Map Linkage Map in Man Using Restriction Fragment Length Polymorphisms. Am J Hum Genet,32 : 314-331. Charlesworth, D. 2003. Effects of Inbreeding on The Genetic Diversity of Populations. Phil Trans R SocLondB, 358:1051–1070. Garcia, M.V.Z.L.A.M. 2010. Determinacion De Los Polimorfismos Del Gen De La Hormona De Crecimiento Y Su Efecto Sobre Characteristicos Productivas En Garado Charolais (tesis).Mexico :Instituto Politecnico National Centro De Biotecnologia Genomica. Hartl D.L. and Clark A.G. 1997. Principles of Population Genetics, 3rd edition. Sunderland USA :Sinauer Associates Inc. 542 p. Hediger, R. 1990. Assigment of The Growth Hormone Gene Locus to 19q26 qter in Cattle and to 11q25 qter in Sheep by In-situ Hybridization. Genome, 8:171-174. Milfa, S., Suwiti, NK., and Tenaya, IWM. 2015. Profil Growth Hormon Sapi Bali Betina pada Tiga Tipe Lahan Pemeliharaan di Provinsi Bali. Buletin Veteriner Udayana, Vol.7. No.1 : 1-8. Nei, M. 1987. Molecular Evolutionary Genetic.Columbia University Press. New York. Asea Uninet Scientific and Plenary Meeting 2016 | 175 Noor, R.R. 2002. GenetikaEkologi. Laboratorium Pemuliaan dan Genetika Ternak. Fakultas Peternakan, IPB. Paputungan, U., Hakim, L., Ciptadi, G., and Lapian, HFN. 2012. The allele frequencies of growth hormone gene on the parental and progeny of Ongole-crossbreed cattle population in the North Sulawesi of Indonesia using PCR-RFLP. Journal of Evolutionary Biology Research Vol. 4 (3), pp. 52-58. Rahmani, N., Muladno, and Sumantri, C. 2004. Analisis Polimorfisme Gen Bovine Growth Hormone (BGH) EXON III-IV Pada Sapi Perah Frisien Holstein di BPTU Baturraden. Seminar Nasional Teknologi Peternakan dan Veteriner. Rocha, J.L., Baker, J.F., Womack, J.E., Sanders, J.O., Taylor, J.F. 1992. Statistical Associations Between Restriction Fragment Length Polymorphism and Quantitative Traits in Beef Cattle. Journal of Animal Sciences, 70 : 3360-3370. Saka, IK., Mantra, IB., Tirta, AIN., Oka, AA., Sriyani, NLP., Sentana,P. 2011. Karakteristik Karkas Sapi Bali Betina dan Jantan yang Dipotong di RPH Pesanggaran Denpasar. The Excellence Research: 39-46. Sari, E.M., Noor, R.R., Sumantri, C., Margawati, E.T. 2012.Carcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle.Proceeding of The 2nd International Seminar on Animal Industry.Jakarta, 5-6 Juli 2012. Slatkin, M. 1985. Gene Flow In Natural Populations. Annual Review of Ecology and Systematics, 16:393-430. Sofro, A. S. M. 1994. Keanekaragaman Genetik. Yogyakarta: Andi Offset. Spencer CC, Neigel JE, Leberg PL. 2000. Experimental evaluation of the usefulness of microsatellite DNA for detecting demographic bottlenecks. Molecular Ecology, 9, 1517- 1528. Sutarno, Lymbery, A.J., Thompson, R.C.A., Cummins, J.M. 1996. Associations Between Growth Hormone Genotypes and Estimated Breeding Values for Pre weaning Growth of Beef Cattle. Proceedings of The 13th International Congress on Animal Reproduction, p26. Sutarno. 1998. Candidate Gene Markers for Production Traits in Beef Cattle. Perth: Murdoch University. Suwiti, NK., Saragih, CI., Ardana, IBK. 2014. Kadar Hormon Pertumbuhan Bibit Sapi Bali di Nusa Penida dibandingkan dengan Wilayah Lainnya di Bali. Lap Penelitian PKSB UNUD. Suwiti, NK.,Candra, Y., Besung, INK., Watiniasih, NL. 2015. Penanda Genetik Bibit Sapi Bali Unggul melalui Identifikasi Gen Hormon Pertumbuhan. Lap Penelitian HRIU UNUD. Unanian, M. M., Barreto, C. C., Cordeiro, C. M. T., Freitas, A. R., Josahkian, L. A. 2002. Possible Association Between Bovine Growth Hormone Gene Polymorphism and Reproductive Traits. Braz Arch Boil Tech, 45: 293-299. Yao, J., Aggrey, S.E., Zadworny, D., Hayes, J.F. danKuhnlein, U. 1996.Sequence Variations in The Bovine Growth Hormone Gene Characterized by Single-Strand Conformation Polymorphism (SSCP) analysis and Their Association ith Milk Production Traits in Holstein. Genetics 144 :1809-1816. Yuniarsih, P., Jakaria, Muladno. 2011. Ekspolarasi Gen Growth Hormone Exon3 pada Kambing Peranakan Etawah (PE), Saanen dan PESA melalui Teknik PCR-SSCP. Bogor :Institut Pertanian Bogor. POTENTIAL OF STREPTOMYCES SP. IN THE RHIZOSPHERE OF PLANTS ZINGIBERACEAE IN INHIBITING MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII Ni kadek Losiani Losi_potter@yahoo.co.id* Retno Kawuri mycrobiologylaboratory@yahoo.com Ketut Darmadi Adarmadi98@yahoo.com Biology Department, Faculty of Mathematics & Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia *Corresponding Author Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract Acinetobacter baumannii is a pathogen that has led to a multidrug resistant. This pathogen is a common cause of outbreaks of infections in patients receiving treatment in the intensive care unit. This study to determine the ability of isolates of Streptomyces sp. that isolated in the rhizosphere of plants Zingiberaceae family in inhibiting the growth of MDR-A. baumannii. Streptomyces bacteria isolated from the rhizosphere of three species of plants Zingiberaceae family in the office of Agriculture and Forestry Plantations, Klungkung, Bali. Isolates were MDR-A. baumannii isolated in patients in the intensive care unit Sanglah Hospital in Denpasar. Test antagonistic Streptomyces sp. on the growth of MDR-A. baumannii using dual culture method. Research results show that the five isolates of Streptomyces that can be isolated from the rhizosphere of plants Curcuma aeruginosa Roxb., Zingiber officinale Rosc., and Curcuma mangga Val. only one isolate capable of inhibiting the growth of MDR-A. baumannii is Streptomyces sp. 2 with a 12 mm zone of inhibition. Keywords: Streptomyces sp., antibiotics, MDR-A. baumannii 1 INTRODUCTION Bacteria resistant Acinetobacter baumannii is recognized as one of the class of Gramnegative aerobic bacteria that are resistant to some antibiotics like ampisillin, ceftazidime, meropenem, levofloxacin, amikacin, and trimethoprim-sulfamethoxazole (Cucunawangsih et al., 2015). A. baumannii resistant bacteria are often the cause of an outbreak of infectious Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 176 Asea Uninet Scientific and Plenary Meeting 2016 | 177 and endemic. This is supported by the ability to survive in a variety of environmental conditions for a long time (Fournier & Richet, 2006) and can even colonize in the hands of health care workers (Jawad et al., 1998). A. baumannii resistant bacteria is known to have broad clinical spectrum such as bacteremia, pneumonia, meningitis, urinary tract infections, skin and soft tissue infections, blood stream infections, endocarditis, intraabdominal abscess, and surgical wound infections (Howard et al., 2010 ). Streptomyces bacteria produce antibiotics contribute as much as 70%, while the remaining approximately 20% is produced by a fungus, and 10% produced by other bacteria (Omura et al., 2001). Secondary metabolites are bioactive compounds that can be produced by Streptomyces sp. is antifungal, antiviral, antitumoral, antihypertensives, immunosuppressants and antibiotics. The availability of variety of organic compounds in the soil can affect the quality and quantity of microbes (Rao, 1994). Plant Zingiberaceae family is one of the rhizome plants that contain enough organic matter that can be released into the area rizosfernya (Wohlmut, 2008). Based on this background, the researchers tried to isolate the Streptomyces bacteria in the rhizosphere of crops family Zingiberaceae, namely the rhizosphere of plants Curcuma aeruginosa Roxb., Zingiber officinale Rosc., and Curcuma mango Val. which is known to have several important bioactive compounds. Antagonistic bacteria were further tested with MDR-A. baumannii in vitro so that it can be seen the potential of the Streptomyces isolates were found to inhibit the growth of MDR-A. baumannii. 2 MATERIALS AND METHODS Streptomyces bacteria isolated by using dilution method (Plating Method). Land weighed 10 grams, then put into 90 mL of sterile water as dilution 10-1, further dilution is continued until reaching 10-5 in 9 mL of sterile water. Dilution factor of 10-4 and 10-5 are grown on media YMA / ISP4 (Yeast Malt order / International Streptomyces Project) of 100 mL and incubated for 5 days at a temperature of 280C (Taechowisan et al., 2013). Colony suspected of being Streptomyces bacteria were isolated to obtain pure isolates. Microscopic observations made after the age of cultures reisolasi to 5 days. The parameters observed colonies form, the surface structure of the colony, the diameter of the colony, colony color, and observing whether or not the colonies were able to change the red color of the media YMA / ISP4 become clear as a sign of secondary metabolites produced in the form of antibiotics. Microscopic observations conducted using three methods; Gram staining, acid-fast stain and catalase test. Macroscopic and microscopic observations of the Streptomyces isolates obtained, further identified using a key determinant book Guide to the Classification and Identification of the Actinomycetes and Their Antibiotics of Lechevalier & Waksman (1973). Antagonistic activity test was carried out using pour plate method. In the first test bacteria rejuvenated is MDR-A. baumannii rejuvenated on media NA (Nutrient Agar) and then incubated for 24 hours at a temperature of 370C and Streptomyces bacteria grown back on YMA media / ISP4 then incubated for 5 days at a temperature of 28 0C. Furthermore, one ose MDR-A. baumannii were inoculated in 5 ml of 0.9% NaCl physiological and made uniform turbidity using Mc Farland 0.5 standard that indicates bacterial density of 1.0 x 108. A total of 100 mL of MDR A. baumannii was inoculated on Petri dishes were homogenized with NA media. After the media solidified, Streptomyces bacteria are taken using a cork borer 5 mm and then placed in the middle of a Petri dish and incubated for 24 - 48 hours at a temperature of 280C. After incubation, observation and measurement of the diameter of inhibition zone formed from Streptomyces bacteria's ability to inhibit the growth of MDR-A. baumannii (Kawuri, 2012). 178 | Asea Uninet Scientific and Plenary Meeting 2016 3 RESULTS AND DISCUSSION Five isolates of Streptomyces that can be isolated from the rhizosphere of plants Curcuma aeruginosa Roxb., Zingiber officinale Rosc., and Curcuma mango Val. have different characteristics macroscopically and microscopically. B a b Figure 1. (A) The colony of Streptomyces sp.1 at the age of 5 days on YMA medium (colony diameter = 1.75 cm). (B) microscopic structure (a. conidia are circular, b. hyphae branched). 1000x magnification with a light microscope (Yazumi) B b a Figure 2. (A) The colony of Streptomyces sp. 2 at the age of 5 days on YMA medium (colony diameter = 1 cm). (B) microscopic structure (a. coccus conidia, b. hyphae branched). 1000x magnification with a light microscope (Yazumi) Asea Uninet Scientific and Plenary Meeting 2016 | 179 B b a Figure 3. (A) The colony of Streptomyces sp. 3 at the age of 5 days on YMA medium (colony diameter = 1 cm). (B) microscopic structure (a. coccus conidia, b. straight hyphae). 1000x magnification with a light microscope (Yazumi) B a b Figure 4. (A) The colony of Streptomyces sp. 4 at the age of 5 days on YMA medium (colony diameter = 1 cm). (B) microscopic structure (a. coccus conidia, b. bumpy hyphae ). 1000x magnification with a light microscope (Yazumi) 180 | Asea Uninet Scientific and Plenary Meeting 2016 A B a b Figure 5. (A) The colony of Streptomyces sp. 5 at the age of 5 days on YMA medium (colony diameter = 2,5 cm). (B) microscopic structure (a. bacill conidia, b. hyphae fragmented). 1000x magnification with a light microscope (Yazumi) Streptomyces isolates that have been isolated are identified using the book Guide to the Classification and Identification of the Actinomycetes and Their Antibiotics (Lechevalier & Waksman, 1973). Characterization of Streptomyces isolates as shown in Table 1. Based on the book Guide to the Classification and Identification of the Actinomycetes and Their Antibiotics (Lechevalier and Waksman, 1973), five isolates were identified as having similarities to the genus Streptomyces. The genus Streptomyces is a genus of the class Actinomycetes that are Gram-positive, catalase negative, and it has not acid-fast properties. Tabel 1. Karakteristik Isolat Streptomyces Isolates Strep. Sp. 1 Strep. Sp. 2 Strep. Sp. 3 Strep. Sp. 4 Strep. Sp. 5 greenish brown white Greenish gray white white + + + + + Hyphae branched branched straigh bumpy fragmented Conidia circular circular circular circular Oval Catalase test + + + + + Gram stain test + + + + + Characteristics Colony color Aerial mycelium Asea Uninet Scientific and Plenary Meeting 2016 Acid-fast stain test - - - - | 181 - Keterangan: Strep : Streptomyces + : Uji menunjukkan reaksi positif : Uji menunjukkan reaksi negatif The results of tests carried out showed that five isolates were tested only one isolate that can inhibit the growth of MDR-A. baumannii is Streptomyces sp. 2. Streptomyces sp. 2 ability to produce inhibition caused by the presence of substances which may be primary metabolites or secondary metabolites. Metabolites are formed may be antimicrobial that is able to inhibit the growth of MDR-A. baumannii. The working mechanism of secondary metabolites in Streptomyces happened to destroy cells or inhibit cell division (Ambavane et al. 2014). Tabel 2. Daya hambat isolat Streptomyces terhadap MDR-A. baumannii No. Isolat Streptomyces Diameter Zona Hambat 1 Streptomyces sp. 1 0,0 mm 2 Streptomyces sp. 2 12 mm 3 Streptomyces sp. 3 0,0 mm 4 Streptomyces sp. 4 0,0 mm 5 Streptomyces sp. 5 0,0 mm 6 Kontrol 0,0 mm 1 Five isolates of Streptomyces isolated from the rhizosphere of plants Curcuma aeruginosa Roxb., Zingiber officinale Rosc., and Curcuma mango Val. has the macroscopic and microscopic characteristics are different. Test results showed only one isolate antagonists capable of inhibiting the growth of MDR-A. baumanni with inhibition zone diameter is 12 mm. REFERENCES Ambavane, V., Tokdar, P., Parab, R., Sreekumar, E.S., Mahajan,G., Mishra, PD., D’Souza,L., Ranadive, P 2014, ‘Caerulomycin A-An Antifungal Compound Isolated from Marine Actinomycetes’, Advances in Microbiology, vol. 4, pp. 567578 182 | Asea Uninet Scientific and Plenary Meeting 2016 Cucuwaningsih, V, Wiwing, & Lugito NPH 2015, ‘Antimicrobial Susceptibility of Multidrug-Resistant Acinetobacter baumanii in a Teaching Hospital: A Two-Year Observation’, Open Journal of Medical Microbiology, vol. 5, pp. 85-89 Fournier, PE, & Richet 2006, ‘The Epidemiology and Control of Acinetobacter baumannii in Health Care Facilities’, Clin. Infect. Dis. Vo. 42, pp. 692–699 Howard, A, Donoghue, MO, Feeney, A, &. Sleator, RD 2010, ‘Acinetobacter baumannii: An Emerging Opportunistic Pathogen’, Virulence, vol. 3, pp. 243-250 Jawad, A, Snelling, AM, Heritage, J & Hawkey, PM 1998, ‘Exceptional Desiccation Tolerance of Acinetobacter radioresistens’, J. Hosp. Infect. Vol. 39, pp. 235–401 Kawuri, R 2012, ‘Pemanfaatan Streptomyces thermocarboxydus untuk Mengendalikan Penyakit Busuk Daun Pada Lidah Buaya (Alloe barbadensis Mill.) di Bali’ (Disertasi), Universitas Udayana, Bali Lechevalier, HA & Waksman, SA 1973, ‘Guide To The Classification & Identification of Actinomycetes & Their Antibiotics’ Waverly Press Inc.USA Omura, S, Ikeda, H, & Ishikawa, J 2001, ‘Genome Sequence of an Industrial Microorganism Streptomyces avermitilis: Deducing the Ability of Producing Secondary Metabolites’, Proc. Natl. Acad. Sci. Vol. 98, pp. 15–20 Rao, S 1994, ‘Mikroorganisme Tanah dan Pertumbuhan Tanaman’, UI Press, Jakarta Taechowisan, T, Chanaphat, S, Ruensamran, W, & Phutdhawong, S 2013, ‘Antibacterial activity of Decursin from Streptomyces sp. GMT-8; an Endophyte in Zingiber officinale Rosc.’, Journal of Applied Pharmaceutical Science, vol. 3, pp, 074-078 POTENTIAL BACILLUS SP. AS BIOCONTROL AGENT OF BACTERIAL WILT RALSTONIA SOLANACEARUM IN VITRO Diah Kharismawati Djereng diah04djereng@gmail.com* Retno Kawuri mycrobiologylaboratory@yahoo.com Yan Ramona yan_ramona@yahoo.com Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia *Corresponding Author Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract Pepper is one of horticultural commodities are cultivated by farmers in Indonesia. One cause reduced production of chili is the presence of diseases, common diseases that attack the bacterial wilt, caused by Ralstonia solanacearum. This study will be isolated antagonistic bacteria Bacillus sp. contained in CustomBio products, and tested the inhibition of Bacillus sp. against R. solanacearum in vitro in laboratorium.menggunakan dual culture method with 3 replications, measured the diameter of inhibition zone is formed. It was found four isolates of Bacillus sp. isolated Bacillus sp. 1 (B1), Bacillus sp. 2 (B2), Bacillus sp. 3 (B3), and Bacillus sp. (B4) with a diameter of inhibition zone respectively 15 mm, 8 mm, 21 mm, 0.0 mm, 0.00 mm compared to the negative control, and positive control 25 mm. Keywords: Bacillus sp., In vitro, Ralstonia solanacearum. 1 INTRODUCTION Pepper is one of horticultural commodities are cultivated by farmers in Indonesia. Diseases in pepper is very complex, both in the rainy season and the dry season. It can even lead to substantial losses and declining quality of chili (Duriat, 2009). Common diseases that attack the pepper plant are bacterial wilt, caused by Ralstonia solanacearum (Fegan & Prior, 2005). In addition to pepper, these pathogens can also infect tomato plants (Aspiras & de la Cruz, 1985), potatoes (Gunawan, 1995), tobacco (Arwiyanto, 1998), ginger (Mulya et al., 2000), banana (Sumardiyono et al ., 2001) and patchouli (Nasrun et al, 2007). In other studies has also been reported that Bacillus spp Bc 26 effectively control the disease patchouli directly (antagonist) through the production of antibiotics and siderophores ranging from laboratory, greenhouse, till in the field (Chrisnawati et al., 2009). Bacillus bacteria is also reported as a plant resistance inducers and as Plant Growth Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 183 184 | Asea Uninet Scientific and Plenary Meeting 2016 Promoting Rhizobacteria (PGPR) that can enhance plant growth (Schipper et al., 1987). It is caused by the ability of PGPR bacteria dissolve phosphate (Premono, 1998) and produce a plant growth hormone include indole acetic acid (IAA) (Marwiyah, 2009). Based on this background, this research will be isolated antagonistic bacteria contained in the product CustomBio, and tested the inhibition of Bacillus sp. against R. solanacearum in vitro in laboratorium.menggunakan dual culture method with 3 replications, measured the diameter of inhibition zone is formed. 2 MATERIALS AND METHODS Samples were collected from Buahan Kaja, Gianyar, Bali, Indonesia. Samples collected were part of a plant that is thought to be infected by R. solanacearum. A total of 10 g organ infected plants at the root of chili, put into 90 mL sterile water. Isolation of Bacillus sp. using the dilution method (Platting Method). Taken as many as 1 mL B5 is then inserted into the tube which already contains 9 mL of sterile water. Macroscopic observation includes observations form a colony, the colony surface shape, the shape of the edge of the colony and the colony color. Observations adapted to the macroscopic structure of bacterial colonies based on the book Bergey's Manual of Bacteriology Determination Test 9th Edition 1994. inhibition of Bacillus sp. against R. solanacearum using the dual culture on Petri dishes containing media SPA (Sucrose Peptone Agar). Suspension of R. solanacearum as much as 100 mL incorporated into the Petri dish, and the Petri dish is rotated to the right and to the left until homogeneous. Let the media NA becomes congested, after the inoculated suspension of Bacillus sp. taken using a pipette micron to 20 mL, and then placed in the hole diffusion with a diameter of 5 mm Petri. Then incubated at a temperature of 370C for 1x24 hours. Then do the observation and measurement of the diameter of the inhibition zone formed from bacterial isolates of Bacillus sp. obtained on the growth of R. solanacearum. Inhibition zone can be seen through the formation of a clear zone around the area of Bacillus sp. Inhibition zone diameter of the most substantial and potentially. 3 RESULTS AND DISCUSSION Fourth isolates have different characteristics macroscopically and microscopically. The following is a characteristic of the four isolates of Bacillus sp. which has been isolated. Isolates of Bacillus sp. 1 (B1) Irregularly shaped colonies and white milk, at the age of 2448 hours, the edges of the colony uneven or bumpy, and catalase positive. At the top of the flat colonies. Microscopic bacill or rod-shaped chain with a diameter of 0.40 to 0.71 μm (Figure 1). A B Figure 1. Macroscopic and microscopic characters B1. (A) Colonies B1 was 24 hours on nutrient agar medium (NA); (B) The character of microscopic shaped bacill (stem chain) and Gram positive. 1000x magnification with a light microscope (Yazumi). Asea Uninet Scientific and Plenary Meeting 2016 | 185 Isolates of Bacillus sp. 2 (B2), colonies are round and white translucent, at the age of 2448 hours, the edges of flat colony and catalase positive. At the top of the convex colonies. Microscopically shaped 0,31- cocobacill with a diameter of 0.45 μm (Figure 2). A B Figure 2. Macroscopic and microscopic characters B2. (A) Colonies B2 only 24 hours on the medium NA; (B) The character of microscopic forms cocobasill and Gram positive. 1000x magnification with a light microscope (Yazumi). Isolate Bacillus sp. 3 (B3), colonies are round and creamy translucent, at the age of 24-48 hours, the edges of flat colony and catalase positive. At the top of the flat colonies. Bacill microscopically shaped with diameter of 0.33 to 0.46 μm (Figure 3). A B Figure 4.3. Macroscopic and microscopic characters B3. (A) Colonies B3 was 24 hours in media NA; (B) The character of microscopic forms basill and Gram positive. 1000x magnification with a light microscope (Yazumi). Isolates of Bacillus sp. (B4), colonies are round and white milk, at the age of 24-48 hours, the edges of the flat colonies like billowy clouds and catalase positive. At the top of the flat colonies. Bacill microscopically shaped with a diameter from 0.28 to 0.39 μm (Figure 4). 186 | Asea Uninet Scientific and Plenary Meeting 2016 A B Figure 4. Macroscopic and microscopic characters B4. (A) Colonies B4 24 hours old at NA media; (B) The character of microscopic forms and gram-positive bacilli. 1000x magnification with a light microscope (Yazumi). Of the four isolates were found to have inhibitory zone variation different. Bacillus isolates sp.3 (B3) has a zone of inhibition of the largest and most potential, compared to isolates of Bacillus sp.1 (B1), Bacillus sp.2 (B2), Bacillus sp.3 (B3). Bacillus sp. has the ability to control the development of bacterial wilt disease caused by R. solanacearum. Bacillus produce antimicrobial substances such as bacteriocins. Bacteriocins are antimicrobial polypeptides or proteins produced by microorganisms that are bactericidal. Bacteriocins kill target cells to penetrate between the membrane and the resulting function of the target cell membrane becomes unstable, causing cell lysis (Compant et al., 2005). Table 1. Inhibition of isolates of Bacillus sp. against R. solanacearum in vitro. Number Isolates Bacillus Inhibition Zone Diameter (mm) 1. Bacillus sp. 1 (B1) 15 2. Bacillus sp. 2 (B2) 8 3. Bacillus sp. 3 (B3) 21 4. Bacillus sp. 4 (B4) 0,0 5. Control negative (–) 0,0 6. Control positive (+) 25 Description: The values in the table ± standard deviation is the average of three replications. Different letters in the same column shows the results that were significantly different (P <0.05), according to Duncan test after ANOVA analysis beforehand It was found four isolates of Bacillus sp, which isolates B1, B2 isolates, isolates B3, and B4 isolates. Tested the ability of these isolates to inhibit the pathogen Ralstonia solanacearum in vitro. B3 isolates have inhibitory potential compared to the largest and most other isolates or control inhibition zone with a diameter of 21 mm. Asea Uninet Scientific and Plenary Meeting 2016 | 187 REFERENCES Arwiyanto, T 1998, ‘Pengendalian secara Hayati Penyakit Layu Bakteri pada Tembakau’ Laporan Riset Unggulan Terpadu IV (1996−1998), Kantor Menteri Negara Riset dan Teknologi, Jakarta, pp. 11-23 Aspiras, R, B, & A, R, de La, Cruz 1985, ‘Potential Biological Control of Bacterial Wilt in Tomato and Potato with Bacillus polymyxa FU6 and Pseudomonas fluorescens’ Proceedings of an International Workshop PCARRD, Los Banos, Philippines 8-10 October 1985, pp. 89-92 Chrisnawati, Nasrun & Triiwidodo, A 2009, ‘Pengendalian Penyakit Layu Bakteri Nilam Menggunakan Bacillus spp dan Pseudomonas fluoresen’ Jurnal Penelitian Tanaman Industri, Bogor, vol. 15, pp. 116-123 Compant, S, Reiter, B, Sessitsch, A, Nowak, J, Clement, C, & Ait Barka, E 2005, ‘Endophytic colonization of Vitis vinifera L. by a plant growth-promoting bacterium, Burkholderia sp . strain PsJN, Appl. Environ. Microbiol, vol. 71, pp. 1685-1693 Duriat, A, S 2009, ‘Pengendalian Penyakit Kuning Keriting Pada Tanaman Cabai Kecil, Balai Penelitian Tanaman Sayuran, Bandung, vol. 5, pp. 43-45 Fegan, M, & Prior, P 2005, ‘How complex is the “Ralstonia solanacearum species complex” in, Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex, American Phytopathological Society, St, Paul, MN, pp. 449-461 Gunawan, O, S 1995, ‘Pengaruh mikroorganisme antagonis dalam mengendalikan bakteri layu Pseudomonas solanacearum pada tanaman kentang, Risalah Kongres Nasional dan Seminar Ilmiah PFI XII, Mataram, pp. 473−479 Marwiyah, 2009, ‘Komposisi media produksi Pseudomonas stutzeri dan Bacillus sp. LTS40 dan formulasinya untuk agen biokontrol pada tambak udang, (Tesis) Bogor, IPB Mulya, K, Supriadi, E,M, Ardhi, S, Rahayu, & N, Karyani 2000, ‘Potensi bakteri antagonis dalam menekan perkembangan penyakit layu bakteri jahe, Jurnal Penelitian Tanaman Industri, vol. 6, pp. 37−43 Nasrun & Y, Nuryani 2007, ‘Penyakit Layu Bakteri Pada Nilam Dan Strategi Pengendaliannya, Jurnal Litbang Pertanian, vol. 26, pp. 25-31 Premono, E, M 1998, ‘Mikroba Pelarut Fosfat untuk Mengefisienkan Pupuk Fosfat dan Prospeknya di Indonesia (Enhancement of Phosphate-Fertilizer Efficiency by Phosphate Solubilizing Microbes and Its Prospect in Indonesia), Hayati, vol. 5, pp. 89-94 Schippers, B, B, Lugtenberg, & P, J, Weisbeek 1987, ‘Plant Growth Control by Pseudomonas fluorescent, Innovative Approaches to Plant Disease Control, pp. 30-34 Sumardiyono, C, S, M, Widyastuti, & Y, Assi 2001, ‘Pengimbasan ketahanan pisang terhadap penyakit layu Fusarium dengan Pseudomonas fluorescens, Prosiding Kongres XVI dan Seminar Nasional Perhimpunan Fitopatologi Indonesia, Bogor, pp. 257-259 EFFECT OF EXPLANT TYPES AND PLANT GROWTH REGULATORS IN IN-VITRO CULTURE OF PINANGA ARINASAE Made Pharmawati pharmawati@hotmail.com Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia I Made Anom Sutrisna Wijaya anomsw@yahoo.com Department of Agricultural Engeenering, Faculty of Agricultural Technology, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract Palem nyabah (Pinanga arinasae J.R.Witono) is endemic plant at Batukahu Natural Reserve, Bali. Conservation of this species is important to maintain ecological function of forest. The population of P. arinasae at Bukit tapak is limited. To avoid lost of germplasm, the availability of seedlings is needed. One method to generate seedling is using in-vitro plant culture. This resersch aimed to evaluate explant type suitable for in-vitro culture of palem nyabah. Leaf, petiole, mature and immature zigotic embrio were used as explants in MS medium supplemented by plant growth regulators. Results show that explants from leaf and petiole did not show any growth in all plant hormone combinations tested. The used of immature zygotic embrio as explant was the best explant type since there was cell division occurred and the explant became bigger. Moreover, root formation and shoot initiation were observed after 16 weeks of culture when using immature zygotic embryo as explant. Keywords: explant type, Pinanga arinasae, in-vitro culture 1 INTRODUCTION Batukahu Natural Reserve is located at Candikuning Village, Tabanan District, and Asah Munduk Village, Buleleng District, Bali Province (BKSDA Bali 2009). Two of unique plants and classified as endangered plants in this area are Podocarpus imbricatus Blume and Pinanga arinasae J.R. Witono (BKSDA Bali 2009). Pinanga arinasae is endemic Pinanga of Bali and can only be found at Bukit Tapak in Batukahu Natural Reserve (Witono et al. 2002). This indigenous biodiversity need to be conserved. One technique in plant multiplication is plant tissue culture. This technique is a vegetative plant propagation technique, therefore plants resulted from this technique have same characteristics to mother plants. However, mutation can occur during cell division in medium containing high concentration of nutrient and growth regulators (Taji et al. 1997). Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 188 Asea Uninet Scientific and Plenary Meeting 2016 | 189 The advantages of tissue culture technique include rapid multiplication, genetic improvement and disease free seedling (Taji et al. 1997). Plant growth regulators are important factors in development of culture. Auxin and cytokinin are significantly contribute in manipulating culture. Auxin stimulates cell elongation and growth, stimulate cell division especially in callus formation and development of adventitive root (Taji et al. 1997; Smith 2012). Cytokinin has effects on enlargement of tissue, development of axilary shoot and adventitive shoot and support cell division. The function of cytokinin in development of axilary shoot trough apical dominan is important in plant tissue culture (Taji et al. 1997; Smith, 2012). Other factor that influence the success of plant tissue culture is type of explant. In woody plant commonly the explants uses are stem or nodal segments such as in citrus (Marin & Duran-Vila 1991), and walnut (Pijut 1994). Based on the background above, this research was conducted to determine the best explant and composition plant growth regulators type in tissue culture of P. arinasae. 2 MATERIAL AND METHODS Sample collection of leaves and fruits of P. arinasae was done at Bukit Tapak, Bali. Unexpanded leaf, petiole, immature embryo and mature embryo were used as explant. Initial sterilisation of explants was done by soaking leaf, petiole and fruit in fungicide for 15 minutes and 70% ethanol for 2 minutes. Explants were then transferred to 50% bleach for 10 minutes, followed by 20% bleach for 10 minutes. After that, explants were rinse twice in sterile water. Leaves were cut 1 cm x 1 cm in aseptic condition in laminar air flow, while petioles were cut 1 cm long. Fruits were excised, and embryos were used as explant. Tissue culture medium (pH 5.6) consisted of 8% agar, 4.4 g/L Murashige and Skoog with vitamin, 30g/L sugar and plant growth regulators. The medium was added by 0.2% activated charcoal and 20 ml was pour into culture bottle. The addition of active charcoal was reported to significantly improve growth of explant of P. arinasae (Arpiwi & Pharmawati 2014). Medium was autoclaved for 20 minutes. The composition of plant growth regulator used is shown in Table 1. The selection of plant growth regulators and their concentration was based on Sharma & Nautiyal (2009). Table 1. Composition of Plant Growth Regulator Used in This Study Code A B 3 2,4-D 3 NAA 3 Plant Growth Regulator (ppm) IBA IAA 1 1 BAP 1 0.5 RESULTS AND DISCUSSION Several sources of explant were studied in this experiment including young and unopened leaf, leaf petiole, immature embryo and mature embryo of P. arinasae. Six week after culture, there was no changes in culture using leaf and petiole explants in the two medium tested. Same condition was observed when mature embryo was used. When immature embryo was used as explant, embryo enlargement occur after six weeks (Figure 1). The percentage of explant enlargement in medium A and medium B were 70% and 100% respectively. In other palm species, such as in coconut, the swelling of immature embryos explant was observed after 2 weeks culture (Karunaratne & Periyapperuna 1990). 190 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 1. Six weeks culture of immature zgotik embryo on medium A. A=Explant that has not enlarged B=enlarged Explan After 16 weeks culture, compact callus and roots were observed in medium A which consisted of 3 ppm 2,4-D, 1 ppm IBA, and 1 ppm BAP (Figure 2A). According to Ikeuchi et al. (2013) this callus is classified as compact callus with partial organ regeneration. The effect of IBA as stimulator of root formation has been reported in woody plant Taxus wallichiana however at higher range of concentration which was 3.5 ppm – 9 ppm (Hussain et al. 2013). In medium A, embryo enlargement reached 70% and 57% of them developed root. Shoot initiation also occurred in this medium (Figure 2A) Medium B did not contain 2,4-D, but 3 ppm NAA, 1 ppm IBA and 0.5 ppm BAP. NAA and IBA are plant growth regulator for root induction (Nandagopal & Kumari 2007). However, in this study, using this combination, no root formation was observed (Figure 2B). Medium B did not stimulate good growth and development. From 100% explant enlargement at 6 week culture, only 20% continue to enlarge while the rest of them turned brown. In culture of Arbutus andrachne tree, rooting failed on medium containing indole-3-acetic acid (IAA), 0.25 or 0.5 mg l-1 indole-3-butyric acid IBA), or 0.25, 0.5 or 2.0 mg l-1 a-naphthaleneacetic acid (NAA) (Kadhimi et al. 2014). Figure 2. Explant enlargement of immature embryo and root formation at 16 weeks culture. Culture in medium with 3 ppm 2.D, 1 ppm IBA and 1 ppm BAP (A). Arrow shows development of root. Culture in medium with 3 ppm NAA, 1 ppm IBA and 0.5 ppm BAP (B) Four variables affected the success of tissue culture are genotipe, source of explant, culture duration and culture condition (Kaeppler et al. 2000, ). In tissue culture of P. arinasae, leaf, petiole and mature embryo were not sitable as explants. Similar results was reported in tissue culture of palm oil. The used of leaf explant in palm oil culture, resulted in no growht and development (Siswanto 2006). Abahmane (2013) reported that explant used in Asea Uninet Scientific and Plenary Meeting 2016 | 191 palm tissue culture was newly emerge inflorescence, such as in tissue culture of date palm (Phoenix dactylifera L.) (Adul-Soad & Mahdi, 2010). The used of infloresence for callus induction has advantages such as does not damage donor plant and immature inflorescence is cover by sheath to prevent fungi and bacteria infection as well as avoid destruction of cell during explant sterilization (Sidky & Eldawyati, 2012). Inflorescence was also used as explant in callogenesis of coconut (Cocos nucifera L.) (Verdeil et al. 1994) and oil palm (Elaeis guineensis Jacq) (Guedes et al. 2011). Concentration and types of plant growth regulator are important factors in callogenesis and organogenesis. The widely used plant growth regulator for callus formation is 2,4-D (Smith 2000). Concentration of plant growth regulators vary for each plant species and explants used. In bottle palm callus formed in medium MS 1 ppm 2,4-D and 1,3 ppm GA3 (Tillaar 2000). In coconut, the plant growth regulators composition to induce callus was medium MS and 20 – 30 ppm 2,4-D and active charcoal (Sugimura & Salvana 1989). In this study, using two different compositions of plant growth regulators, at 6 week culture only explant enlargement occurred. In a research by Maciel et al. (2010) in immature zygotic embryo culture of peach palm, after 41 days, intumescence was formed at mesocotyl area. In P. arinasae, after 16 weeks culture, explant enlargement and elongation occurred. At medium with 2,4 D and other auxin and cytokinin (medium A), shoot and root emerged. According to Pretova & Obert (2003) in embryo culture there was additional mitosis activity, therefore the change occurred was embryo enlargement. Plant growth regulator 2,4-D was reported to cause transition between callus formation and germination (Bronsema et al. 2001). In embryo culture of palm oil, it was reported that the addition of 2,4-D stimulated morphogenic response of flower bud (Teixeira et al. 1994). ACKNOWLEDGEMENT The authors thank Directorate of Higher Education, Republic of Indonesia for research funding. REFERENCES Abahmane, L 2013, ‘Recent achievements in date palm (Phoenix dactylifera L.) micropropagation from inflorescence tissues’, Emirate Journal of Food and Agriculture, Vol. 25, pp. 863-874 Abul-Soad, AA & Mahdi, SM 2010, ‘Commercial Production of Tissue Culture Date Palm (Phoenix dactylifera L.) by Inflorescence Technique’, Journal of Genetic Engineering and Biotechnology, Vol. 8, pp. 39-44 Arpiwi, NL & Pharmawati, M. 2014, ‘Induksi kalus pelm nyabah (Pinanga arinasae JR Witono) secara in vitro’, Proseding Seminar Nasinal Sains dan Teknologi, Universitas Udayana BKSDA-Bali 2009, Cagar Alam Batukahu. Balai Konservasi Sumberdaya Alam, Bali. Departemen Kehutanan, Bali Bronsema, FBF, van Oostveen, WJF, van Lammeren, AAM 2001, ‘Influence of 2,4-D, TIBA and 3,5-D on the growth response of cultured maize embryos’, Plant Cell, Tissue and Organ Culture, Vol. 65, pp. 45-56 Guedes, RDS, da Silva, TL, Luis, ZG, & Scherwinski-Pereira, E 2011, ‘Initial Requirements for Embryonic Calluses Initiation in Thin Cell Layers Explants from Immature Female Oil Palm Inflorescences’, African Journal of Biotechnology, Vol. 10, pp. 10774-10780 192 | Asea Uninet Scientific and Plenary Meeting 2016 Hussain, A, Qarshi, IA, Nazir, H, Ullah, I, Rashid, M, & Shinwari, ZK 2013, In vitro callogenesis and organogenesis in Taxus wallichiana Zucc. The Himalayan yew, Pakistan Journal of Botany, Vol. 45, pp. 1755-1759 Ikeuchi M, Sugimoto K, & Iwase A 2013, ‘Plant callus: mechanisms of induction and repression’, Plant Cell, Vol. 25, pp. 3159-73 Kadhimi, AA, Alhasnawi, AN, Mohamad, A, Yusoff, WMW, & Zain, CRBCM 2014, ‘Tissue culture and some of the factors affecting them and the micropropagation of strawberry’, Life Science Journal, Vol. 11, pp. 484493 Kaeppler, SM, Kaeppler, HF, & Rhee, Y 2000, ‘Epigenetic sspects of Somaclonal variation in plants’, Plant Molecular Biology, Vol. 43, pp. 179-188 Karunaratne, S & Periyapperuma, K 1990, ‘Culture of immature embryos of coconut Cocos nucifera L.: callus proliferation and somatic embryogenesis’, Cocos, Vol. 8, pp: 13-22 Maciel, AS, Fermino Junior, PCP, Silva, RA, & Scherwinski-Pereira, JE 2010, ‘Morphoanatomical characterization of embryogenic calluses from immature zygotic embryo of peach palm during somatic embryogenesis’, Acta Scientiarum, Vo. 32, pp. 263-267 Marin, ML & Duran-Vila, N 1991, ‘Conservation of Citrus Germplasm in Vitro’, Journal of American Society of Horticultural Science, Vol. 116, pp.740-746 Nandagopal, S & Kumari, BDR 2007, ‘Phytochemical and antibacterial studies of chicory (Cichoriumintybus L.) - a multipurpose medicinal plant’, Advances in Biological Research, Vol. 1. Pp. 17-21 Pijut, PM 1994, ‘Micropropagation of butternut, Juglans cinerea’, HortScience, Vol. 29 pp. 431 Pretova, A & Obert, B 2003, ‘Plax (Linum usitatisimum L.) – a plant system to study embrogenesis’. Acta Biologica Cracoviensia Series Botanica, Vol. 45, pp. 15-18 Sharma, G & Nautiyal, AR 2009, ‘Influence of explants type and plant growth regulators on In vitro multiple shoots regeneration of a Laurel from Himalaya’, Nature and Science, Vol. 7, pp 1-7 Sidky, RA & Eldawyati, MM 2012, ‘Proliferation of female inflorescence explants of date palm’, Annals of Agricultural Sciences, Vol. 57, pp. 161-165 Siswanto 2006, Sterilisasi dan Induksi Kalus Daun Kelapa Sawit Secara In Vitro. Skripsi, Jurusan Agronomi, Fakultas Pertanian, Universitas Muhamadiyah, Yogyakarta Smith, R 2012, Plant tissue culture: techniques and experiments, San Diego: Academic Press. Sugimura, Y & Salvaña, MJ 1989, ‘Induction and growth of callus derived from rachilla explants of young inflorescences of coconut palm’, Canadian Journal of Botany, Vol. 67, pp. 272-274 Taji, A, Dodd, W, & Williams, RR 1997, Plant tissue culture practice. Armidale, NSW: University of New England Teixeira, JB, Söndahl, MR, & Kirby, EG 1994, ‘Somatic embryogenesis from immature inflorescences of oil palm’, Plant Cell Reports, Vol. 13, pp. 247-250 Tillaar, W 2000. ‘Pelestarian palm botol melalui kultur in vitro. Agrotrop. Vol. 1, pp. 1-5 Verdeil, JL, Huet, C, Grosdemange, F, & Buffard-Morel, J 1994, ‘Plant regeneration from cultured immature inflorescences of coconut (Cocos nucifera L): evidence for somatic embryogenesis’, Plant and Cell Report, Vol. 13, pp. 218-221 Witono, JR, Mogea, JP, & Somadikarta, S 2002, ‘Pinanga in Java and Bali’, Palms, Vol. 46, pp. 193–202 IN SEARCH FOR JATROPHA CURCAS L. GENOTYPES SUITABLE FOR DRY LAND AREAS Ida Ayu Astarini idaastarini@yahoo.com* Made Pharmawati pharmawati@yahoo.com Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Bali, Indonesia Edi Purlani Bambang Heliyanto bheliyant@gmail.com Indonesian Sweeten and Fiber Crops Research Institute (ISFCRI), Indonesia Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract This study aims to identify potential Jatropha genotypes that able to grow in dryland areas, to be used for alternative bioenergy source such as biofuel and biodiesel. The project was carried out at Asembagus Experimental Field Station, Situbondo, East Java, Indonesia. Thirty six accession collections from eastern part of Indonesia were chosen for drought trial. Cuttings, 40 cm length and 1.5 cm in diameter were planted in 35 cm diameter pot and watered every morning. Ten weeks later, all accessions were exposed to four water regime treatments, i.e. 20 – 39%, 40 – 59%, 60 – 79% and 80 – 100% of field capacity with three replicates each treatment. Plant height, number of leaves, flower initiation time, and plant performance were observed every week until 26 weeks. Number of stomata was counted at 12 weeks after treatment. Results show that each accession has different response to water stress. A number of accessions have good adaptability in limited water supply, including accession no 26 which has the best vegetative growth; accession no 8, 14, 18, 19, 30, 35 and 36 that able to produce fruit at the end of the observation time. Accession 34 was not adapted to drought. Keywords: jarak pagar, biodiesel, biofuel, drought tolerance 1 INTRODUCTION Fossil fuels consumption around the worlds and particularly in Indonesia is very high (Suryana, 2007). In contrast, fossil fuels supplies are decreasing. Increasing fossil fuels price in the International market will increase Indonesia budget since the amount of government subsidies would increase, while reducing fuel subsidy would give significant impact for the community, such as increase in retail prices and industrial sector would Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 193 194 | Asea Uninet Scientific and Plenary Meeting 2016 stagnant (Hasnam, 2007). Strategic plan should be taken, including development of renewable energy as an alternative source for fuel. In the effort to advance bioenergy in the country, Indonesian government has issued Presidential Regulation No. 5, Year 2006 about National Energy Policy. One of the targets is to reach more than 5% national bioenergy consumption in the year 2025 (Hamdi, 2006). Green bioenergy to replace solar and crude oil can be produce from a number of renewable sources such as vegetable oil (Canola, Brassica napus) (Riley, 2004), palm oil, coconut oil, sorghum, sugar cane, and the most popular source in Indonesia currently is Jatropha curcas (Prihandana and Hendroko, 2006). The advantages of Jatropha curcas compared to other plant sources are there is no competition with other uses, such as palm oil for cooking oil (Prastowo, 2007). Producing biofuel from local plants will give benefit in reducing dependency to fossil fuel, increase income from farming sector and open up work opportunity as well as environmentally friendly (Timnas BBN, 2007). In accordance to vision and mission on estate development and considering the prospect, commodity potency and opportunity, development of Jatropha in Indonesia was aim toward maximizing neglected land and marginal land, which are usually dry land with limited rainfall (Suryana, 2007). Therefore, it is necessary to develop Jatropha plantation that withstand and able to produce fruits with high content of oil. Puslitbangbun (Indonesian Research Centre for Estate Plants) and Balittas (Indonesian Sweeten and Fiber Crops Research Institute, ISFCRI) were given mandatory to focus on Jatropha research. This two institutes has explored genetic materials of Jatropha curcas from Indonesia, and planted at three main research station, Kebun Induk Jarak Pagar Asembagus, Situbondo, East Java (for dry climate), Kebun Induk Jarak Pagar Muktiharjo, Pati, Centre Java (for mild climate) and Kebun Induk Jarak Pagar Pakuwon, Sukabumi, West Jawa (for wet climate). Evaluation of all the accession has resulted in three selected population with productivity around 4-5 ton per ha. However, selected population can only be achieved at a good cultural practice (Mulyani et al, 2006). Therefore, in practice, only farmers with big capital (investor) that able to reach maximal productivity of selected Jatropha accession, while ordinary farmers would not get the benefit as they only practice low input with limited rainfall (400 – 600 mm per year). Successful breeding program will depend on validity of selection criteria being used. A number of characters that highly correlate with seed productivity of Jatropha are: proportion of male and female flowers on each inflorescence, number of inflorescence per plant, number of fruit per inflorescence, number of inflorescence per branch, number of seed per capsule and number of reproductive branch (Hasnam, 2007). The aim of this research is to identify Jatropha germplasms that are well adapted to dry land areas. Long term goal is to obtain superior varieties to support the development of energy alternative in Indonesia. 2 METHOD Field-pot trial to select drought tolerance accession of Jatropha curcas was carried out at Indonesian Sweeten and Fiber Crops Research Institute (ISFCRI) at Asem Bagus District, Situbondo Regency, East Java. Jatropha curcas seed from 34 accession and 2 selected clones (IP 1A and IP 2A) were planted in 35 cm diameter pot. Accession was collected from dry land areas of Eastern part of Indonesia including West Nusa Tenggara, East Nusa Tenggara, South Sulawesi and East Java. Media consists of soil and cow manure (13:1). Asea Uninet Scientific and Plenary Meeting 2016 | 195 Both soil and cow manure was screened before mixing to obtain homogenized media texture. Jatropha cutting were used as plant materials. Same size of cutting were chosen, with ± 1.5 cm diameter and ± 40 cm height. The tip of the cutting were cover with plastic to avoid standing water that can cause fungi or bacteria infection. Watering was done every morning between 7 – 9 am. Pots were place in the open areas without shade to make sure plants obtain full sunlight to maximize growth. Screening for drought tolerance was started when cuttings exhibited healthy grows, shown by having 2 branches and plant heigh around 90 – 110 cm, which was around 10 weeks after planting. Cuttings were exposed to 4 different levels of water stress, i.e. 80 – 100%, 60 – 79%, 40 – 59% and 20 – 39% from field capacity. Randomized completely block design were use in this experiment, with three replicates for each treatment, and two sub unit each replicate. Soil water level on each pot was measure every morning using gypsum block. In each pot, cylindrical gypsum block, with dimension of 3 cm diameter and 5 cm length, was planted and connected with 30 cm length cable/filament. To measure media water level, cable from gypsum block was connected to gypsum meter and the water level will shows on the monitor. Based on the water level measured, water was then added as needed until the gypsum meter shows the water level according to the treatment. Water regime treatment was done for 4 months (16 weeks) during dry season. Observation was done every week, including plant height, number of primarily branches and secondary branches, number of leaves, time of first flowering, percentages/proportion of male and female flowers. 3 FINDINGS AND DISCUSSIONS Results shows that there are variation observed among cultivars after four months observation on vegetatif and generatif growth. Details observation as follows: 3.1 Plant height and number of leaves Plant height at the end of observation period (26 weeks after planting, WAP), shows variation among accession. Plant height on treatment 80-100% water regime ranging from 35 cm (accession no 1 and 21) to 62 cm (accession no 7) showing accession 1 and 21 has slow growth, while accesion 7 has fast growth in good water supply. Each accession shows different response to water regime treatments. Accession no. 4, 13, 30 shows sharp decrease in plant height with decrease of water supply (Table 1). According to Sarvestani and Pirdasthi (2008), water stress significantly affect plant height. Decrease in plant height can be due to inhibition on cell elongation or inhibition to cell division due to limited water availability. Other accession such as accession no 1, 3, 17, and 26 did not affected by water stress and has the same plant height or event taller than control plants (plants that were given 100% water). The results shows those accession able to adapt on dry environment. Observation on number of leaves also shows a similar trend with plant height. Each accession has a different response to water regime, as revealed by different number of leaves. There was a positive correlation between plant height and number of leaves, in which the taller the plants, the more leaves they have. It is presumable that accession with drought tolerance has stable plant height and a lot of leaves, has high vegetative biomass a. Lots of leaves means bettern photosynthesis (Germ et al., 2005) 196 | Asea Uninet Scientific and Plenary Meeting 2016 3.2 Number of branches Observation on number of primary and secondary branch do not shows significant differences among cultivars, after treatment with drought level. Every accession has in average 3 primary branches. A number of accessions did not produced secondary branches, such as accession no 19, 20, 22 and 31. This is may be due to the specific characteristics of those accessions. Accession no 2 and 33 have a lot of branch, which is a preferable characteristic for selection in Jatropha. The more branches on each plant, the more flowers will be produced and ultimately the more fruit will be produced. 3.3 Flowering time and proportion of male and female flowers Jatropha accession produced by cutting were started to flower at 10 WAP. Flowering times varied between cultivars and between treatments. Plants on control treatments (given 80100% water supply) in general shows the earliest flowering time compared to plants treated with lower water level. Accesion no 3, 4, 6, 10, 15 and 36, water regime treatment causing plants to flower earlier compared to optimum water supply (Table 1). Earlier flowering time is a mechanism for plants to survive. 3.4 Plant vigor Observation on plant vigor was done with scoring from 1 – 4. Score 1 shows plants are dying, score 2 shows plants are weak or slender, short and low number of leaves, score 3 means healthy plants, many branch and many leaves, score 4 shows healthy plants, tall with many branches and many leaves. In general, Jatropha accession shows decreasing score with increasing water stress treatment (Table 1). This shows that Jatropha plants needed plenty of water to grow and develop. Accession 14 and 35 shows healthy plants grow on all water regime treatments. Table 1. Average plant height, number of leaves, number of branches, first flowering time and vigor score of each accession of Jatropha curcas, exposed to different treatment of water regime, 26 weeks after planting. Accessi on no Water regime No. of leaves No. of branch 1 80-100% 60-79% 40-59% 20-39% 35.2 35.2 31.3 38.8 18.1 35.2 31.3 38.8 3.0 2.7 2.3 3.0 18.3 17 Not yet 16 3.5 3 2 3 2 80-100% 60-79% 40-59% 20-39% 56.8 50.0 48.2 46.0 29.4 50.0 48.2 46.0 3.3 2.7 3.0 3.3 17 15.5 16.5 15.5 4 3.5 3 2 3 80-100% 60-79% 40-59% 20-39% 44.5 42.2 40.7 40.3 23.8 42.2 40.7 40.3 3.3 3.0 3.3 2.7 17 16.3 16 18 3 3 3 2.5 Plant height (cm) Flowering time (WAP) Vigor score Asea Uninet Scientific and Plenary Meeting 2016 4 80-100% 60-79% 40-59% 20-39% 53.2 40.0 37.3 34.0 28.6 40.0 37.3 34.0 2.3 3.3 4.3 2.7 17 19 Not yet 22 3.5 3 1.5 1 5 80-100% 60-79% 40-59% 20-39% 41.8 38.5 32.2 33.2 23.4 38.5 32.2 33.2 3.0 3.3 3.0 3.0 16 Not yet Not yet 16 3 2.5 1 1.5 6 80-100% 60-79% 40-59% 20-39% 54.0 37.0 42.2 35.0 30.0 37.0 42.2 35.0 3.0 3.0 3.7 3.7 18 19 20.5 20 4 3 3 1.5 7 80-100% 60-79% 40-59% 20-39% 62.2 47.5 38.1 38.7 34.6 47.5 38.1 38.7 3.0 3.0 3.0 3.0 17.3 15 17 Not yet 3.5 3 2 2 8 80-100% 60-79% 40-59% 20-39% 51.8 42.2 38.8 40.7 29.9 42.2 38.8 40.7 3.3 2.3 3.0 3.7 18.5 17 Not yet 18 3.5 2.5 2.5 2.5 9 80-100% 60-79% 40-59% 20-39% 49.5 45.2 42.7 30.0 29.3 45.2 42.7 30.0 3.3 3.0 2.0 2.3 16.33333 19 15 Not yet 3 3.5 2.5 2 10 80-100% 60-79% 40-59% 20-39% 41.0 38.0 36.3 38.7 25.5 38.0 36.3 38.7 2.7 3.0 3.3 2.0 16 15 16 18 3 2.5 2 2 11 80-100% 60-79% 40-59% 20-39% 49.5 34.3 38.5 38.2 30.3 34.3 38.5 38.2 3.0 3.0 3.7 3.3 18.3 15 19 15 3.5 2 2.5 3 12 80-100% 60-79% 40-59% 20-39% 39.5 36.7 32.0 33.9 25.8 36.7 32.0 33.9 3.0 3.0 3.3 3.0 15.5 15.5 15.3 15 2.5 2.5 2 1.5 13 80-100% 60-79% 40-59% 44.7 39.7 38.3 28.8 39.7 38.3 2.3 2.3 2.7 16.3 16.3 18 3 2.5 1.5 | 197 198 | Asea Uninet Scientific and Plenary Meeting 2016 20-39% 31.0 31.0 2.3 17 2 14 80-100% 60-79% 40-59% 20-39% 52.0 49.7 43.3 49.2 33.0 49.7 43.3 49.2 2.7 2.7 3.0 3.0 17 21 19.5 18 4 4 3 3.5 15 80-100% 60-79% 40-59% 20-39% 51.5 37.3 35.7 40.0 33.3 37.3 35.7 40.0 3.3 2.7 3.3 3.0 18 19 16 21 3.5 3.5 2.5 1.5 16 80-100% 60-79% 40-59% 20-39% 52.8 36.2 40.3 38.0 34.4 36.2 40.3 38.0 2.7 3.0 3.3 2.7 15.5 16 20 Not yet 3 2.5 2.5 2 17 80-100% 60-79% 40-59% 20-39% 39.0 41.8 43.2 36.3 28.0 41.8 43.2 36.3 2.7 3.0 3.3 2.7 17 18 21 Not yet 3 3 3.5 2.5 18 80-100% 60-79% 40-59% 20-39% 44.0 35.5 36.0 35.0 31.0 35.5 36.0 35.0 2.7 3.3 3.0 3.0 16 Not yet Not yet 17 2.5 2 2 2.5 19 80-100% 60-79% 40-59% 20-39% 39.7 32.8 38.8 32.0 29.3 32.8 38.8 32.0 4.0 3.0 3.0 3.3 18.3 Not yet 16.5 17 3 2 2 2 20 80-100% 60-79% 40-59% 20-39% 40.7 35.2 31.7 39.7 30.3 35.2 31.7 39.7 3.0 2.7 2.7 3.0 19.3 17 16 16 3 1.5 2 2.5 21 80-100% 60-79% 40-59% 20-39% 35.3 31.3 26.2 32.3 28.2 31.3 26.2 32.3 3.3 3.3 2.7 3.7 15 16 16 Not yet 2.5 2 2 2 22 80-100% 60-79% 40-59% 20-39% 43.2 31.4 32.0 30.3 32.6 31.4 32.0 30.3 3.0 3.0 3.3 2.3 17 19 15 Not yet 3 2.5 2 1 23 80-100% 51.2 37.1 3.7 17.7 3.5 Asea Uninet Scientific and Plenary Meeting 2016 60-79% 40-59% 20-39% 38.3 39.7 41.0 38.3 39.7 41.0 3.0 3.0 3.0 16 20 16 3.5 2.5 2 24 80-100% 60-79% 40-59% 20-39% 40.7 36.0 31.7 35.0 32.3 36.0 31.7 35.0 3.7 2.3 3.0 2.3 17 15 17 16 3 2.5 2 1.5 25 80-100% 60-79% 40-59% 20-39% 38.3 44.7 37.5 32.2 31.7 44.7 37.5 32.2 3.0 3.0 3.0 3.3 18.5 17.5 23 Not yet 2.5 2.5 2.5 3 26 80-100% 60-79% 40-59% 20-39% 44.8 39.5 42.7 35.3 35.4 39.5 42.7 35.3 2.7 3.0 4.0 3.0 18.7 18 23 20.5 3 3 2.5 2.5 27 80-100% 60-79% 40-59% 20-39% 42.2 38.0 41.3 39.7 34.6 38.0 41.3 39.7 3.0 3.3 3.3 3.0 17.3 18.5 17.5 16 2.5 2 2.5 1.5 28 80-100% 60-79% 40-59% 20-39% 39.5 40.3 37.7 34.8 33.8 40.3 37.7 34.8 3.0 3.7 3.3 3.3 16.7 16 15 Not yet 3.5 3 2.5 2 29 80-100% 60-79% 40-59% 20-39% 36.8 37.8 33.7 29.7 32.9 37.8 33.7 29.7 3.0 3.7 3.3 3.7 16 Not yet 16 Not yet 2.5 2.5 2.5 2 30 80-100% 60-79% 40-59% 20-39% 57.5 45.7 42.0 37.0 43.8 45.7 42.0 37.0 3.0 3.0 3.0 3.0 18 18.3 17.5 17.5 4 2.5 2.5 2.5 31 80-100% 60-79% 40-59% 20-39% 48.5 32.0 44.5 32.0 39.8 32.0 44.5 32.0 3.0 3.0 3.3 3.3 17.5 15 16.3 15 3.5 2.5 2.5 1.5 32 80-100% 60-79% 40-59% 20-39% 55.2 39.3 37.0 34.3 43.6 39.3 37.0 34.3 2.7 3.0 3.3 2.7 17 16 17.5 15 4 3 2.5 2 | 199 200 | Asea Uninet Scientific and Plenary Meeting 2016 33 80-100% 60-79% 40-59% 20-39% 41.5 36.0 43.0 34.5 37.3 36.0 43.0 34.5 3.7 3.7 3.0 3.7 15.3 16 23 15 2.5 3 3 2 34 80-100% 60-79% 40-59% 20-39% 38.0 33.8 28.3 25.7 36.0 33.8 28.3 25.7 2.7 2.0 1.3 4.0 17.5 17.5 19.5 16 2.5 1.5 1.5 0.55 35 80-100% 60-79% 40-59% 20-39% 42.3 36.0 40.0 33.2 38.7 36.0 40.0 33.2 3.3 3.3 3.3 3.0 16 15 15 15.3 3.5 2.5 3 3 36 80-100% 60-79% 40-59% 20-39% 40.7 48.2 41.0 38.3 38.3 48.2 41.0 38.3 3.3 3.0 2.7 2.7 16.3 15.5 16.5 23 3 1.5 2 2 4 CONCLUSIONS AND SUGGESTIONS It can be concluded that Jatropha accessions have varied response to water stress. Accession 8, 14, 18, 19, 30, 35 and 36 has good vigour. Accesion no 34 is very sensitive to water regime and cannot withstand water stress. Accession 26 has the best vegetative growth. Accession 2 and 33 has many branches with potential on producing many fruits. Accession 2, 26 and 33 could be used as parent line for breeding for drought tolerance plants. To evaluate performance of accession selected from current pot trials, it can be suggested to do a field trial in dryland region in Indonesia such as north part of Bali, West Nusa Tenggara and East Nusa Tenggara. ACKNOWLEDGEMENTS This research was supported by Indonesian Agency for Agricultural Research and Development, Ministry of Agriculture, Indonesia through KKP3T Grant. Thank you to Balittas Malang for the facility at Asembagus field station and providing Jatropha plant materials. REFERENCES Germ, M., Berčič, O.U., Ačko, D.K. (2005). The response of sunflower to acute disturbance in water availability. Acta Agriculturae Slovenica 85, 135–141. Hamdi, A. (2006). Ekonomi Jarak pagar. Pelayanan informasi jarak pagar nasional. http://www.jarakpagar.com. Hasnam. (2007). Status perbaikan dan penyediaan bahan tanaman jarak pagar (Jatropha curcas L.), In: Prosiding Lokakarya II: Status Teknologi Tanaman Jarak Pagar, Asea Uninet Scientific and Plenary Meeting 2016 | 201 Bogor, 29 Nopember 2006. Ed. Karmawati A dkk. 367 pp. Badan Litbang Pertanian. Mulyani, A., F. Agus dan D. Allelorung. (2006). Potensi Sumberdaya Lahan untuk Pengembangan Jarak Pagar (Jatropha curcas) di Indonesia. J. Litbang Pertanian. 25 (4) : 130-138 Prihandana, R dan R. Hendroko. (2006). Petunjuk Budidaya Jarak Pagar. Agro Media Pustaka, Jakarta. Riley, W. W. (2004). The Canadian Biodiesel Industry: an Analysis of Potential Feedstocks. Biodiesel Association of Canada. Sarvestani, Z. T. and H. Pirdasthi. (2008). Study of water sress effects in different growth stages on yield and yield components of different rice (Oryza sativa) cultivars. Pakistan Journal of Biological Sciences 1-7. Suryana, A. (2007). Pengembangan inovasi teknologi pertanian mendukung ketahanan pangan dan pengembangan bioenergi di Indonesia. Prosiding ekspose dan seminar nasional hasil penelitan dan pengkajian teknologi pertanian mendukung PENAS XII, Palembang, 10-11 Juli 2007. Timnas Nasional BBN. (2007). BBN, Bahan Bakar Nabati. Bahan Bakar aternatif dari tumbuhan sebagai pengganti minyak bumi dan gas, Eka Cipta Foundation, Jakarta. DISTRIBUTED CYBER PHYSICAL SYSTEMS Albert Treytl albert.treytl@donau-uni.ac.at Center for Integrated Sensor Systems, Danube University Krems, Austria Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract The combination of sensors, actuators and networked embedded systems as well as their ubiquitous deployment form distributed cyber physical systems (CPS) and further the Internet of Things (IoT). Challenges are, among others, sensing a complex environment, managing complex connectivity, power consumption, security and the utilization of the vast amount of data gathered by the system. The research focus on the Industrial Internet of Things (IIoT), where real-time behavior, robustness, latency and determinism are even more critical, since systems are possibly also affecting health and safety of humans and the environment. Systems must also be built to allow maintenance and updates even considering a life cycle of a system well beyond 10 years common in industrial contexts. The Center for Integrated Sensor Systems at Danube University and the Department of Computer Engineering Kasetsart University teamed up to investigate: a) synchronization concepts to deliver data in time in complex CPS. Multi-path clock synchronization, real-time control and data coordination should be investigated.b) robustness and flexibility by local and autonomous decision making. Concepts from big data analysis should be transformed to local decision making algorithms to allow CPS to act autonomously.Applications are manifold and range from Industry 4.0, automotive and telematics to environmental monitoring networks but also building automation. Keywords: distributed systems, cyber physical systems, sensor systems. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 202 MARITIME AFFAIRS . Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 203 REVITALIZATION OF FISHERMAN SOCIAL INSTITUTION IN THE SUSTAINABLE COASTAL MANAGEMENT R. Hamdani Harahap rhamdani@yahoo.com Abstract One of the important elements in sustainable development of coastal areas is the community participation and the decentralized management. The implementation of community participation in the development of marine and coastal area management is the community-based fishery resource management, which is realized by the social institutions. The social institutions in the maritime community have been degraded, causing massive damage to coastal and marine ecosystems, especially in the area of western Indonesia. The social institutions in the community-based management can be categorized into two groups, namely, Traditional and Neotraditional. This article will give a recommendation for revitalization of the existing social institutions (traditional), or create new institutions (Neotraditional) so that the sustainable management of marine and coastal ecosystems can be sustainably performed. Keywords : revitalization of social institution, community based coastal management, co-management, sustainability 1 INTRODUCTION People who live in coastal areas or what is often called coastal communities become an important part of the coastal ecosystem. The largest component of coastal communities is fisherman who has a great dependence on the sustainability of coastal natural resources. Fisherman is the person who fishes (makes aquaculture) in the sea and in a place that is still influenced by tides (Tarigan, 2000). Harahap (1992, 1993,1994) has conducted a series of studies related to the poverty of coastal communities in three villages on the East Coast of North Sumatra. The results of these studies indicated that the causes of their poverty were the cultural factors and resources degradation. Resources degradation such as the destruction of mangrove ecosystems and fisheries were partly caused by the use of destructive fishing equipment, the presence of illegal logging, and the land conversion into fishponds and oil palm plantations. Based on the specific condition and poverty which looks like a trade mark in the coastal communities, it is necessary to further understand the management of coastal areas. Regarding the management of coastal areas, according to Bromley and Cernea (in Adhuri, 2005) there are four types of ownership and authorization of these coastal resources such as : a. Open access property, b. Common property, c. Public property and d. private property, which also determine how management of coastal areas is conducted. In North Sulawesi, there are four types of ownership and authorization of the resources, but the most dominant type is the government-owned type, and in some places the type of quasi-private-owned is developing. In the coastal of Bunaken, fishermen community still considers fishery resources as the open access property so that fishermen from other places are allowed to fish. At Tumbak Village and Biongko Village, the community considers the fishery resources, mangrove and coral reefs lay in front of their Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 204 Asea Uninet Scientific and Plenary Meeting 2016 | 205 village belong to the communal property of the villages (Mancoro in Adhuri, 2005). However, the Law Regarding Indonesian Waters No. 6/1996 clearly states that the existing natural resources in the waters are owned by the government. In particular scale, the government allows the coastal communities to manage it. This causes an ambiguity (ambiguous) that on one side, the coast is considered to be owned by the communities, but on the other hand, it is considered government property. This ambiguity of ownership and authorization of coastal resources (ambiguity of property regimes) encourages the emergence of a conflict of authority (jurisdictional conflict) and conflicts of use (user conflict). These conflicts can arise from several causes, but the dominant cause is the ambiguity of ownership. Conflicts related to the authorization of marine natural resources often arise as for example in the case of Kei Islands, Southeast Maluku. (Adhuri, 2005). Adhuri stated in his writings that there were two challenges in the practice of a sustainable marine resources management; firstly, the awareness shown by the executants upon the importance of sustainable and equitable management was not seen by the stakeholders (including the military and local bureaucracy) in the area. Secondly, there was contestation among all groups associated with the use of marine resources. In this arena of contestation each group apparently tended to claim their special rights to the marine resources and denied the claims of other parties. 2 COMMUNITY BASED MANAGEMENT One of the important elements in sustainable development is the community participation and decentralized management. The implementation of community participation in the development of marine and coastal area management is the community-based management of fisheries resources. The community-based management of fisheries resources can be defined as a process of assignment of the authority, responsibility, and opportunity for communities to manage their own fishery resources by first defining needs and desires, goals and aspirations. (Nikijiluw, 2002). Two essential components of successful community-based management are: 1) 2) The clear consensus of the three main actors, namely the government, coastal communities, and researchers (social, economic, and resources) The in-depth understanding of each of the main actors of their roles and responsibilities in implementing community-based management program (Dahuri, 2003). Management or community-based development was initiated by Korten (1984), which proposed the theory that presents an important new potential in order to strengthen growth and human welfare, equity and sustainability of the development itself, called the Peoplecentered Development Theory. This theory states that the development process should be oriented towards improving the quality of human life, rather than on economic growth through the market as well as strengthening the state, the theory referred to as Alternative Development Theory. (Mardikanto and Soebianto, 2012). Moelyarto Tjokrowinoto (in Mardikato and Soebianto, 2012) gives the characteristics of people-centered development (human), namely: 1) 2) The initiative and decision-making process to meet the needs of society step by step should be put on the community itself. The main focus is to improve the community's ability to manage and mobilize the resources available in the community to fulfil their needs. 206 | Asea Uninet Scientific and Plenary Meeting 2016 3) 4) 5) This approach tolerates local variations and therefore, is flexible to adjust to local conditions. In carrying out development, this approach emphasizes the social learning process in which there are collaborative interactions between the bureaucracy and the community, from the project planning to evaluation with the foundation of learning from each other. The networking between the bureaucracy and non-governmental organizations, units of independent traditional organization, is an integral part of this approach, both to improve their ability to identify and manage various sources, as well as to maintain a balance between the vertical and horizontal structures. Through the networking process is expected a symbiosis between the structural development at the local level. In an outline, there are five basic principles that are important to be implemented in community-based management (LIPI COREMAP in Dahuri, 2003), namely: 1).empowerment, 2). equality of access and opportunity, 3). environmentally friendly and sustainable, 4). recognition of national knowledge and wisdom, and 5). gender equality. In practice, community-based management can be categorized into two groups, Traditional and Neotraditional (Dahuri, 2003). Traditional community-based management is generally based on customs and traditions established or have been in the society for a long time, for example Sasi in Maluku (Elikisia, 2000), the management of coastal waters at Tanjung Bararai Biak Village and Panglima Laot in Aceh (Nikijuluw, 2002). Sasi which has been implemented since approximately the 17th century has significance in the development of society and the preservation of coastal ecology. Sasi literally means "prohibition". This means that there are certain management rights on the territorial waters by a community around the waters, while communities outside the area are prohibited to conduct fishing activities in the area where Sasi is applied. The rules applied do not necessarily prohibit fishing outside to enter the territorial waters, but also prohibit the community with Sasi rights to operate. There are at least four things contained in the institutional Sasi, namely (1) the timing of the operation, (2) fishing regulation by species, (3) regulating based on fishing equipments, and (4) sanctions (Knight, 2015) Meanwhile, the presence of Neotraditional community based management was intentionally produced based on the new rules established by the community itself or facilitated by the government or NGOs. In some cases, programs that are the projects of community based management are only able to produce a pile of project reports that do not provide solutions to the problems of coastal communities that exist in the field. Essentially, community based management should be able to solve two major problems that have been publicly known, namely : 1). problems of biological resources (e.g., overfishing, fishing equipments which are not environmentally friendly, damage to ecosystems and conflicts between traditional fishermen and modern fishing industry, and 2). the environmental problems that affect the health of marine biodiversity (e.g. reduction in area of mangroves and sea grass beds as an enlarged area of fishery resources, deterioration of water quality, pollution, etc.). The community-based management can be accomplished if the local community is able to wisely use the potential of nature, culture and infrastructure. Therefore, the communities need to understand and to be aware of the potential and constraints related to the management of their marine resources. The community awareness and empowerment in the community-based resource management can be implemented through five levels, namely, 1) improving the welfare of the community by providing an alternative business that is economically profitable and does not damage the environment, 2) giving the public access to information about natural resources, markets, and law protection, 3) encouraging Asea Uninet Scientific and Plenary Meeting 2016 | 207 and enhancing the community of the meaning of the coastal / marine ecosystems conservation, 4) growing and increasing the community participation in protecting and conserving the coastal and marine ecosystems, and 5) increasing the ability of communities to manage and conserve marine ecosystems. In terms of its presence, the community-based resource management could be instituted through three ways (Fauzi, 2005), namely: 1) the government and the public recognize the practices of fishery resources management that have been performed by generations and are customs or cultures that have been embraced. 2) government and communities revive or revitalize the customs and culture of the community in managing the fishery resources. The customs and culture had probably been lost or no longer used because due to the change in times. However, the community and the government realize that the customs and cultures require revitalization because apparently the loss of customs and culture does not make the community more prosperous and happier. 3) The government gives full responsibility and authority to manage the resources to the community. The spirit of conducting community based management in Indonesia is now increasingly open along with the implementation of Law No. 6/2014 on Villages, which gives authority to villages to autonomously govern themselves, including giving room for villages in establishing customary regulations as the legal regulations. However, the implementation of this regulation still leaves some problems associated with the authority between the villages and the government unit above them, namely the sub-district, district and province. The current scope of authority is not clearly regulated. Even though if it is considered ideal, there are several variables that also determine the success of the community-based coastal resources management (Fauzi, 2005), namely: trust, written rules, technology, development of the fishing industry, change in government, trade, and price. Furthermore, Fauzi (2005) has identified some disadvantages and advantages of community-based coastal management. The disadvantages of the community-based coastal management are (1) it does not resolve the inter communal problems, (2) it is domestic, (3) it is easily influenced by external factors, 4) it is difficult to achieve economic scale and the high cost of institutionalization. Meanwhile, the advantages of community-based coastal management are (1) it is in accordance with the aspirations and the local culture, (2) it is received by the local community, (3) the supervision is easily done. Neotraditional of coastal resources management is one of which is undertaken by the government. The fishery resources management by the government is the resources management with the government the as holder of power and authority in the use of resources such as the access rights, the right to exploit, the rights to regulate, the exclusive rights, and the right to transfer. Jentoft (1989 in Fauzi, 2005) says that the government should get involved or interfere in the fishery resources management for the following three reasons: 1) 2) 3) The government manages fisheries resources for efficiency reasons. This refers to the participation of the government in managing fishery resources so that efficiency can be improved. The government involvement is in terms of controlling the fishing business so there will not be excessive capacity which ended in inefficiency. The government is involved in the fishery resources management so that justice can be realized. If the government does not get involved, the stronger and bigger fishermen will take excess benefits and leave the smaller fishermen in poverty. If the government does not make any efforts which are carried out affirmatively in helping small fishermen, the imbalance will continue. The government's involvement is needed in managing the fishery resources due to administrative reasons. On the other hand, the assumptions and the fact state 208 | Asea Uninet Scientific and Plenary Meeting 2016 that only the government has the right to run the administration with its authority and capacity. 3 GOVERNMENT-BASED MANAGEMENT MODEL In the next development, the role of government agencies in managing coastal and marine areas is very important in securing fishery resources management, particularly in developing fishery according to the demand and to the international standard. In some cases, however, government institutions have some weaknesses in managing fishery resources (Lawson in Fauzi, 2005) as follows: 1) 2) 3) 4) 5) 6) 7) 8) 4 Failing to prevent from the exploitation on fishery resources due to the delay in the implementation of the prevailing rules. Difficulty in upholding law enforcement. People’s ability and success in avoiding regulations. Inappropriate and unclear policy or conflicting policies. Inefficient administration in the form of relatively transaction high cost. Distributive authority in some institutions and departments. Incorrect and inaccurate data and information. Failing to formulate management decision. CO-MANAGEMENT MODEL Based on the management model above, both the community-based management regime and the government-based management have their own strengths and weaknesses. Therefore, the solution is by conducting the integration of both managements which is called management collaboration, or management cooperative or co-management. It is a division or distribution of responsibilities and authorities between the government and local community in managing fishery resources. One of the regimes in managing fishery resources which is considered as a comanagement regime is decentralization of authority and responsibility from the central government to regional governments. In the literature on public administration, decentralization vertically has four types: (1) de-concentration, entrusting authority and responsibility by the central government to government institutions or agencies in the regions or to the central government institutions located in the regions. (2) Delegation, entrusting some parts of the authority and the power to make decisions from the central government to regional institutions or to government staffs in the regions; although at any time the central government always has the right and authority to accept or reject any decision made in a certain region. (3) Devolution, entrusting special or specific authority and responsibility from the central government to the regional governments. (4) Privatization, entrusting the responsibility of certain tasks from the central government to non-government organizations (NGO), private voluntary organization (PVO), public organizations or associations, and private companies.1 See also Person, G.A. Diny M.E. van Est and Tessa Minter (2005) who wrote about decentralization in managing natural resources. Person et.al suggested that in the process of decentralization, the management of natural resources lead to the form of co-management. Asea Uninet Scientific and Plenary Meeting 2016 | 209 According to Pomeroy and Berkes (in Fauzi, 2005), there are ten levels or forms of co-management which can be arranged from the lowest public participation to the highest one. When public responsibility and authority are low in a certain form of comanagement, the government’s responsibility and authority will increase. On the other hand, when public responsibility and authority are high, the government’s responsibility and authority will decrease. The ten levels of co-management are as follows: 1) 2) 3) 4) 5) 6) 7) 8) 9) 10) Community only give information to the government and it is used as the material for management formula; Community are consulted by the government; Community and the government work together; Community and the government inter-communicate; Community and the government exchange information; Community and the government work together in providing advice and suggestion; Community and the government work together in any activities and in any joint-actions; Community and the government work as partners; Community control any government regulations; Community play more roles in coordinating among locations or among regions which are supported by the government. Besides the ten forms of co-management above, there is also the division of comanagement as follows: 1) 2) 3) 4) 5) Instructive co-management in which the government plays its important role and the community only receive what has been planned and arranged by the government; for example, co-management of general water supply in Bangladesh and co-management of Lake Caribbean in Zambia. Consultative co-management in which local people profoundly involved in the process of the implementation of management planning, but the government, through its staffs and agencies, still plays its vital role; for example, the management of Lake Malombe in Malawi and the management of San Miguel gulf in the Philippines. Cooperative co-management in which the community and the government play their role in balance, or the government and the other stakeholders work together in partnership relationship on the same level; for example, the management of Maritime and Island Protective Area San Salvador in the Philippines, Pacific Fishery Management Board in the U.S., Communal Right of Disposal, Fiji, and Middle Visayasa Fishery Development in the Philippines. Advocative co-management in which the government has little role while the community, through work groups, has bigger role, or the government only gives legal support to the demand or suggestions from fishermen; for example, Regulation of the Right time to Catch Fish in Denmark, Coastal Dragnet Fishery in Sri Lanka, and Fishery Provcessing Model in Queensland. Informative co-management in which the government has minimal role; it is only in the form of making agreement and cooperation with the community. The government’s involvement is only limited to village level; for example, Partial Fish Producers Organization in the Netherlands, Herring Fishery in 210 | Asea Uninet Scientific and Plenary Meeting 2016 Denmark, Coastal Dragnet Fishery in Mozambique, Coastal Fishery in Faroe Islands, and Maritime Protective Area in Apo Island, Negros, the Philippines. In managing coastal area collaboratively, the role of stakeholders is very important. Alikodra (2006) defined ‘stakeholder’ as individuals or groups that have high interest in resources of resources management. There is no strategy of resources management which is successful without asking the community to participate in their own interest. Claridge (1995 in Alikodra, 2006) points out that the stakeholders include: 1) 2) 3) 4) 5) Local community who directly use resources and local people who have direct interest in resources; Individuals or groups that legally have commercial activities in directly using resources and those who come to use resources which often causes the incidence of competition with local users; Companies which produce waste or cut off the link of life organism cycle; Suppliers and marketers who supply fuel and equipment related to the use of resources; and The government, Non-Government Organizations, naturalists or environmentalists, conservationists, and consumers who use products. Alikodra (2006) further presents some important items as a guideline in making evaluation on the characteristics of the success in managing collaboratively which can be seen by the existence of: 1) 2) 3) 4) 5) 6) 7) 8) The benefit of the integration between conservation and development which is recognized by the government and other stakeholders; The government actively supports and facilitates the involvement of local community in managing conservation-based natural resources; Stakeholders give their full attention to and participation in the conservation of natural resources and their environment; The managing of appropriate sharing (resources, information, position/capacity, and decision); Stakeholders fully understand and have mutual confidence building in each role transparently; The root of the problems is understood and agreed to be followed up; Clear benefit for the stakeholders; Stakeholders have adequate ability (skills, financial, and capability) as the most important requirements for perform the program sustainably. When co-management approach is related to issue of maritime axis(poros maritime), coastal community culture should be taken care of. Maritime axis (poros maritime) is an effort to change the mindset of the Indonesian people from land and air centric to maritime centric. The concept of maritime axis(poros maritime) is the government’s effort to make maritime as the connecting component among the islands; in consequence, all of its resources can be used for increasing people’s prosperity. It means that maritime become the anchor of economic development. Is the idea of maritime axis(poros maritime) appropriate with Indonesians? This question should be followed by the other questions: How is the maritime culture in Indonesia?, and does the mental of our coastal community which has been recorded in the history represent their characteristic as fishermen or sailors? Asea Uninet Scientific and Plenary Meeting 2016 | 211 In some historical literatures, it is said that the kingdoms that used to be victorious in the Indonesian archipelago were followed by their powerful army on the sea. This indicated that military strength on the sea became the specific characteristic of big kingdoms in the Indonesian archipelago. Another historical fact which can also be recorded is the image that maritime customary law throughout the archipelago still focuses on the use of sea as the trade/sailing channel. For example, maritime law in Serdang Monarchy (read Sinar and Wan Saifuddin, 2002) and Amanna Gappa law in Bugis Monarchy which becomes a legend. The track on the example of substance of the twocustomary laws above indicates that the main maritime spirit which is focused on sailing procedure, related to trade. There are not many facts which specifically describe the regulation of managing maritime and fishery resources for people’s welfare like whale hunt practiced by the people of Lamarera and Lamakera in West Nusa Tenggara and Sasi people in Maluku. Therefore, it is necessary to dig out and revitalize people’s cultural values which are related to the management of coastal areas in order to make coastal community prosperous and the idea of maritime axis(poros maritime) which is focused on the increase in coastal people’s prosperity can be realized. In terms of the above case for the management of coastal areas in North Sumatra, the social institutions in the management of coastal areas are no longer found such as “Jamu Laut” in the East and West coast. Furthermore, the presence of “Pawang Laut” also begins to slowly disappear. Even though Jamu Laut and Pawang Laut still exist, the function to conserve coastal and marine ecosystems have disappeared. Therefore, it is necessary to revitalize the role and function of the Pawang Laut and Jamu Laut in the management of marine coastal areas, which should have been initiated by all stakeholders, namely non-governmental organizations, community leaders, fishery businessmen, universities and government. Besides that, coastal area management has to be done in an integrated way (Integrated Coastal Management or ICM); a planning integration which keeps in balance economic and socio-cultural interest, natural resources conservation, and environment (Alikodra, 2006). ICM is management approach which leads to the use of coastal and maritime resources sustainably by integrating various sectoral planning, various governmental levels, and by integrating land ecosystem components and maritime ecosystem components, along with science and management. Sustainable development is “a development which can meet the need of the present generation without sacrificing the future generation in fulfilling their need” (Siregar, 2004). Sustainable development is an integrated approach to development which connects three pillars simultaneously: economic development, social development, and environmental protection. Sustainable development contains two important ideas; first, the idea of need, essential need which sustains human life; secondly, the idea of limitation which comes from technological condition and social organization for environmental ability in order to meet the need nowadays and in the future (Djajadiningrat and Famiola, 2004). Djajadiningrat and Famiola (2004) further point out that every sustainable development element is divided into four things: equal distribution and social justice, diversity, integration, and long term perspective. Regarding the concept of sustainable development, environmental institutional development is far different from developmental institutional improvement. In principle, environmental institution has to be able to promote sustainable development. Therefore, the institution has to be able to change mandate or policy which can be applied in the context of sustainable development in order to emphasize the atmosphere of developing institution today which indicated by exploitation and to prioritize economic interest (Karwono, 2008). 212 | Asea Uninet Scientific and Plenary Meeting 2016 In order to achieve an accurate collaboration target, Alikodra (2006) suggests that three basic principles be developed; first, capacity empowerment and development; secondly, recognition of traditional wisdom and management and improvement of local people’s rights; and thirdly, sustainable, accountable, and transparent development, environmental preservation, development of earnings, justice, and integrity. 5 CLOSING REMARKS 1) 2) 3) 4) 5) The management of community-based coastal area can be defined as a process of giving authority, responsibility, and opportunity to people to manage their own fishery resources by defining their need, objectives, and aspiration. Co-management is distribution of responsibility and authority between the government and local community in managing coastal area and its fishery resources which is the integration of community-based management model and government-based management model. The sustainable management of community-based coastal area is a certainty; that is, an integrity approach toward development which simultaneously combines three pillars of development: economic development, social development, and environmental protection. Co-management model is the newest management model which the integration of community-based management model and government-based management model. Conceptually, this type of model is believed to be able to cope with the problems of environmental damage and, at the same time, extricating the coastal community from poverty. Understanding the coastal community and their problems will be able to help the government as the manager partner participate in predicting and anticipating negative potential change. Besides that, understanding community will be able to help design capacity strengthening for all stakeholders who are involved in the implementation of co-management model. On this occasion, it seems that the higher education should play its role which is, of course, related to its capability of helping collaborate the people’s power as the capital in managing and developing and help the government design its role as the responsive facilitator in the people’s needs. If all stakeholders understand their position and are able to play their role properly, big effort to increase people’s welfare through the sustainable management of community-based coastal area will certainly be realized. REFERENSES Alikodra, Hadi S. 2006. Integrasi Konsep Pengelolaan SDAL Dalam Perencanaan Pembangunan Daerah. Makalah Disampaikan Pada Diklat Perencanaan Daerah. Badan Diklat DEPDAGRI. Jakarta. -----------------. 2006. Pengembangan Institusi Lingkungan Hidup. Fakultas Kehutanan IPB. Bogor. -----------------, 2006. Pengelolaan Kolaboratif Kawasan Konservasi Di Era Otonomi Daerah. Makalah disampaikan pada Lokakarya Pengelolaan Kolaboratif Taman Nasional Karimunjawa. Semarang 19 September 2006. Adhuri, Dedi Supriadi. 2005. Perang-perang Atas Laut, Menghitung Tantangan pada Manajemen Sumberdaya Laut di Era Otonomi : Pelajaran dari Kepulauan Kei, Asea Uninet Scientific and Plenary Meeting 2016 | 213 Maluku Tenggara. Dalam Jurnal Antropologi Indonesia Vol 29, No.3. Hal.300308. Dahuri, Rokhmin. 2003. Keanekaragaman Hayati Laut. Aset Pembangunan Berkelanjutan Indonesia. Gramedia Pustaka Utama. Jakarta. Djajadiningrat, S, T. Dan Melia F. 2004. Kawasan Industri Berwawasan Lingkungan (Eko-Industrial Park) Fenomena Baru dalam Membangun Industri dan Kawasannya Demi Masa Depan Berkelanjutan. Rekayasa Sains. Bandung. Elikisia. 2000. Model Pengelolaan Sumberdaya Pesisir dan Lautan Berbasis Masyarakat (Sasi) di Maluku dalam Prosiding Konperensi Nasional II Pengelolaan Sumberdaya Pesisir dan Lautan Indonesia. Makasar. Kerjasama Proyek Pesisir Jakarta-UNHAS, DELP, CRC – Univ.Rhode Island-Pemda Sulsel dan LSM Konsosium Kelautan Sulsel. Fauzi, A. 2005. Kebijakan Perikanan dan Kelautan. Gramedia Pustaka Utama. 2005. Jakarta. Harahap, R.Hamdani. 1992. Nelayan dan Kemiskinan (Studi Antropologis Di Desa Paluh Sibaji, Kecamatan Pantai Labu, Kabupaten Deli Serdang). Laporan Penelitian. Lembaga Penelitian USU. Harahap, R.Hamdani. 1993. Kearifan Ekologi Masyarakat Nelayan Desa Jaring Halus, Kecamatan Secanggang, Kabupaten Langkat Propinsi Sumatera Utara. Laporan Penelitian. Lembaga Penelitian USU. Harahap, R.Hamdani. 1994. Orientasi Nilai Budaya Nelayan Propinsi Sumatera Utara( Studi Perbandingan Terhadap Masyarakat Nelayan Desa Jaring Halus, Kecamatan Secanggang, Kabupaten Langkat dan Masyarakat Nelayan Cina di Desa Sungai Berombang, Kecamatan Panai Hilir, Kabupaten Labuhan Batu). Laporan Penelitian. Lembaga Penelitian USU. Harahap, R.Hamdani. 1994a. Keterkaitan Faktor Kebudayaan Dalam Pemenuhan Kebutuhan Masyarakat Nelayan dan Pelestarian Lingkungan Di Daerah Pantai Timur Sumatera Utara. Tesis S2. Program Pascasarjana IPB. Bogor. Harahap, R.Hamdani dan Subhilhar. 1998. Partisipasi Masyarakat Nelayan Dalam Pengelolaan Mangrove. Laporan Penelitian Tidak Diterbitkan. DP3M Dirjen Dikti dan FISIP USU. Medan. Karwono, H. Pengembangan Kapasitas Berkelanjutan untuk Desentralisasi (Sustainbale Capacity Building Decentralization) dan Peran Lembaga Pendidikan. http://karwono.wordpress.com. Tgl 28 Oktober 2008. Korten, D.C. 1984. People Centered Development. West Harford. Kumarian Press. Mardikanto, Totok dan Poerwoko Soebiato. 2012. Pemberdayaan Masyarakat Dalam Perspektif Kebijakan Publik. Bandung. Alfabeta. Nikijuluw, Victor P.H. 2002. Rezim Pengelolaan Sumberdaya Perikanan. P3R. Jakarta. Person, Gerard A, Diny M.E. dan Tessa Minter. 2005. Decentralisation of Natural Resource Management : Some Themes and Unresolved Issues. Dalam Jurnal Antropologi Indonesia Vol 29, No.3. Hal.225-238. Satria, Arif. 2015. Pengantar Sosiologi Masyarakat Pesisir. Kerjasama Fakultas Ekologi Manusia IPB dengan Yayasan Pustaka Obor Indonesia. Jakarta Sinar, Tengku Lukman dan Wan Saifuddin. 2002. Kebudayaan Melayu Sumatera Timur. Medan: USU Press Siregar, Doli D. 2004. Manajemen Aset Strategi Penataan Konsep Pembangunan Berkelanjutan Secara Nasional Dalam Konteks Kepala Daerah Sebagai CEO’s pada Era Globalisasi & Otonomi Daerah. Gramedia Pustaka Utama. Jakarta. LAW ENFORCEMENT AGAINST ILLEGAL, UNREPORTED AND UNREGULATED (IUU FISHING) IN INDONESIAN EXCLUSIVE ECONOMIC ZONE Eka Martiana Wulansari ekamartianawulansari@yahoo.co.id Abstract Fish is shared stocks can not prevent displacement from one area to other, although there are fish that live in a particular area. Displacement is not a problem if ITS occur within ONE region of the country, but if the waters are explored CROSS the region some countries, the use and management of fish can not be left to one particular country, but must involve concerned, particularly if fishing is carried out in waters located outside the territory of the country. The practice of catching fish species that excessive amounts of the population or an issue that still continues until this day. Law enforcement in the field of fisheries is basically one part of the law enforcement in the waters or sea. Law enforcement in the waters or sea is generally activities state or apparatus based on the sovereignty of the country and/or under the provisions of international law that aims to make laws in force in the sea either national law or the rules of international law can be respected or adhered to by or legal entities, including the state as a subject of law, and thus can be created leach person legal order of national and international law. Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone and Act No. 31 of 2004 jo. Law No. 45 of 2009 on Fisheries adopted the provisions of international maritime law in the United Nations Convention on the Law of the Sea (United Nations Convention on the Law of the Sea/UNCLOS1982), which was ratified by Law No. 17 of 1985. In combating IUU fishing in indonesian Exclusive Economic Zone of Indonesia duties and powers of investigation, prosecution and examination before the court, in addition to follow the procedural law set out in Law No. 8 of 1981 on Criminal Procedure Act and the Indonesian Exclusive Economic Zone Act Fisheries Act also contains its own procedural law as special provisions (lex). Some specific provisions set out in Indonesian Exclusive Economic Zone in Act and Fisheries in Act, including granting the same outority in investigations in the field of fisheries to the Civil Servant Fisheries Investigators and Officers Navy Armed Forces of Indonesia, the establishment of a court of fisheries as well as legal subjects of IUU fishing actors in the Exclusive Economic Zone are foreign citizens and corporations. Types of illegal fishing that happend in Indonesia is a large-scale poaching and endanger the national economy, handling regulations should be directed to address the large-scale crimes and complex (sophisticated), belonging to the types of white collar crime or corporate crime. Regarding the perpetrators of IUU fishing by the corporation, the constraints faced by the Government of in this case are still many companies that use fictitious names, it will be difficult for law enforcement agencies to ensnare corporate responsibility as actors in IUU fishing. As a result of this many fictitious companies, financial terms the state lost tax revenue sources Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 214 Asea Uninet Scientific and Plenary Meeting 2016 | 215 and export duties. Corporate crime is not only a violation of criminal law, but also a violation of civil law and administrative law. The ineffectiveness of law enforcement against IUU fishing a big impact to fishing industry. IUU fishing cause harm, directly or indirectly, in the form of loss of material and immaterial, of the economic, ecological, and socially. Keywords: Law Enforcement, Corporate Actors IUU Fishing, Indonesian Exclusive Economic Zone 1 BACKGROUND Fish is shared stocks can not prevent displacement from one area to other, although there are fish that live in a particular area. Displacement is not a problem if its occur within one region of the country, but if the waters are explored cross the region some countries, the use and management of fish can not be left to one particular country, but must involve the countries concerned the countries, particularly if fishing is carried out in waters located outside the territory of the country.2 The practice of catching fish species that excessive amounts of the population or an ongoing problem until this way. comparison fish populations and high human population, causing the demand for fish is high with the state of the technological limitations of fishing, and the production is high enough so that overfishing done only to full fill the food needs of human population.3 Law enforcement in the field of fisheries is basically one part of law enforcement 4 at sea. Law enforcement at sea is generally interpreted as activities state or apparatus based on the sovereignty of the country and/or under the provisions of international law that aims to make laws in force in the sea either national law or the rules of international law can be respected or adhered by each person or legal entity including the state as a subject of law, and thus can be created legal order of national law and international law.5 Sovereignty and law enforcement in Indonesian waters, the air space above it, the seabed and the subsoil there of, including the natural resources contained there in as well as sanctions for the offense, carried out in accordance with the provisions of the Convention on International Law, and the legislation in force.6 2 Melda Kamil Ariadno, International Law Law of Life: The provisions of International Law on Fisheries, (Jakarta: Diadit Media, April 2007), p. 119 3 Eric M. Singer, Towards A Sustainable Fishery: The Price-Cap Approach, Tulane Environmental Law Journal, Summer 2011, 24 TLNELJ 253, 24 Tul. Envtl.L.J. 253. Copyright (c) 2011 4 National Law Development Agency, Research on Legal Aspects of Management of Fisheries in the National Water Indonesian Exclusive Economic Zone, (Jakarta: National Law Development Agency 1993/1994), p. 74. 5 National Law Development Agency, National Law Seminar Fifth Book I, Jurisdiction and Competence Law Enforcement Institutions in the Settlement Law Violations that occur in the Mediterranean waters Jurisdiction (Jakarta: National Law Development Agency, 1990), p. 70. 6 Law No. 6 of 1996 concerning Indonesian Waters, State Gazette No. 73, 1996, Supplement to State Gazette No. 3647, Article 24 paragraph (1), Chapter V of Sovereignty and Law Enforcement in Indonesian waters. 216 | Asea Uninet Scientific and Plenary Meeting 2016 Law of the Sea Convention 1982 which has been ratified by Indonesia with Law Number 17 of 1985 on Ratification of the United Nations Convention on the Law of the Sea, 1982, State Gazette No. 76, 1985, Supplement to State Gazette No. 3319 With her applicable Law No. 17 of 1985 on Ratification of the United Nations Convention on the Law of the Sea, 1982, Indonesia have an obligation subject to the convention, so that all policies in Indonesian marine and fisheries sector must comply with these provisions. This convention gives greater authority to utilize all marine resources in its territory to the outer boundaries of the state, namely the Exclusive Economic Zone. The provisions concerning the Exclusive Economic Zone of this Convention is set on the fifth part of Article 5 through Article 75. As for the rights of coastal states in the Exclusive Economic Zone consists of: 7 1) The sovereign rights to conduct exploration and exploitation, conservation and management of natural resources, living and non biodiversity of the seabed and subsoil; The right of sovereignty over the activities of exploration and exploitation, such as water and wind products; and Jurisdiction for the establishment and use of artificial islands, installations building, marine scientific research, protection, and development of the maritime environment. 2) 3) National laws relating to the implementation of sovereign rights in the Indonesian Exclusive Economic Zone are: 1) Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone, State Gazette No. 44 of 1983, Supplement to State Gazette No. 3260; Law No. 45 2009 jo. Law No. 31 of 2004 on Fisheries, State Gazette No. 154 of 2009, Supplement to State Gazette No. 5073; and Government Regulation No. 15 of 1984 on the Management of Natural Resources in the Exclusive Economic Zone of Indonesia, Promulgated in Jakarta on June 29, 1984 the Minister/Secretary of State of the Republic of Indonesia. 2) 3) Republic of Indonesia constitute the largest archipelago in the world, with two thirds of the total area of the sea area, the number of the island about 17,504 islands and a coastline of 81,000 km.8 Potential marine resources are so extensive that the stored content of biological and non biological resources from inland waters to the Indonesian Exclusive Economic Zone. Potential of biological resources is the largest marine fisheries. In the decade of the past 10 years shows that the exploitation and exploration of fishery products in Indonesia showed a very significant improvement. Exploration activities at the sea are proximate to IUU fishing activities are very detrimental to Indonesia. 7 Legal Development Department, the Navy Headquarters Indonesian Armed Forces, Official Translation of the United Nations Convention on the Law of the Sea (UNCLOS 1982), Permit from the Director of the International Treaty, Political Directorate, Ministry of Foreign Affairs, No. PO 114/93/29, 19 in February 1993, (Jakarta: Legal Development Department, the Navy Headquarters Armed Forces of Indonesia, 2007). 8 Melda Kamil Ariadno, International Law Law of Life: The provisions of International Law on Fisheries, (Jakarta: Diadit Media, April 2007), p. 129 Asea Uninet Scientific and Plenary Meeting 2016 | 217 UU Fishing understood and embraced in Indonesian positive law that the impact of illegal fishing and has great impact on the economy of the country. Therefore, the essence of regulation and prosecution of IUU Fishing in Indonesian should be understood in the prosecution of large-scale illegal fishing, which is generally carried out by foreign vessels and former foreign vessels. During this time many fishing violations committed by the foreign vessels and former foreign vessels. The violations include: (1) violation of fishing areas and violation of jurisdiction by foreign fishing vessels; (2) The fishing activities without permission or the validity period has run out; (3) manipulation of fishing licenses and/or permits fishing vessels; and (4) the use of fishing gear that does not fit with the permission and/or use of destructive fishing fish resources. For example, many foreign fishing vessels either licensed or unlicensed (among other foreign vessels and former foreign vessels from Japan, Korea, Vietnam, the Philippines and Taiwan) operating in the Indonesian Exclusive Economic Zone waters are rich in various types of fish. Activities of foreign fishing vessels that are not licensed, causes losses to Indonesia because most fishery source exploited by foreign fishermen.9 2 FORMULATION OF THE PROBLEM How is law enforcement against IUU fishing in Indonesian Exclusive Economic Zone, especially against corporate actors fishing industry? 3 PURPOSE To know the problems of legal construction legislation in law enforcement against IUU Fishing in Indonesian Exclusive Economic Zone, in particular corporate actors and responsibility. 4 WRITING METHOD This writing method is normative, which were analyzed using descriptive method. The data used are primary data in the form of legal materials legislation, the data obtained from the academics, legal experts and stakeholders in the form of interviews and secondary legal material in the form of publication of the law, such as a book, the result of scientific papers, magazines, articles, and internet. In this writing method, using the approach of legislation to see consistency and compatibility between one act/law with other act/law. Explanation: 9 Sub-Directorate of Supervision and Control, the Directorate General of Fisheries of the Ministry of Fisheries of the Republic of Indonesia, Research Report: Evaluation Utilization of Fish Resources in the Context of Development and its Control, (Jakarta: Directorate General of Fisheries Ministry of Fisheries of the Republic of Indonesia, 1995), p. 18. 218 | Asea Uninet Scientific and Plenary Meeting 2016 5 ILLEGAL, UNREPORTED, UNREGULATED (IUU FISHING) IN INDONESIA Definition of IUU fishing refers to definition issued by the International Plan of Action (IPOA) is Illegal, Unreported, Unregulated (IUU) Fishing initiated by FAO in the context of the implementation of the Code of Conduct for Responsible Fisheries (CCRF). Definition of Illegal Fishing is described as follows. Illegal Fishing, are:10 1) 2) 3) Fishing activities carried out by a particular country or foreign vessels in waters that are not a jurisdiction without the permission of the state which has jurisdiction or fishing activity is contrary to the laws and regulations of the country. Fishing activities carried out by fishing vessels flagged from one of the countries that joined as members of regional fisheries management organizations, Regional Fisheries Management Organization (RFMO) but the operation of its vessels at odds with conservation measures and fisheries management has been adopted by a RFMO. RFMO state must follow the rules or other rules relating to international law. The fishing activities contrary to the law of a state or international regulations, including the rules that endorsed by RFMO member countries. Although the IPOA-IUU Fishing has restrictions against IUU fishing definition, in a more simple definition and operational . Definition of IUU fishing is illegal fishing carried out, unreported or were not and are not regulated (Illegal, Unreported, Unregulated Fishing) in Regional Fisheries Management of the Republic of Indonesia. Activities and causes of IUU fishing in Indonesian Exclusive Economic Zone which is common among other fishing: 1) without authorization; 2) using a false license; 3) using prohibited fishing gear and 4) the types (species) that are not in accordance with less permission. The causes of Illegal Fishing, are:11 1) 2) 3) 4) 5) 6) 7) 8) Increased demand for fish (domestic / foreign) Fish resource in other countries is reduced or exhausted Lack of national fishing fleet Permit / supporting documents issued more than one agency Weak monitoring and law enforcement at the sea Lack of offense charges and court decisions There is no common vision of law enforcement officers and Lack of regulation and criminal provisions. 10 Mukhtar, Definition of illegal fishing. http://mukhtar-api.com/2011/05/illegal-fishing-diindonesia.html, downloaded 2015 11 GoBlue Indonesia, http: //www.stop IUU fishing.com, August 17th, 2009, retrieved May 18, 2015 Asea Uninet Scientific and Plenary Meeting 2016 | 219 Common forms of unreported fishing that occurs, are:12 1) 2) fishing which does not report actual catches or falsification of data capture. fishing that is directly taken to other countries (transhipment in middle of the sea). The causes of unreported fishing, are:13 1) 2) 3) 4) 5) 6) 7) 8) 9) Lack of legislation Collecting data system of fish catched / transport of fish that have not been perfect; No awareness of employers of the importance of submitting data catches / transport of fish; Catch and fishing ground is considered confidential and not to know by the other party (rival); Lack of sanctions and criminal provisions; The shape of the islands led to many fish landing sites are largely unmonitored and uncontrolled; Under arrest unit; Most entrepreneurs who have a fishing fleet has a port / its own catch; and production reports provided by the management company to the relevant agencies tend to be lower than actual. The form of unregulated fishing, are no:14 1) 2) 3) 4) setting a data recording mechanism of the catch from all fishing activities; setting water region is allowed and forbidden; regulation of sport fishing activity; and setting fishing activity using a modification of the prohibited fishing gear; The causes of unregulated fishing, are:15 1) 2) 3) 4) 12 The potential of fish resources in the waters of Indonesia is still considered to be adequate and not harmful; Busy regulate existing ones because of the many problems; Short-term orientation; The diversity of regional waters conditions and fish resources; and http://www.stopiuufishing.com http://www.stopiuufishing.com 14 http://www.stopiuufishing.com 15 http://www.stopiuufishing.com 13 220 | Asea Uninet Scientific and Plenary Meeting 2016 5) Indonesia is not a members of the international fishery organizations. IUU Fishing is done with a certain modus operandi. The modus operandi is related to an attempt to trick the officers, the operating time and location of illegal arrests, as well as involvement with the apparatus. This mode will continue to evolve in line with technological developments and the state's response to the IUU fishing activities.16 6 STATE LOSSES BROUGHT BY IUU FISHING IN INDONESIA For Indonesia IUU fishing is a major concern, because it happens every day in the waters of Indonesia. IUU Fishing has clearly detrimental to Indonesia. This country has lost a source of foreign exchange should be able to support the welfare of society, but in fact it is enjoyed by certain individuals or groups from within and outside the country. IUUfishing potentially raises some disadvantages, as follows:17 (a) Economic Losses, the Government lose the economic value of the fish being stolen, levy Fishery lost, the fuel subsidy is enjoyed by fishing vessel who are not eligible, fish processing unit shortage of supply of raw materials, thus undermining government efforts to boost competitiveness fisheries, as well as the livelihoods of small-scale fishermen who compete with foreign vessels.18 16 Fauzi, Akhmad, Fisheries and Maritime Policy. (Jakarta: Scholastic, 2005) G.A. Wagey, S. Nurhakim, VPH. Nikijuluw, Badrudin, and T.J. Pitcher, Study of illegal, unreported, and unregulated fishing in the Arafura Sea, Indonesia Year 2009, Sub Legal Department, Directorate General of Resources of Marine Fisheries, Ministry Marine and Fisheries, THE REPUBLIC, (Jakarta: Ministry of Maritime Affairs and Fisheries, Wednesday, April 22 2015, 11:57), law.psdkp <law.psdkp@gmail.com 17 18 Calculation of the loss can be described as follows: 1) Based on data reported by the Food and Agriculture Organization (FAO) in 2001, which states that that the developing countries could potentially lose 25% of the stock of fish resources as a result of illegal fishing activities. Based on estimates of the FAO, Indonesia estimated losses due to illegal fishing activities can be calculated as follows: a) With Value Maximum Sustainable Yield (MSY) of 6.5 million tonnes (according Kep. Minister KP No. 45/2011 on Potential Estimation of Fish Resources in the Region Water and Fisheries-Republic Iindonesia), it is predicted that Indonesia loses resources fish 6.5 million tons x 25% = 1.6 million tons / year; and b) If the assumption of the selling price of fish in the international market average of 2 USD / kg (lowest average price), the losses due to illegal fishing Indonesia reached Rp. ± 30 trillion (1.6 million tonnes x 2 USD = 3.2 billion USD, equivalent to Rp. ± 30 trillion, that time). 2) Estimates of potential losses to the state due to IUU fishing based on results of a study conducted by DG. PSDKP In 2011, obtained estimates of potential losses as follows: KE = T + (I x ICOR), Where : KE = Total Losses State; Asea Uninet Scientific and Plenary Meeting 2016 (b) (c) (d) | 221 Ecological losses, which include damage to fish resources and the environment, caused by the use of fishing gear and/or fishing tools that are not environmentally friendly. In addition, the practice of IUU fishing is causing difficulties for the fisheries management authority to obtain data on potential fishing resources are accurate, to set the quota utilization of fishery resources. Social disadvantages, it is proved that the practice of IUU fishing in the territorial waters of the Republic of Indonesia fisheries led to fishermen in the country that in fact dominated by small-scale fishermen, become less competitive, and potentially urgent livelihoods of small fishing communities. In addition, IUU fishing is one of the causes of the capacity of fish processing units that have been built only about 30-50% utilized. The average loss per year as a result of IUU fishing in the Arafura Sea is reach Rp. 11.3 trillion. In addition to the above disadvantages, Indonesia also suffered a loss of political impact of the rise of IUU fishing is one of the triggers of conflict or tension of diplomatic relations between the countries is the problem of IUU fishing. Especially disturbing the sovereignty of the Republic of Indonesia, creating a negative image, because some countries consider we are unable to manage marine resources well. Moreover, concerning the bilateral relations between adjacent/neighboring countries conducted by a fishing boat (traditional fishing right), or trawlers (trawlers) which is owned by each country. In some cases traditional fishing right, often happens is in the border between Indonesia and Malaysia and Indonesia and Australia. In an effort to reduce tensions between the two countries, required reviewing bilateral agreements related thereto. It also did outreach /dissemination to the relevant traditional fishermen fishing legally in a region that has in agreement I = nominal value of fish stolen, T = Losses Related to Labor ICOR = index fisheries investment in Indonesia amounted to 3.5 Details of the calculation of estimated potential losses as follows: a. The calculation of labor losses are calculated from estimates of the number of ships that carry out IUU fishing. From the experience of the operating results of the Supervisory Ships for Maritime Affairs and Fisheries Ministry, the number of fishing vessels that conduct IUU average of more than 1000 ships in a year. If one assumes an average workforce in the vessel reached 10 with a salary of Rp. 24 million per person / year, the losses in the labor sector into: T = 1000 x 10 x Rp. 24,000,000 = Rp. 240 billion / year b. The estimated number of fish stolen globally reaching 25% of potential fish (FAO, 2001), so the estimate of the number of fish that were stolen reaches 25% x 6.5 million tonnes / year (6.5 million tons is the value of Maximum Sustainable Yield ( MSY) based on the Ministry of Marine Affairs and Fisheries No. 45/2011). Assuming the price of fish stolen an average of 2 USD (exchange rate of Rp. 9,000) then the I becomes: I = 1,600,000 x 2 x Rp. 9000 = Rp. 28.8 trillion / year c. the Central Statistics Agency (BPS) sets the value of 3.5 Incremental Capital Output Ratio (ICOR) for Indonesian fisheries activities, meant to produce fish with a value of Rp. 1 million USD worth of investment opportunities. 3.5 million. d. so that the total losses due to illegal fishing be: KE = Rp. 240 billion + (Rp. 28.8 trillion x 3.5) = ± Rp. 101 040 billion / year 222 | Asea Uninet Scientific and Plenary Meeting 2016 (fishing ground). IUU fishing activities undertaken by foreign vessels trawling many uses, especially Thailand, Myanmar, the Philippines and Taiwan vessels. The existence of such vessels and can lead to conflict between the two countries. While for some countries, very low desire to create a subregional or regional cooperation to combat IUU fishing. This is supported by the fishing industry conditions in neighboring countries that desperately need the supply of fish, regardless of where the fish supply comes from. In an effort to minimize the conflict between the two countries is needed coordination and mutual respect for national sovereignty, especially on the exploration and exploitation of fishery resources.19 IUU fishing does not only cause harm to the state, but also threaten the interests of Indonesian fishermen, industrial climate, and national fisheries. Viewed from the side of fishermen and entrepreneurs interests, IUU fishing threatens the potential availability of fish, causing fish stocks decline on a large scale. In terms of the interests of the industrial and commercial fisheries, IUU fishing generated a climate of competition and industry in the field of fisheries becomes unhealthy, the image of the national fisheries collapsed and the possibility Indonesia 20will face the threat of embargo on countries importing fish products from Indonesia. The problems that led to the rise of IUU fishing activities are: (1) control range and wide area surveillance, not comparable with the control capabilities that exist today; (2) the limited ability of facilities and a fleet of surveillance at sea, (3) the weak capability of Indonesian Human Resources fishermen, and many businessmen mentality of rentier economy or broker, (4) weakness of law enforcement; and (5) lack of coordination and commitment among law enforcement officials. 7 7.1 LAW ENFORCEMENT AGAINST IUU FISHING IN THE EXCLUSIVE ECONOMIC ZONE BASED ON UNCLOS 1982 AND NATIONAL LAW Law Enforcement in Exclusive Ecomic Zone by UNCLOS 1982 Exclusive Economic Zone have legal status sui generis (unique/different). The uniqueness in the existence of the rights and obligations of coastal States and other countries over the Exclusive Economic Zone According to the Convention on the Law of the Sea 1982 in the Exclusive Economic Zone shall remain in force freedom for every state in certain things such as shipping or navigation and aviation as well as the laying or installation of cables and pipes in seabed. Therefore, in the Exclusive Economic Zone, coastal states do not have absolute sovereignty as well as in the territorial sea, but only has sovereign rights over its natural resources and other authorities relating to the natural resources. As to the rights, jurisdiction, and duties of states in the Exclusive Economic Zone under the Convention on the Law of the Sea 1982, namely the Exclusive Economic Zone of coastal state has sovereign rights for the purpose of exploring and exploiting, conserving and managing the natural resources, both living and non-biological, from the waters above 19 Dina Sunyowati, impact of IUU-Fishing activities in Indonesia, Presented at the National Seminar on "Role and Law Enforcement Efforts and Stakeholder In Handling and Combating IUU Fishing in the Border Region of Indonesia". Cooperation of the Ministry of Foreign Affairs of the Republic of Indonesia, Airlangga University, Surabaya, 22 September 2014 20 Bill Drafting Deputy Secretary General of the Council of Representatives of the Republic of Indonesia, an academic paper on the Draft Law on Courts Fisheries, (Jakarta: Deputy Designers Act, the General Secretariat of the Council of Representatives of the Republic of Indonesia, 2005), p.1 Ibid., P , 2 Asea Uninet Scientific and Plenary Meeting 2016 | 223 the seabed and of the seabed and the subsoil thereof and with regard to other activities for the purposes of economic exploitation and exploration of the zone, such as the production of energy from water, currents, and winds. Furthermore in Exclusive Economic Zone of coastal States have jurisdiction with respect to the manufacture and use of artificial islands, installations and structures; marine scientific research; and the protection and preservation of the marine environment. In Article 27, paragraph (5) of UNCLOS in 1982 further refers to Chapter V of the Exclusive Economic Zone in violation of laws and regulations relating to the coastal state of exploration and exploitation of fishery resources. It is different, if the violation occurred in the Exclusive Economic Zone, especially the violation of the activities of exploration, exploitation, conservation and management of fishery resources. Associated with law enforcement in the coastal States Exclusive Economic Zone, Article 73 of UNCLOS in 1982 set: 1) 2) 3) 4) The coastal State may, in the exercise of its sovereign rights to exploration, exploitation, conservation and management of living resources in the exclusive economic zone, take such measures, including boarding, check, arrest and initiate proceedings, as required to ensure compliance with laws an invitation that was determined in accordance with the provisions to this Convention. The ships were captured and the crew should be released immediately after being given a decent bail or other forms of guarantees Coastal states penalties imposed for violations of fisheries laws and regulations in the exclusive economic zone may not include imprisonment, if no contrary agreement between the countries concerned, or any other form of corporal punishment. In the event of the arrest or detention of foreign vessels coastal States shall promptly notify the flag State, through appropriate channels, of the action taken and of any penalties subsequently imposed. Under the provisions of Article 73 of UNCLOS in 1982, if a foreign vessel does not comply with the laws and regulations in the coastal state fishery Exclusive Economic Zone. The state can shore up, inspect, arrest and initiate proceedings on the vessel and notify to the flag state. But the ship and crew were arrested should be immediately released with reasonable bond (guarantee decent money) given to coastal states. The penalties against foreign ships should also not be in the form of corporal punishment is prison. Therefore a form of punishment for the vessels and its crew is different if it occurs in the sea area under the sovereignty of the subject in the Exclusive Economic Zone. Coastal state authority against violations in the Exclusive Economic Zone is limited only to enforce the law relating to Fisheries. This difference is due in the Exclusive Economic Zone, a coastal state has sovereign rights only (sovereign rights), not sovereign, that is limited to matters relating to sovereign rights which are owned by the state beach or island states. The provisions of Article 73 paragraph (2) requires coastal states to immediately release the arrested vessel and its crew after being given a decent bail or other forms of guarantees. Immediately release procedures under Article 292. Immediately release procedures of the detained vessel and crew is an innovation in 224 | Asea Uninet Scientific and Plenary Meeting 2016 international maritime law.21 However, although Article 292 paragraph (1) requires that the bond or other financial security must be "reasonable / feasible, but UNCLOS 1982 did not give the details about the financial guarantees. 7.2 Enforcement against IUU fishing in the Exclusive Economic Zone by the National Law Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone and Act No. 31 of 2004 jo. Law No. 45 of 2009 on Fisheries (Fisheries Act) adopted the provisions of international maritime law in the United Nations Convention on the Law of the Sea (United Nations Convention on the Law of the Sea / UNCLOS) of 1982, which was ratified by Law No. 17 of 1985. In eradicate IUU fishing in Indonesian Exclusive Economic Zone, duties and authority of investigation, prosecution and examination before the court, in addition to follow the procedural law set out in Law No. 8 of 1981 on Criminal Procedure, Indonesian Exclusive Economic Zone Act, and Fisheries Act also contains its own procedural law as special provisions (lex specialist). Law enforcement is one crucial factor in upholding the rule of law. In the process of law enforcement, investigator hold a very important role, because it is a legal apparatus that drives the justice system. The results of investigations conducted by the investigator would be material in the court process. Therefore, the success or failure of a trial process depends on the results of investigations conducted by the investigator.22 The concept of law enforcement at the sea in the handling of IUU fishing implemented in an integrated manner based on the authority given to law enforcement officials in accordance with the mandate of the legislation. Basic authority of law enforcement against IUU Fishing in Indonesian Exclusive Economic Zone, among others:23 1. Investigators Navy Officer of the Indonesian National Army (a) (b) (c) Ordinance (Law Act) TZMKO (Territorialle Zee en Maritieme Kringen Ordinance), Staatsblad 1939 No. 442, Article 13 states that the Navy is one of the agencies that have the authority conducting an investigation; Article 73, Law Number 45 Year 2009 jo Law No. 31 of 2004 on Fisheries, (sheet states No. 154 of 2009, Additional sheets of state No. 5073); and Article 14 of Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone, (sheet states No. 44 of 1983, Additional sheets of state No. 3260). 21 GAO Jianjun, Reasonableness of the Bond under Article 292 of the LOS Convention: Practice of the ITLOS., In http://chinesejil.oxfordjournals.org/content/7/1/115.full.pdf+html. Accessed October 28, 2012. 22 Agreement between the Ministry of Maritime Affairs and Fisheries, the Indonesian National Police and National Army Navy Indonesiano: KB.05A / DJP2SDKP / 2008, No: NO.POL: B / 325 / II / 2008, No: B / 150 / II / 2008 standard Operating and Handling Procedures Crime Investigation Levels Fisheries, (Jakarta: Directorate Handling Violations, Directorate of Monitoring and Control of Marine Resources and Fisheries, the Ministry of Maritime Affairs and Fisheries 2009), p.1 23 Answers Interviews with the Ministry of Maritime and Fisheries, Wednesday, April 22, 2015, 11: 57, law.psdkp <law.psdkp@gmail.com Asea Uninet Scientific and Plenary Meeting 2016 | 225 2. Civil Servant Fisheries Investigators (a) (b) Article 6 of Law No. 8 of 1981 on Criminal Proceedings (sheet states No. 76 of 1981, Additional sheets of state No. 3209); and Article 73, Law Number 45 year 2009 jo. Law No. 31 year 2004 on Fisheries, (sheet states No. 154 of 2009, Additional sheets of state No. 5073). 3. Maritime Security Agency (a) (b) Article 59, Law No. 32 of 2014 on the Marine (sheet states No. 294 2014, Additional sheets of state No.5603); and Presidential Decree No. 178 of 2014 on State Security is Sea (sheet states No. 380 in 2013) Investigative authority against IUU fishing in Indonesian Exclusive Economic Zone is only given to the Investigator Officer of the Navy and the Civil Servant Fisheries Investigators. While the Maritime Security Agency only have function as law enforcement officials. IUU fishing causing huge losses, the government through Ministry of Maritime and Fisheries has made various efforts to solve them. Such efforts can be classified into two types:24 1. Soft structures, including: a. Review and improvement of legislation. b. Reinforcement monitoring technical implementation units. c. Strengthening the capacity of the fisheries inspectors and fisheries investigators. d. Regional cooperation: 1) a member of the Regional Fisheries Management Organisation (Regional Fisheries Management Organizations / RFMOs); IOTC, CCSBT, WCPFC. 2) Establish a Regional Plan of action (RPOA) to promote fishing practices which actually included the eradication of IUU fishing. e. Actively participate in regional fora and international fisheries (ASEANSEAFDEC, APEC, CTI-CFF, IORC, FAO, and so on) f. Applying the provisions of the conservation and management of fishery (EC regulation, PSMA, and so on). 2. Hard structures, including: a. Monitoring, Control and Surveillance / MCS Implement consistently: Fishing Vessel Monitoring System/Vessel Monitoring System (VMS), observer, logbook, port inspection. b. Carry out inspection of the fishing vessel either before or during fishing, during and after berthing. c. Build a surveillance infrastructure. 24 Research / Interview / Focus Group Discussion, Source: Asep Burhanudin (DG Control of Marine Resources and Fisheries, the Ministry of Maritime Affairs and Fisheries, Research Team Fisheries Research Center, Research and Documentation of the Secretariat General of the Council of Representatives of the Republic of Indonesia, February 23, 2015, p..2-3. 226 | Asea Uninet Scientific and Plenary Meeting 2016 d. Engaging the relevant law enforcement agencies, including cooperation on exchange of data and information among relevant agencies. e. Facilitating and fostering supervisor community group. f. Joint operations at the sea surveillance with relevant institutions. g. Cooperation surveillance / patrolling, and data exchange with several neighboring countries. h. Jointly build 10 courts fishery. Additionally there are some actions/policies implemented by the government through the Ministry of Maritime Affairs and Fisheries in the framework of supervision and law enforcement eradication at this time include: 1. Establish Regulation of the Minister of Maritime Affairs and Fisheries: (a) (b) (c) Regulation of the Minister of Maritime Affairs and Fisheries Number 56 year 2014, regulating the temporary halt to fishing licenses in the fishery management area of the Republic of Indonesia which is reserved for exforeign vessel or vessel construction is done abroad. Temporary suspension (moratorium) is in effect from November 3, 2014 through April 30, 2015. Things are regulated, among others: the issuance of a new license (Fishery Business License / Business License, a fishing permit / SIPI and fish transport vessels License / SIKPI); renewal of a fishing permit / SIPI and fish transport vessels License / SIKPI; analysis and evaluation for a fishing permit / SIPI and fish transport vessels License / SIKPI valid; and administrative sanctions for the violation. Before the moratorium (October 25, 2014), the number of foreign vessels which install transmitter of Fishing Vessel Monitoring System / Vessel Monitoring System (VMS) there are as many as 933. After the moratorium (February 3, 2015), the number of vessels that are still active transmitter Fishing Vessel Monitoring System / Vessel Monitoring System (VMS) it decreased to 67 vessels. Regulation of the Minister of Maritime Affairs and fisheries Number 57 Year 2014, concerning the prohibition of Transhipment (over charge), namely the transfer of the fish from the fishing vessel to the freighter removal fish or fish caught from the fishing vessel to the fishing vessel. Transhipment also provided for in Article 41 paragraph (3) and (4) of Law No. 45 of 2009 on the amendment of Law No. 31 year 2004. Regulation of the Minister of Marine and fisheries No. 58 Year 2014 on Improving Employee Discipline. 2. Transparency of data and information, among others: (a) (b) (c) (d) head publication of data via website www.kkp.go.id. Transparency of the licensing process of fishing boats (fishing permit / SIPI and fish transport vessels License / SIKPI) Publication of the results of monitoring of fishing vessels by data satellite that can be accessed by law enforcement officials in the sea and fishing vessel concerned owners. Transparency catching fishing vessel fishery criminals arrested by the supervision of the Ministry of Maritime Affairs and Fisheries. Asea Uninet Scientific and Plenary Meeting 2016 | 227 3. Establish IUU Fishing Task Force and Working Group. Based on the Regulation of the Minister of Marine and fisheries No. 76 year 2014 formed a task force of IUU fishing which consists of the Inspectorate General of the Ministry of Maritime Affairs and Fisheries, Monitoring Marine Resources and fisheries Ministry Maritime Affairs and Fisheries, the Navy Armed Forces of Indonesia, Indonesian National Police (Criminal Investigation and Police Air), Directorate General of Sea Transportation, Ministry of Transportation Directorate General of Customs and the Directorate General of Taxation, Ministry of Finance, and the Center for Financial Transaction Reporting and Analysis. The task of the Task Force Combating IUU fishing are: (a) (b) (c) re-verification of ex-foreign fishing vessels affected by the moratorium. Fisheries licensing arrangement. Calculating state losses due to IUU fishing. In addition to the Task Force Combating IUU fishing, CTF also established a Working Group (WG), the Working Group on Data Integration Architecture Development Ministry of Maritime Affairs and Fisheries and Verification Working Group on Fish Processing Unit Partnership with Fishing Vessels. 4. Improve the monitoring and enforcement cooperation IUU fishing: (a) (b) (c) 5. 6. 7. 8. Memorandum of Understanding / MOU with the Indonesian National Army Navy (December 1, 2014) Task Force anti-IUU fishing (Maritime Affairs and Fisheries Ministerial Decree Number 76 Year 2014) Sinking of the illegal foreign fishing vessels (Act No. 45 of 2009): 1) Sinking ship on the high seas (Article 69 paragraph (4) (Act No. 45 of 2009). In this case there is also a Charter Agreement between DG Control of Marine Resources and Fisheries, Navy of Indonesian National Army and Indonesian National Police. Terms drownings ships at the sea: foreign ships without documents; resistance / maneuver endanger the lives of law enforcement officers, or conditions that endanger the ship badly damaged to be pulled into port. Before the drowned crew had been saved beforehand. 2) Sinking of the vessel conducted by: a. Court approval (Article 76 A of Act Number. 45 year 2009). b. Court decisions that have permanent legal force. c. The inauguration of the 3 (three) trial fisheries Court: Ambon Fisheries Court, Sorong Fisheries Court, and Merauke Fisheries Court. d. Memorandum of Understanding / MOU with the Center for Financial Transaction Reporting and Analysis (January 5, 2015) Strengthening fisheries court. There are 10 (ten) courts are Medan Fisheries Court, Jakarta, Pontianak, Tual, Bitung, Tanjungpinang, Ranai, Ambon, Sorong, and Merauke. Propose a Presidential Instruction on eradication of IUU fishing. Increase supervision capacity. Setting up the Standard Operating Procedures of the acceleration of the process of law enforcement and relationships working procedures of law enforcement requests for assistance in the sea between law enforcement agencies. Policy direction of the Ministry of Maritime Affairs and Fisheries forward related to combating IUU fishing: 228 | Asea Uninet Scientific and Plenary Meeting 2016 1. Propose to the President of the Republic of Indonesia to issue a Presidential Instruction on Acceleration Combating IUU Fishing. Currently the Presidential Instruction is in the process of discussions facilitated by the Secretariat of the Cabinet. 2. Control the licensing process and increased control of fishing quotas based integrated with the transport of the fish and fish live cultivation, post-harvest processing, and distribution of fishery products. 3. Strengthening the monitoring capacity of maritime resources and fisheries: (a) (b) (c) Increase the number of days of operation of surveillance vessels MMAF to 280 days. Develop airborne surveillance. Addition 4 (four) Permit surveillance vessels fish transport vessels / SIKPI a length of 60 meters. 4. Preparing Standard Operating Procedures of the acceleration of the process of law enforcement and relationships working procedures helprequest of law enforcement on the sea between the law enforcement agencies (Ministry of Maritime Affairs and Fisheries, Indonesia National Army Navy, the Indonesian National Police and Maritime Security Agency). Related to the fisheries court, Regional Fisheries fishery tribunal in the general court is intended to improve the efficiency and effectiveness of law enforcement against IUU fishing. When this has been established 10 (ten) fisheries courts, but IUU Fishing cases handled 7 (seven) fisheries court that had been active during the period 2007 to 2013 is still very small.25 IUU fishing cases is rife but the number of cases examined by the court it is only a vew. Government legal basis to special measures such as burning and / or the sinking of the foreign-flagged fishing vessel that has done IUU Fishing is Article 69 paragraph (4) of Fisheries Act. The provisions concerning special measures in the form of burning and/or sinking of foreign-flagged fishing vessel that has done IUU Fishing only based on "sufficient preliminary evidence" performed by the investigator and / or fisheries supervisor is need for further assessment. Special measures are a remedy for a deterrent effect for the perpetrators of IUU fishing. However, special measures such as burning and sinking of the fishing vessel or a foreign flag is not in accordance with the principle of the Code of Criminal Procedure. Special measures have been contradictory, and violate the principles of the Code of Criminal Procedure, among others: the presumption of innocence, the principle of equal treatment before the law and the principle of balance, the action means has removed the evidence that will be used to proof at trial. IUU Fishing must suspected perpetrators to be presumed innocent until their guilt has been proven otherwise by the court and the verdict was binding. 25 Former Chairman of the Supreme Court for Special Crimes, to Djoko, states that "almost all the courts have a number of cases slightly. Except maybe one to two cases per year in Pontianak court and Tanjung Pinang. In North Jakarta, even for two consecutive years no single case. " http://www.bbc.co.uk/indonesia/berita_indonesia/2014/12/141211_indonesia_pengadilan_perikan an, downloadable on January 15, 2 Asea Uninet Scientific and Plenary Meeting 2016 | 229 Against the criminal acts that occurred in the field of fisheries in the Indonesian Exclusive Economic Zone there are other provisions as based on the 1982 UNCLOS, coastal states in this zone has exclusive sovereign rights to explore and exploitation natural resources as well as the particular jurisdiction. Implementation of sovereign rights of the Convention on the Law of the Sea 1982 specifies in Article 73 that the coastal states can take necessary action such as inspection, arrest of ships and conduct judicial proceedings against ships which violate the provisions that endorsed by coastal state. Against the criminal acts that occurred in the field of fisheries in Indonesian Exclusive Economic Zone is generally carried out arrests of people suspected as the culprit and the stuff that has to do with criminal acts such as vessels used and the fish seizure. The case against the suspect / defendant can apply for his release and the goods seized by law enforcement bail decent. This is accordance with Article 104 paragraph (1) of the Act Fisheries decisive "request for the release of ships and / or people who are arrested for a criminal offense referred to in Article 5 (1) b, can be done at any time before a decision of fishery court by submitting a decent amount of bail, which is decided by the courts fishery " Although the actions undertaken by the fishing vessel with a foreign flag is punishable by imprisonment and fined, but throughout there is no agreement between the Government of the Republic of Indonesia with the state government criminal then a prison sentence (body) is not applicable in the case of fisheries that occur in Indonesian Exclusive Economic Zone. This is in accordance with the provisions of Article 73 of the Convention on the Law of the Sea 1982 that the enforcement of the law of coastal state in Indonesian Exclusive Economic Zone can not completely implemented. The ships were captured and their crews must be released immediately after providing reasonable assurance money. Besides, the penalty imposed for violators of laws and regulations in the exclusive economic zone may not include reduction or corporal punishment. For exemption may be filed at any time before the case is decided by the courts. The conditions prescribed by Article 104 paragraph (1) of Fisheries Act is that the petition was accompanied by a payment guarantee a decent standard explanation that article decent size for a security deposit is based on the price of ships, ship fittings and results of operations coupled with the amount of the maximum fine amount. Therefore, burning and sinking of the fishing vessel or a foreign flag has conducted IUU fishing in Indonesian Exclusive Economic Zone can not be done because at any time after the exemption applied for bail. Unless the case has been decided by the court with a ruling on the status of the evidence seized to be destroyed. CORPORATE OFFENDER AGAINST IUU FISHING IN INDONESIAN EXCLUSIVE ECONOMIC ZONE Legal subject of IUU fishing offender in Indonesian Exclusive Economic Zone is a foreignflagged fishing vessel, foreign citizens and corporate. Illegal fishing that happen in Indonesia is a large-scale poaching and endanger the national economy, handling 230 | Asea Uninet Scientific and Plenary Meeting 2016 regulations should be directed to address the large-scale crimes and complex (sophisticated), belonging to the types of crime white collar crime or corporate crime. Regarding the perpetrators of IUU fishing by the corporation, the constraints faced by the Government of in this case are still many companies that use fictitious names, it will be difficult to law enforcement agencies to ensnare corporate responsibility as actors in IUU fishing. As a result of this many fictitious companies, financial terms the state lost tax revenue sources and export duties. Corporate crime is not only a violation of criminal law, but also a violation of civil law and administrative law. IUU fishing can classified into economic crimes. The formulation of criminal offenses in the field of fisheries have kriminogen factor similar to economic crimes and the impact affects the interests of the nation in achieving prosperity of the people.26 During this time IUU fishing in Indonesia in law enforcement is only exposed to the actors in the field, such as the ship's captain, head of the engine room and the crew, while those who are behind them (corporations) almost never touched. During this time the principle of corporate responsibility is not so popular in the handling of criminal cases fishery. As a result, the handling of criminal cases fishery completed difficult, particularly involving the corporation. More over, in the era of reform with regional autonomy concept is one of the causes difficulty in handling criminal cases of fisheries, particularly those involving the corporation because of the protection of the head of the region (District head ) from each province to the fishing industry / corporations are investors in each region. Many fishing industry / corporations such as the "double-edged sword", as well as a investor in the management of fish also do IUU fishing to increase profits for the company. In the essence, a criminal law enforcement policy through several steps: the first steps is the stage of formulation of the law enforcement agencies in abstracto by the legislators (legislative).27 Second, the application stage is the stage of the application of criminal law by law enforcement officers (Judicial). These three, namely the execution phase of concrete execution of criminal law by the criminal executive officers (executive administrative). Law enforcement against IUU fishing by corporations should be based on the three steps above.28 Crime setting in the field of fisheries as defined in the Fisheries Act, is the nature of crime and offense. Arrangements regarding liability criminal offense fishery carried out by corporations that can be prosecuted for a criminal offense fishery not only those who are direct actors in the field but also the corporations that are behind them, Article 101 Fisheries Act states: "in the case of criminal acts committed by a corporation fisheries, criminal charges and sanctions imposed against its officials, and criminal penalties plus one third of the sentence imposed ". With such formulation, though the corporation is recognized as perpetrators of a crime, but the corporation it self can not be requested criminal liability. Such arrangements would give rise to many disadvantages. Logically, for certain cases where the benefits such a large company and / or great costs to society, then the 26 Yanti Amelia Lewerissa Practices Illegal Fishing In Maluku waters as a Form of Economic Crime, Sasi Journal Vol.16. 3 In July-September 2010, p.8 27 Barda Nawawi Arief, Legislative Policy in Combating Crime With Criminal Prison (Semarang, the Agency Diponegoro University Publishers, 1994), p. 59 28 Muladi, Capita Selecta Criminal Justice System, (Semarang, the Agency Diponegoro University Publishers, 1995),p. 13, 14 Asea Uninet Scientific and Plenary Meeting 2016 | 231 imposition of imprisonment / fine of "only" to the corporate board would be disproportionate. In addition, the imposition of a criminal to the management of the corporation is also not sufficient to provide assurance that the corporation does not carry out similar actions. In fact, not a few corporation also hide behind corporate puppet (dummy company) who deliberately build to protect its holding corporation. Law on the Exclusive Economic Zone of Indonesia, stated that:29 (a) (b) (c) The arrest of the vessel and / or those suspected of committing abuses in the Indonesian Exclusive Economic Zone includes the action termination vessels up to handing over the ship and / or those people in ports where the matter can be further processed; Delivery of the vessel and / or those that should be done as soon as possible and must not exceed a period of 7 (seven) days, unless there is a force majeure; and For the sake of detention, criminal offenses set out in violation of the activities in the Indonesian exclusive economic zone included in the class of crime referred to in Article 21 paragraph (4) b Code Aacara Criminal Law. The provisions of the legislation above do not provide optimal protection in maintain and restore the state assets of IUU fishing by corporate actors with foreignflagged fishing vessels that are not few in number. Thus, to thefore in the long term Indonesia need to consider their policies and new breakthrough on the prevention and combating IUU fishing, especially in Indonesian Exclusive Economic Zone against the perpetrators of the corporation, additional policies on corporate responsibility is to give administrative sanction of revocation of license for investment foreign / foreign investors proved to be perpetrators of IUU fishing and for corporate / industrial fisheries are / the place is outside the jurisdiction of Indonesia, which proved to be the perpetrators of IUU fishing can do Mutual Legal Assistance cooperation with related countries for the return of state assets. Additionally opened the international dispute resolution in the field of fisheries in advance before trial fishery so the guarantee given by foreign flag fishing vessels to Indonesia can be maximized in the return of state assets and make IIU Fishing as transnational crime. 8 CONCLUSION At the moment the government is promoting the eradication of IUU fishing in Indonesia, indicated by the operation of IUU fishing on a large scale and involves several agencies, the Navy Indonesian Military Security Agency of the Sea (Bakamla), and the Ministry of Maritime Affairs and Fisheries that are under the coordination of the Coordinating Ministry for maritime and control Bakamla. Even the Government has also established the Task Force on Combating IUU fishing through the Minister of Marine and Fisheries 2014 Task Force on IUU Fishing. 29 Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone, State Gazette No. 44 of 1983, Supplement to State Gazette No. 3260 232 | Asea Uninet Scientific and Plenary Meeting 2016 Law enforcement by the government against IUU fishing in Indonesia Exclusive Economic Zone at this time not provide optimal protection in maintain and restore the state assets of IUU fishing by corporate actors with foreign-flagged fishing vessels that are not few in number. Especially law enforcement action in the form of burning and / or foreign-flag fishing vessel sinking of an Indonesian government policy is only to give deterrent effect to the perpetrators of IUU fishing, 9 SUGGESTION Indonesian Exclusive Economic Zone Marine area are very wide, contains many diverse wealth of natural resources, but recognized until now has not laid out the entire natural resources and put to good use. At the moment, vulnerable control of the vast area of sea Indonesian Exclusive Economic Zone is not comparable to the surveillance capabilities, its need blueprint / white paper on law enforcement in the sea area Indonesian Exclusive Economic Zone in accordance with the provisions of UNCLOS in 1982 which was then applied in the legislation in Indonesia to revise or replace the laws that are not in accordance with the times, and adapted to the provisions of international law in force at the moment. Besides the target of law enforcement against IUU fishing in Indonesia Exclusive Economic Zone Indonesia is more focused on the creation of good cooperation in addressing IUU fishing in Indonesian Exclusive Economic Zone among law enforcement agencies both within agencies / central and local institutions; when the total of personnel investigator of Indonesian Navy Armed Forces and Civil Servant Fisheries Investigators and professional existence is spread evenly throughout the territorial waters of Indonesia and fulfillment support operational facilities and infrastructure for the implementation of security measures for fisheries resources, to protect state assets, and utilize the maximum assets for national development. BIBLIOGRAPHY Agreement between the Ministry of Maritime Affairs and Fisheries, the Indonesian National Police and National Army Navy Indonesia no: KB.05A / DJP2SDKP / 2008, No: NO.POL: B / 325 / II / 2008, No: B / 150 / II / 2008 standard Operating and Handling Procedures Crime Investigation Levels Fisheries, (Jakarta: Directorate Handling Violations, Directorate of Monitoring and Control of Marine Resources and Fisheries, the Ministry of Marine and Fisheries 2009) Answers Interviews with the Ministry of Maritime Affairs and Fisheries, Wednesday, April 22, 2015, 11: 57, law.psdkp <hukum.psdkp@gmail.com Barda Nawawi Arief, Legislative Policy in Combating Crime With Criminal Prison (Semarang, the Agency Diponegoro University Publishers, 1994 Bill Drafting Deputy Secretary General of the Council of Representatives of the Republic of Indonesia, an academic paper on the Draft Law on Courts Fisheries, (Jakarta: Deputy Designers Act, the General Secretariat of the Council of Representatives of the Republic of Indonesia, 2005) Dina Sunyowati, impact of IUU-Fishing activities in Indonesia, Presented at the National Seminar on "Role and Law Enforcement Efforts and Stakeholder In Asea Uninet Scientific and Plenary Meeting 2016 | 233 Handling and Combating IUU Fishing in the Border Region of Indonesia". Cooperation of the Ministry of Foreign Affairs of the Republic of Indonesia, Airlangga University, Surabaya, 22 September 2014 Eric M. Singer, Towards A Sustainable Fishery: The Price-Cap Approach, Tulane Environmental Law Journal, Summer 2011, 24 TLNELJ 253, 24 Tul. Envtl.L.J. 253. Copyright (c) 2011 Fauzi, Akhmad, Fisheries and Maritime Policy. (Jakarta: Scholastic, 2005) Former Chairman of the Supreme Court for Special Crimes, to Djoko, states that "almost all the courts have a number of cases slightly. Except maybe one to two cases per year in Pontianak court and Tanjung Pinang. In North Jakarta, even for two consecutive years no single case. " http://www.bbc.co.uk/indonesia/berita_indonesia/2014/12/141211_indone sia_pengadilan_perikanan, downloadable on January 2015 G.A. Wagey, S. Nurhakim, VPH. Nikijuluw, Badrudin, and T.J. Pitcher, Study of illegal, unreported, and unregulated fishing in the Arafura Sea, Indonesia Year 2009, Sub Legal Department, Directorate General of Marine Fisheries Resources Power, Ministry of Marine and Fisheries, THE REPUBLIC, (Jakarta: Ministry of Maritime Affairs and Fisheries, Wednesday, April 22, 2015, 11:57), law.psdkp <law.psdkp@gmail.com GAO Jianjun, Reasonableness of the Bond under Article 292 of the LOS Convention: Practice of the ITLOS., In http://chinesejil.oxfordjournals.org/content/7/1/115.full.pdf+html. Accessed October 28, 2012. GoBlue Indonesia, http: //www.stop IUU fishing.com, August 17th, 2009, retrieved May 18, 2015 Indonesia, Law No. 5 of 1983 on the Indonesian Exclusive Economic Zone, State Gazette No. 44 of 1983, Supplement to State Gazette No. 3260 ________,Law No. 6 of 1996 concerning Indonesian Waters, State Gazette No. 73, 1996, Supplement to State Gazette No. 3647, Article 24 paragraph (1), Chapter V of Sovereignty and Law Enforcement in Indonesian waters. ________,Law No. 17 of 1985 on Ratification of the United Nations Convention on the Law of the Sea (United Nations Convention on the Law of the Sea), sheet states No. 76 of 1985, Supplement to State Gazette No. 3319 ________,Law No. 6 of 1996 concerning Indonesian Waters, sheet states No. 73, 1996, Supplement to State Gazette No.3647 ________,Law No. 45 of 2009 on the Amendment of Law No. 31 of 2004 on Fisheries, sheet states No. 154 of 2009, Supplement to State Gazette No. 5073 ________,Law No. 8 of 1981 on the criminal procedure law. sheet states No. 76 of 1981, Supplement to State Gazette No. 3209 Legal Development Department, the Navy Headquarters Indonesian Armed Forces, Official Translation of the United Nations Convention on the Law of the Sea (UNCLOS 1982), Permit from the Director of the International Treaty, Political Directorate, Ministry of Foreign Affairs, No. PO 114/93/29, 19 in February 1993, (Jakarta: Legal Development Department, the Navy Headquarters Armed Forces of Indonesia, 2007). Melda Kamil Ariadno, International Law Law of Life: The provisions of International Law on Fisheries, (Jakarta: Diadit Media, April 2007). 234 | Asea Uninet Scientific and Plenary Meeting 2016 Muladi, Capita Selecta Criminal Justice System, (Semarang, the Agency Diponegoro University Publishers, 1995) Mukhtar, Definition of illegal fishing. http://mukhtar-api.com/2011/05/illegalfishing-di-indonesia.html, downloaded 2015 National Law Development Agency, Research on Legal Aspects of Management of Fisheries in the National Water Indonesian Exclusive Economic Zone, (Jakarta: National Law Development Agency 1993/1994). ____________________________, National Law Seminar Fifth Book I, Jurisdiction and Competence Law Enforcement Institutions in the Settlement Law Violations that occur in the Mediterranean waters Jurisdiction (Jakarta: National Law Development Agency, 1990). Research / Interview / Focus Group Discussion, Source: Asep Burhanudin (DG Control of Marine Resources and Fisheries, the Ministry of Maritime Affairs and Fisheries, Research Team Fisheries Research Center, Research and Documentation of the Secretariat General of the Council of Representatives of the Republic of Indonesia, February 23, 2015 Sub-Directorate of Supervision and Control, the Directorate General of Fisheries of the Ministry of Fisheries of the Republic of Indonesia, Research Report: Evaluation Utilization of Fish Resources in the Context of Development and control, (Jakarta: Directorate General of Fisheries Ministry of Fisheries of the Republic of Indonesia, 1995). Yanti Amelia Lewerissa, Practices Illegal Fishing In Maluku waters as a Form of Economic Crime, Sasi Journal Vol.16. 3 In July-September 2010 EFFICIENCY OF BIODIESEL PRODUCTION FROM WASTE TUNA OIL (THUNNUS SP.), SEAWEED KAPPAPHYCUS ALVAREZII AND GRACILARIA SP. Mochammad Amin Alamsjah alamsjah@fpk.unair.ac.id Annur Ahadi Abdillah Hutami Mustikawati Suci Dwi Purnawa Atari Faculty of Fisheries and Marine, Universitas Airlangga, Jl. Mulyorejo, Surabaya, Indonesia, Telp.62-31-5911451, Fax. 62-31-5975641, Abstract Biodiesel has several advantages over solar. Compared to solar, biodiesel has more eco-friendly chraracteristic and produces lower greenhouse gas emissions. Biodiesel that is made from animal fats can be produced from fish oil, while other alternative sources from vegetable oils are seaweed Kappaphycus alvarezii and Gracilaria sp. Waste tuna oil (Thunnus sp.) in Indonesia is commonly a side product of tuna canning industries known as tuna precook oil; on the other hand, seaweed Gracilaria sp. and Kappaphycus alvarezii are commonly found in Indonesia’s seas. Seaweed waste that was used in the present study was 100kg and in wet condition, and the waste oil was 10 litre. The seaweed was extracted with soxhletation method that used n-hexane as the solvent. To produce biodiesel, transesterification was performed on the seaweed oil that was obtained from the soxhletation process and waste tuna oil. Biodiesel manufactured from seaweed K. alvarezii obtained the best score in flash point, freezing point, and viscocity test. However, according to level of manufacturing efficiency, biodiesel from waste tuna oil is more efficient and relatively easier compared to biodiesel from waste K. alvarezii and Gracilaria sp. Keywords: Biodiesel, Waste, Kappaphycus alvarezii, Gracilaria sp., Thunnus sp. 1 INTRODUCTION Petroleum is one of the major energy sources used in many different aspects of our daily life. As the number of motor vehicle increases, so does the consumption of fuel oil (Rachmaniah et al., 2010). This is followed by the earth’s dwindling petroleum supplies as the result of continuous consumption (Zakir et al., 2012). Over the last decade (2002 2012), the petroleum reserves underwent a drop of 92.43 barrel. If there is no effort attempted, this downward trend can deteriorate further, putting the government in difficult situation to fulfil its target production of petroleum at 1.01 million barrel per year (SKK Migas, 2012). The rising consumption of world’s energy and the depletion of fossil fuel reserves as many as 2-3% per year since 2010 can potentially lead to to scarcity of fossil Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 235 236 | Asea Uninet Scientific and Plenary Meeting 2016 fuels in years to come. This energy crisis occurs due to dependence on only one kind of energy resources. The biggest consumption of petroleum lies in diesel or solar (Makmuri, 2002 in Rachmaniah et al., 2010) with total consumption of 173.134 thousand barrel in 2009, and it continued to increase to 174.669 thousand barrel in 2010 (SKK Migas, 2012). The need for solar is highly likely to rise in conjunction with the population growth and economic activity volume. To fulfil the increasing need, it is necessary to improve national refinery capacity. The attempt to boost refinery capacity is not an easy thing to do within relatively short time span because refinery is a capital-intensive investment (Budiman, 2004). Indonesia is one of the fossil fuel producers in the world, yet the country is still importing petroleum to meet the need of petroleum in transportation and energy sectors. Indonesia has changed its status from exporter to net importer of petroleum in 2005 with deficit standing at approximately 100 million liter (Lubis, 2007). In the long run, the petroleum import will dominate the supply of national energy if no government’s policy is enacted to diversify energy sources by taking advantage of renewable sources and others. Using renewable resource is an alternative to fossil fuels that uses biodiesel to replace solar (Handayani, 2010). Biodiesel has several advantages compared to solar; it is more eco-friendly and releases less greenhouse-gas emissions. Biodiesel has several following characteristics: reduction of carbon dioxide emissions by 100%, reduction of carbon monoxide by 10-50%, reduction of hydrocarbon emissions by 10-50%, reduction of polycylic aromatic hydrocarbons (PAH) especially the hazardous ones (Lubis, 2007). Biodiesel can be manufactured from vegetable oils and animal fats (Demisbar, 2008), which are renewable resources. Biodiesel from animal fats can be produced from fish oil. Fish oil in Indonesia is commonly a side product of tuna canning industries known as tuna precook oil. Tuna precook oil is usually sold with cheap price to paint industries, wood coating industries, animal feed industries; it is even left unused. Another resource widely found in Indonesia’s seas is macroalgae Gracilaria sp. It is a species of seaweed that can live in either estuary or fish farm with its original habitat in sea (Hasanah, 2007). According to Mubarak et al. (1998) in Kadi (2004), the distribution area of seaweed Gracilaria in Indonesia reaches 255 km2. Gracilaria is a kind of seaweed that can be cultivated easily with harvesting time around 2-2.5 months and with net production of 1500-2000 kg dried seaweed/acre (Pusat Penyuluhan Kelautan dan Perikanan, 2011). According to Syahid et al. (2006) in Hendrajat et al. (2010), Gracilaria is cultivated by many farmers because of its cheap cost of fish seeds, availability, and easy rearing. Kappaphycus alvarezii is a seaweed that is cultivated by many people and widely distributed in almost all Indonesia’s seas. Many biodiesel research studies have investigated biodiesel production from microalgae and, accordingly, there is a paucity of biodiesel studies on macroalgae or seaweed as raw material for biodiesel production (Zakir et al., 2012). The present study was carried out to understand the efficiency comparison of biodiesel from different materials: biodiesel from vegetable waste (seaweed Gracilaria sp. and K. alvarezii), biodiesel from fish waste (waste tuna oil), biosolar and combination of biodiesel from seaweed or from waste tuna fish with biosolar. Biodiesel efficiency can be known by conducting flash point, freezing point, and viscosity test. Asea Uninet Scientific and Plenary Meeting 2016 2 2.1 | 237 MATERIALS AND METHOD Materials The equipment used in the present study was grinder machine and blender to grind seaweed, soxhlet, flat bottom to do extraction with the methods of soxhletation, beaker glass to take and measure solvent that would be used, funnel to put liquid n-hexane into soxhlet, magnetic stirer to perform homogenity when esterification process took place, heater to heat during the transesterification process as well as to vaporize n-hexane, pipette to separate ester and glycerol that would be mixed, thermometer to measure temperature on reaction, volumetric pipette to take biodiesel and biosolar that would be mixed, pH meter to measure the last pH of ester, scale to weigh the used materials, firelighter, timer, wick, bunsen, freezer, test tube and test tube shelf to perform biodiesel efficiency test The materials used in the present study were waste seaweed Gracilaria and Kappaphycus, waste tuna oil, n-hexane, KOH, methanol, filter paper, thread, and pH universal. 2.2 Method Method of study is used to solve a problem that can be done by collecting data from observation, survey, or test (Kusriningrum, 2012). The method used in the present study was experimental method. Experimental method is a planned effort to disclose new facts or to strengthen a new theory, even to counter the existing researches’ results (Srigandono, 1987 cited in Mufarihin et al., 2012). The present study was done by observing and comparing biodiesel efficiency with flash point, freezing point, and biodiesel viscosity as the tested parameters. Seaweed waste that was used in the present study was 100kg and in wet condition, and the waste oil was 10 liter. The seaweed was extracted with soxhletation method that used n-hexane as the solvent. To produce biodiesel, transesterification was performed on the seaweed oil that was obtained from the soxhletation process and waste tuna oil. 3 RESEARCH DESIGN The experimental design used in the present study was completely randomized design. Completely Randomized Design is used if media and experiment materials are uniform or can be considered uniform (Kusriningrum, 2012). It consists of nine groups of treatment and three replications. According to Kusriningrum (2012), the formula used to determine the number of replications done is: t (n-1) ≥ 15 Denotation : t = total of treatments ; n = number of replications The detail explanation of treatment that was used in the present study is as follows: P0 : Biosolar 100%; P1 : Biodiesel waste seaweed Gracilaria 100 %; P2 : Biodiesel waste seaweed Gracilaria 75% and Biosolar 25%; P3 : Biodiesel waste seaweed Gracilaria 50% and Biosolar 50%; P4 : Biodiesel waste seaweed Gracilaria 25% and Biosolar 75%; P5 : Biodiesel waste seaweed Kappaphycus 100%; P6 : Biodiesel waste seaweed Kappaphycus 75% and Biosolar 25%; P7 : Biodiesel waste seaweed Kappaphycus 50% and Biosolar 50%; P8 : Biodiesel waste seaweed Kappaphycus 25% and Biosolar 75%; P9 238 | Asea Uninet Scientific and Plenary Meeting 2016 : Biodiesel waste tuna oil 100%; P10 : Biodiesel waste tuna oil 75% and Biosolar 25%; P11 : Biodiesel waste tuna oil 50% and Biosolar 50%; P12 : Biodiesel waste tuna oil 25% and Biosolar 75%; The variables in the present study are as follows. Independent Variable : Biodiesel seaweed (100%, 75%, 50% dan 25%) Biodiesel fish oil (100%, 75%, 50% dan 25%) Controlled Variable : methanol, KOH Dependent Variable : Flash point (°C), freezing point (°C) and viscocity (cSt) 4 MATERIAL COLLECTION As many as 100 kg waste seaweed was washed in fresh water to remove dirt and sands attached to seaweed until it was free from unwanted materials. The clean seaweed was dried in the sun for about 10 days. Then, the waste seaweed was ground with grinder machine and blender until it became flakes in order to extract the oil. Waste tuna oil was obtained from side product of tuna canning industry known as tuna precook oil. 4.1 Biodiesel Extraction The oil extraction process was done with soxhletation method that used n-hexane solvent. Seaweed waste, that would be extracted, was weighted up to 45 gr dried seaweed for each tube. After that, the dried seaweed was wrapped with filter paper tightened with thread. The seaweed in filter paper was transferred to soxhlet tube. The soxhlet process of seaweed to extract the oil required 250 ml of n-hexane as the solvent, and it was placed in the flat bottom. Then, soxhlet machine was turned on, and the machine temperature was adjusted to the used solvent temperature. For n-hexane solvent, the temperature used was 82°C. During the extraction process, the liquid’s colour of n-hexane would turn into green as the result of extraction. Extraction process was marked with the liquid of n-hexane that was dripping in the soxhlet tube until its colour changed into transparent. Afterwards, tha nhexane solvent was vaporized on the heater so that the oil, the result of waste seaweed extraction, was obtained. The same procedure was also applied to the waste tuna oil (Thunnus sp.), where the obtained waste tuna oil was filtered, and continued to the soxhletation process with n-hexane solvent. 4.2 Transesterification The obtained oil from waste seaweed and tuna was put in the beaker glass and heated with heater. In the transesterification process, the produced oil liquid was added with 40 % methanol liquid, which had been mixed with KOH 2% as the catalyst. During the heating, the temperature was maintained at around 55-60oC for 60 min. Consequently, the main product ester on the upper side and the side product glycerol on the bottom part of ester appeared. The side product was, then, separated from ester so that the main product for biodiesel was taken. Asea Uninet Scientific and Plenary Meeting 2016 4.3 | 239 Biodiesel Efficiency Test Biodiesel efficiency test could be proven with flash point, freezing point, and viscosity test. The initial testing was conducted with the help of nine panellists, followed by laboratory test. The panellist flash point test was done by placing 5 ml of sample in each petri dish with wick. Every wick in bunsen was lighted with firelighter, and the time of which wick that ignited first was counted. Freezing point test was carried out by inserting 3 ml of sample into test tube and storing it in the freezer. Then, an observation was made on how long it took to reach freezing point at temperature (-18°C). Viscosity test was performed by counting the flow time from each treatment put in the titration instrument. Laboratory analysis was also done in the laboratory of fuel and combustion owned by mechanical engineering department, Faculty of Industrial Technology, Institute of Techology Sepuluh November, Surabaya. The laboratory test showed dynamic viscosity of biodiesel. To change it into kinematic viscosity so it could be compared with SNI requirements, the following formula was applied: Denotation : µ kinematic = kinematic viscocity (cSt) µ dynamic = dynamic viscocity (cp) p product = product density (gr/ml) Figure 7. Conversion Formula Kinematic Viscocity (Laksono, 2013) Parameter Main Parameter The main parameter that was observed was flash point, freezing point, and viscocity. Supporting parameter The supporting parameter in the present study was pH. 240 | Asea Uninet Scientific and Plenary Meeting 2016 5 RESULTS AND DISCUSSION 5.1 Results A. Biodiesel Flashpoint Table 1. The Panelist Test Result and Biodiesel Flash Point Average of Gracilaria sp., Kappaphycus alvarezii, and waste tuna oil Paneli st P0 P1 P2 P3 P4 P5 P6 P7 P8 P9 P1 0 P1 1 P1 2 1 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 4.00 4.0 0 3.6 7 4.0 0 3.0 0 4.0 0 3.0 0 4.0 0 3.6 7 3.0 0 3,5 9 3.0 0 3.3 3 3.6 7 4.0 0 4.0 0 3.0 0 3.0 0 3.3 3 4.0 0 3.4 8 3.0 0 3.6 7 3.0 0 3.6 7 3.0 0 3.0 0 3.3 3 3.0 0 3.0 0 3.1 9 5.00 4.00 5.00 4.00 5.00 4.00 5.00 5.00 5.00 5.00 5.00 4.00 5.00 5.00 5.00 4.00 5.00 4.00 5.00 4.33 3.0 0 3.3 3 4.0 0 3.0 0 4.0 0 3.0 0 4.0 0 3.0 0 4.0 0 3.4 8 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 4.0 0 4.0 0 3.0 0 3.2 2 5.0 0 4.6 7 5.0 0 5.0 0 4.6 7 5.0 0 5.0 0 5.0 0 5.0 0 4.9 3 5.0 0 3.3 3 4.0 0 5.0 0 5.0 0 4.0 0 3.6 7 4.6 7 4.0 0 4.3 0 3.0 0 4.0 0 3.6 7 3.0 0 4.0 0 3.0 0 4.0 0 3.0 0 4.0 0 3.5 2 3.0 0 4.0 0 3.0 0 3.0 0 4.0 0 3.0 0 3.0 0 2.0 0 3.0 0 3.1 1 74. 1 115. 1 95. 1 89. 8 77. 4 120. 1 110. 9 87. 9 78. 7 11 7 99. 8 86. 9 78. 4 2 3 4 5 6 7 8 9 Avera ge score of paneli st test Avera ge flash point (°C) 4.00 4.00 4.00 4.67 4.67 4.00 4.00 4.00 4.15 Description: P0 = Biosolar 100%; P1 = Biodiesel Gracilaria sp. 100%; P2 = Biodiesel Gracilaria sp. 75% and biosolar 25%; P3 = Biodiesel Gracilaria sp. 50% and biosolar 50%; P4 = Biodiesel Gracilaria sp. 25% and biosolar 75%; P5 = Biodiesel K. alvarezii 100 %; P6 = Biodiesel K. alvarezii 75% and biosolar 25%; P7 = Biodiesel K. alvarezii 50% and biosolar 50%; P8 = Biodiesel K. alvarezii 25% and biosolar 75%; P9 = Biodiesel waste tuna oil 100%; P10 = Biodiesel waste tuna oil 75% and biosolar 25%; P11 = Biodiesel waste tuna oil 50% and biosolar 50%; P12 = Biodiesel waste tuna oil 25% and biosolar 75%; Score 1 = Not ignited; Score 2 = Dimmed red flame; Score 3 = Red flame with black smoke; Score 4 = Bluish red flame; Score 5 = Blue flame Asea Uninet Scientific and Plenary Meeting 2016 | 241 From the panelist test result, it is known that the one which had the highest flash point from Gracilaria sp. is P5, biodiesel seaweed K. alvarezii 100 % was in accordance with the panelist test result score of 5.00. P5 produced blue flame with longer combustion time compared to other treatments. The statistic test result with Friedman test showed lower significant score from 0.05 (P<0.05) with ranking average score among treatments. Interestingly, P0 with biosolar 100% indicated a result with the lowest flash point at 77.4°C and along with the panelist score of 3.00. B. Biodiesel Freezing Point Table 2. Panelist Test Result and Freezing Point Average of Biodiesel Gracilaria sp., Kappaphycus alvarezii, and waste tuna oil Paneli st P0 P1 P2 P3 P4 P5 P6 P7 P8 P9 P1 0 P1 1 P1 2 1 4.0 0 4.0 0 4.3 3 4.0 0 4.0 0 4.6 7 4.0 0 4.0 0 4.3 3 2.0 0 1.0 0 1.0 0 1.3 3 1.3 3 1.6 7 1.0 0 1.0 0 1.6 7 1.3 3 2.0 0 3.6 7 2.0 0 2.3 3 3.0 0 3.6 7 3.0 0 2.0 0 2.0 0 2.6 3 3.0 0 3.6 7 3.6 7 4.0 0 3.3 3 3.6 7 3.6 7 4.0 0 3.0 0 3.5 6 4.0 0 3.6 7 4.0 0 4.0 0 4.0 0 3.6 7 4.0 0 3.6 7 4.0 0 3.8 9 1.0 0 1.0 0 1.0 0 1.3 3 1.0 0 1.0 0 1.0 0 1.3 3 1.0 0 1.0 7 2.0 0 2.0 0 2.0 0 3.0 0 2.3 3 2.0 0 2.0 0 2.0 0 2.0 0 2.1 5 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 4.0 0 3.0 0 3.0 0 3.0 0 3.1 1 4.0 0 3.0 0 4.0 0 4.0 0 3.3 3 4.0 0 3.6 7 4.0 0 4.0 0 3.7 8 1.3 3 1.0 0 1.3 3 1.3 3 1.0 0 1.0 0 1.0 0 1.0 0 1.0 0 1.1 1 3.0 0 3.0 0 2.0 0 3.0 0 2.3 3 2.0 0 3.3 3 2.0 0 2.0 0 2.5 2 4.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.6 7 4.0 0 3.3 0 4.0 0 3.6 7 4.0 0 4.0 0 3.6 7 4.0 0 3.6 7 4.0 0 4.0 0 3.9 0 3.2 3.5 4.5 4.6 2.6 2.8 3.6 4.3 3.8 4.0 4.2 4.8 2 3 4 5 6 7 8 9 Avera ge score of paneli st test Freezi ng Point Avera ge (°C) 4.1 5 5.0 Description: P0 = Biosolar 100%; P1 = Biodiesel Gracilaria sp. 100%; P2 = Biodiesel Gracilaria sp. 75% and biosolar 25%; P3 = Biodiesel Gracilaria sp. 50% and biosolar 50%; P4 = Biodiesel Gracilaria sp. 25% and biosolar 75%; P5 = Biodiesel K. alvarezii 100 %; P6 = Biodiesel K. alvarezii 75% and biosolar 25%; P7 = Biodiesel K. alvarezii 50% and 242 | Asea Uninet Scientific and Plenary Meeting 2016 biosolar 50%; P8 = Biodiesel K. alvarezii 25% and biosolar 75%; P9 = Biodiesel waste tuna oil 100%; P10 = Biodiesel waste tuna oil 75% and biosolar 25%; P11 = Biodiesel waste tuna oil 50% and biosolar 50%; P12 = Biodiesel waste tuna oil 25% and biosolar 75%; Score 1 = Frozen completely; Score 2 = Started to freeze; Score 3 = Crystalline solids were found in sample test; Score 4 = Dewdrops were found on the surface of test tube; Score 5 = Still liquid According to the panelist test result, the one that had the highest freezing point is P0 biosolar 100%, and the one with the lowest point is P5 biodiesel K. alvarezii 100 %. This indicates that biodiesel K. alvarezii 100 % can freeze easily at the temperature -2.6°C in storage place condition with low temperature. C. Biodiesel Viscocity Table 3. Panelist Test Result and The Viscocity Average of Biodiesel Gracilaria sp., Kappaphycus alvarezii, and waste tuna oil Panelis t P0 P1 P2 P3 P4 P5 P6 P7 P8 P9 P1 0 P1 1 P1 2 1 5.0 0 5.0 0 5.0 0 4.6 7 4.0 0 5.0 0 5.0 0 4.6 7 5.0 0 3.7 0 3.0 0 3.0 0 3.0 0 3.0 0 3.3 3 3.0 0 3.0 0 3.0 0 3.0 0 3.0 4 3.0 0 5.0 0 3.0 0 3.0 0 4.6 7 3.0 0 5.0 0 4.6 7 3.0 0 3.8 2 5.0 0 5.0 0 4.6 7 5.0 0 4.0 0 5.0 0 5.0 0 5.0 0 5.0 0 4.8 5 5,0 0 5,0 0 5,0 0 5,0 0 4,3 3 5,0 0 5,0 0 5,0 0 4,6 7 4.8 9 3.0 0 2.6 7 3.0 0 3.0 0 2.6 7 3.0 0 2.6 7 3.0 0 3.0 0 2.8 9 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 4.0 0 4.0 0 3.0 0 4.0 0 4.0 0 3.0 0 4.0 0 3.5 6 4.6 7 5.0 0 5.0 0 4.6 7 5.0 0 4.6 7 4.0 0 5.0 0 5.0 0 4.7 8 2.0 0 3.0 0 3.0 0 3.0 0 2.0 0 3.0 0 2.0 0 3.0 0 3.0 0 2.6 7 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 3.0 0 4.0 0 3.0 0 3.0 0 3.0 0 4.0 0 3.2 0 4.0 0 5.0 0 5.0 0 4.0 0 4.0 0 4.6 7 5.0 0 4.6 7 4.0 0 4.4 8 3.4 5 3.6 3 3.5 3 3.4 8 3.4 7 3.7 5 3.6 1 3.5 4 3.4 6 3.6 7 3.5 5 3.4 9 3.4 6 2 3 4 5 6 7 8 9 Averag e score of panelist test Viscoci ty Averag e (cSt) Description: P0 = Biosolar 100%; P1 = Biodiesel Gracilaria sp. 100%; P2 = Biodiesel Gracilaria sp. 75% and biosolar 25%; P3 = Biodiesel Gracilaria sp. 50% and biosolar 50%; P4 = Biodiesel Gracilaria sp. 25% and biosolar 75%; P5 = Biodiesel K. alvarezii 100 %; P6 = Biodiesel K. alvarezii 75% and biosolar 25%; P7 = Biodiesel K. alvarezii 50% and Asea Uninet Scientific and Plenary Meeting 2016 | 243 biosolar 50%; P8 = Biodiesel K. alvarezii 25% and biosolar 75%; P9 = Biodiesel waste tuna oil 100%; P10 = Biodiesel waste tuna oil 75% and biosolar 25%; P11 = Biodiesel waste tuna oil 50% and biosolar 50%; P12 = Biodiesel waste tuna oil 25% and biosolar 75%; Score 1 = Very thick; Score 2 = Too watery; Score 3 = Thick; Score 4 = Watery; Score 5 = A little bit watery From the panelist test result, it is noticed that the one with the highest viscosity from biodiesel Gracilaria is P5, is biodiesel K. alvarezii 100 % with laboratory rest result of 3.75 cSt, while the lowest viscocity belongs to P0 Biosolar 100% with the score of 3,45 cSt. According to Indonesian National Standard/Standart Nasional Indonesia (SNI), the minimum flash point for biodiesel is 100°C and 60°C for biosolar, while the viscosity score must be in the range of 2.3-6.0 cSt for biodiesel and 2.0-5.0 cSt for biosolar. Referring to the laboratory test result on flash point, freezing point, and viscosity, biodiesel K. alvarezii 100 %, biodiesel K. alvarezii 75% and biosolar 25%, biodiesel Gracilaria sp. 100% as well as biodiesel waste tuna oil 100% fulfilled the SNI requirement for flash point > 100°C. Interestingly, all treatments carried out in the present study fulfilled the flash point standard as biosolar and viscosity value of biodiesel and biosolar. The same result was also discovered in pH measurement result where normal or neutral score of pH 7 was obtained in all treatments of biodiesel. 6 DISCUSSION The test parameters used to discover the efficiency of biodiesel used are flash point, freezing point, and viscosity. Flash point is a measure that indicates the lowest temperature at which the surface of fuel will flash upon application of ignition source (Siswani et al., 2012). The more biosolar composition a treatment has, the lower flash point it has. In the combination treatment of biosolar, each has flash point that has fulfilled the biosolar standard issued by PT. Pertamina (Persero) in 2007, stating that the minimum flash point of biosolar fuel is 60°C. The result of panelist and laboratory tests showed that the volatility level is lower and flash point temperature is higher when the time needed for combustion is longer. Flash point indicates volatility level and biodiesel’s ability to combust because of a fuel (Setiawati and Edwar, 2012). Low volatility is property of biodiesel that can reduce combustion speed, resulting in high flash point (Fajar, 2012). Flash point is also affected by respective fuel viscosity. Low viscosity will lead to poor atomization (Wahyuni, 2007). Extremely high flash point of fuel can cause ignition delay, while extremely low flash point can result in small explosion before the fuel goes to combustion room (Christina et al., 2010 in Laksono, 2013). Based on quality, compared to biosolar, biodiesel has higher flash point which causes it to combust longer when ignited. Nevertheless, biodiesel K. alvarezii 100 %, biodiesel K. alvarezii 75% and biosolar 25%, biodiesel Gracilaria sp. 100% as well as biodiesel waste tuna oik 100% have better flame quality and more lasting flame than those of biosolar when ignited. It is also noticeable that bisolar has red flame mixed with black smoke, indicating significant pollution caused by biosolar combustion. This converges with the statement of Handayani (2010) saying that biodiesel is more eco-friendly because it contains no Sox emissions, has low toxicity, low CO and hydrocarbon emissions (Wahyuni, 2007). Flash point is required for the safety purpose in handling oil that is prone to fire risks (Wardan dan Zainal, 2003 in Siswani et al., 2012). After seeing the flash point result of biodiesel biodiesel K. alvarezii 100 %, biodiesel K. alvarezii 75% and biosolar 25%, biodiesel Gracilaria sp. 100% as well as biodiesel waste tuna oil 100% which has the highest flash point, it can be said that both biodiesel are in safe limits towards fire risk during storage, handling, and transportation. 244 | Asea Uninet Scientific and Plenary Meeting 2016 Freezing point is a temperature characteristic where biodiesel turn into solid, not liquid anymore (Boz et al., 2009). The more biosolar composition a treatment has, the lower freezing point it has. Biodiesel K. alvarezii, biodiesel Gracilaria sp. and biodiesel waste tuna oil in the present study have good freezing point characteristic because the freezing point is below 0°C, so they can be used in areas with low or cold temperature like Europe and are still safe to be used in tropical areas. In general, cloud and pour point of biodiesel is higher than solar, so is the freezing point. This can cause a problem in the use of biodiesel especially in countries that have winter. To overcome this problem, certain additives are usually added to biodiesel in order to prevent agglomeration. Crystals can appear in biodiesel in low temperature. In addition to additives, mixing biodiesel and solar is another possible alternative (Environment Canada, 2007). Viscocity is a number that indicates fluid’s resistance to flow (Wardan and Zainal, 2003 in Siswani et al., 2012 ) or the required time to flow within certain distance (Lubis, 2007). The viscosity test in the present study revealed that the biodiesel in the present study fulfils the biodiesel quality requirement based on SNI-04-7182-2006, stating that viscosity of biodiesel fuel is 2,3-6,0 cSt and biosolar fuel viscocity is 2,0-5,0 cSt. The high or low score of kinematic viscosity is influenced by the thickness of the respective fuel. On thickness, catalyst type and excessive concentration in transesterification triggered soap reaction, resulting in varied biodiesel density values. With the increasing level of triglyceride conversion into methyl ester, the biodiesel density will decline because the methyl ester density is lower than triglyceride density (Laksono, 2013). The higher the viscosity is, the thicker and more difficult a fluid will flow (Wardan and Zainal, 2003 in Siswani et al., 2012). The viscosity data explain the role and purpose of oil-fat conversion to ester (biodiesel), which is to reduce the viscosity so that it fulfills the diesel fuel requirements. The mixture of biodiesel fuel and biodiesel seaweed, waste tuna oil, and biosolar in various compositions induces dwindling thickness value towards biodiesel viscosity fuel. The varied biosolar composition in combination generates lower viscosity, so the fuel turns out to be more watery, enabling smoother flow during pumping/supplying process of fuels from tank to combustion room. Biodiesel viscosity is affected by the unresponsive triglyceride content towards some chemical compounds. These chemical compounds are methanol, fatty acid methyl ester compositions of biodiesel, intermediate substances such as monoglyceride and diglyceride that have quite high polarity and molecular weight (Listiawati, 2007). Some other contributing factors are position and number of double bonds (unsaturation degree) in biodiesel as well as type of alcohol used in estrans process (Knothe dan Steidley, 2005 in Listiawati, 2007). The correlation between the three test parameters (flash point, freezing point, and viscosity on biodiesel) revealed that higher flash and freezing point caused higher viscosity. This is in line with Wahyuni (2007), who stated that low fuel flow leads to poor fuel atomization. Several types of biodiesel have relatively higher viscosity and need combustion heat in order to stimulate atomization in combustion room. Higher viscosity results in poor atomization; hence, the flash point of the fuel becomes higher. According to Wahyuni (2007), biodiesel is an ester that tends to swell polymeric materials; hence, if the 100% polymeric materials are used, they have to be replaced with other materials that are resistance to ester. Therefore, as an alternative of use, a mixing between biodiesel and solar is done, considering that many otomotives used polymeric materials as fuel pipes or leak sealer. Another biodiesel’s disadvantage lies in its storage period. According to Romano and Sorichetti (2011), biodiesel is less stable than diesel fuel, so it will break down for long term storage (six months). The arising problem of storing biodiesel for extended periods of Asea Uninet Scientific and Plenary Meeting 2016 | 245 time is hydrolytic and oxidative degradation. Biodiesel tends to have high flash point and viscosity, causing poor combustion and machine endurance (Wahyuni, 2007). Moreover, if it is used in large percentage, biodiesel has solvency characteristics. Usually sediments and crusts are formed in storage tank as the result of the solar use in diesel machine. The most common encountered problem with biodiesel’s solvency is that it can dissolve these sediments and crusts. Consequently, this can clog the fuel system and the fuel filters. The solvency effect of fuels that have biodiesel mixture will plunge as the biodiesel level in fuels declines (Lubis, 2007). As for price comparison, the efficiency comparison of using biodiesel from seaweed and waste fish oil is very profitable. Similarly, the availability of both materials is quite plentiful, so there will not be any problem in continuous biodiesel production. Based on those several aspects, the most efficient material to be used as an alternative source in biodiesel manufacturing is seaweed K. alvarezii 100%. In order to suppress the production cost with seaweed material of K. alvarezii and to prevent competition with people’s consumption needs, it is better to use seaweed K. alvarezii of low quality or the sorting result from processing factories of seaweed K. alvarezii. The flash point parameter demonstrated that the amount of exhaust emissions in the form of smock density experienced a decrease, proving that biodiesel seaweed waste is more eco-friendly than biosolar. Generally, diesel exhaust gasses contain particulates due to unclean fuel factor. (Suhartanta and Arifin, 2008). The components of those hazardous gasses are black smokes, unburned hydrocarbon (UHC), carbon monoxide (CO), nitrogen oxide (NO) and NO2 commonly indicated with NOx (Arismunandar, 2002 in Saifulloh, 2013). The high flash point, which was caused by high level of heat to ignite fire, engendered ignition and combustion delay of fuels so that fire risk is smaller. This is in accordance with the statement of Mahfud et al. (2012), who explained high flash point eases managing and storing fuels because fuels need not to be stored at low temperature. Conversely, if the flash point is too low, it is more dangerous because it has higher risk during ignition; thus, it must be stored at low temperature. Azis (2010) mentioned that high flash point causes fuels take longer time to combust. All previous explanations emphasize that seaweed K. alvarezii can become alternative fuel replacement for biosolar. The other parameter to determine biodiesel quality is viscosity. Viscocity is important to be tested because excessively high viscosity can disrupt the performance of vehicle injection apparatus. Knothe (2006) explained that high viscosity can damage the injection tool of vehicle, and tends to produce deposits in combustion tank. Zakir et al. (2012) stated that viscosity plays an important role in lubrication of frictions between the moving parts and wear. The result of biodiesel production from K. alvarezii revealed the highest viscosity score at temperature of 400C is 3.75 cSt, making biodiesel K. alvarezii the best fuel alternative to use in diesel machine. Wardan and Zainal (2003) in Siswani (2012) explained that the higher the viscosity is, the thicker and the more difficult a fluid flow. Furthermore, excessively high viscocity hampers carburetion process (Azis, 2010). Likewise, high freezing point will cause machine not to operate at low temperature. The result of the biodiesel production from K. Alvarezii showed the freezing point is at temperature -2.60C. This highlighted that biodiesel K. alvarezii can be considered the best biodiesel compared to Gracilaria and waste tuna oil in tropical regions. Freezing point is not an important indicator to determine fuel standard in tropical areas like Indonesia, but freezing point can play a significant role when this fuel is used in countries with four seasons because fuels with high freezing point need heater to maintain oil remain liquid to be easily transferred to combustion chamber. However, according to efficiency of manufacturing procedure, biodiesel waste tuna oil is more efficient than biodiesel K. alvarezii because waste tuna oil can be found 246 | Asea Uninet Scientific and Plenary Meeting 2016 easily in markets or tuna canning factories. It is not the same as biodiesel K. alvarezii where extracting the oil requires soxhletation method and takes long time in order to produce biodiesel concentration. 7 CONCLUSION Based on the result of biodiesel efficiency comparison, it can be concluded that biodiesel seaweed K. alvarezii, Gracilaria sp. and waste tuna oil can become biodiesel production materials. Biodiesel seaweed K. alvarezii scored the best in flash point, freezing point, and viscosity test. However, if both are compared in terms of efficiency level, biodiesel waste tuna oil is more efficient than biodiesel K. alvarezii because biodiesel manufacturing process is more obtainable from waste tuna than seaweed K. alvarezii. On the other hand, it is necessary to discover extraction technology that enables to manufacture biodiesel efficiently with seaweed materials. REFERENCES Azis, I. (2010). Uji Perfomance Mesin Diesel Menggunakan Biodiesel dari Minyak Goreng Bekas. Jurnal. Jurusan Kimia. Fakultas Sains dan Teknologi. UIN Syarif Hidayatullah Jakarta. Jakarta. pp. 291-297. Boz, N., Kara, M., Sunal. O., Alptekin, E and Degirmenbasi, N. (2009). Investigation of the Fuel Properties of Biodiesel Produced Over an Alumina-Based Solid Catalyst. Turk J Chem. Vol.33 (3), 433-442. Budiman, B. T. (2004). Penggunaan Biodiesel Sebagai Bahan Bakar Alternatif. Rumusan Hasil Seminar Prospek Biodiesel di Indonesia, 12 Agustus 2004. Serpong. 16 pp. Demisbar, A. (2008). Biodiesel a Relactic Fluel Alternative for Diesel Engines. Springer. Turkey. pp. 100-129 Environment Canada (2006). Biofluels and Biotechnology. Fact Sheet Series on Innovative Technologies-2006. http://www.cielap.org/pdf. 30 Desember 2013. 4 p. Fajar, R. (2012). Re-Formulasi Biodiesel Jatropha Curcas L.: Optimasi Key-Properties dengan Modifikasi Komposisi Fame (Fatty Acid Methyl Esters) dan Karakterisasi Pembakaran pada Motor Diesel. Disertasi. Program Studi Teknik Mesin. Fakultas Teknik. Universitas Indonesia. Depok. 118 pp. Handayani, S. P. (2010). Pembuatan Biodiesel dari Minyak Ikan dengan Radiasi Gelombang Mikro. Skripsi. Fakultas Matematika Dan Ilmu Pengetahuan Alam. Universitas Sebelas Maret. Surakarta. 38 pp. Hasanah, R. U. (2007). Pemanfaatan Rumput Laut (Gracilaria sp.) dalam Peningkatan Kandungan Serat Pangan pada Sponge Cake. Skripsi. Program Studi Teknologi Hasil Perikanan. Fakultas Perikanan dan Ilmu Kelautan. Institut Pertanian Bogor. Bogor. 79 pp. Hendrajat, E.A., Pantjara, B. and Mangampa, M. (2010). Polikultur Udang Vannamei (Litopenaeus vannamei) dan Rumput Laut (Gracilaria verrucosa). Prosiding Forum Innovasi Teknologi Akuakultur. 6 pp. Kadi, A. (2004). Potensi Rumput Laut Dibeberapa Perairan Pantai Indonesia. Oseana Vol.29 (4), 25 – 36. Knothe , G. (2006). Analyzing Biodiesel: Standards and Other Methods. JAOCS, Vol.83 (10), 823-833. Kusriningrum (2012). Perancangan Percobaan. Fakultas Kedokteran Hewan Universitas Airlangga. Surabaya. pp. 15-20. Asea Uninet Scientific and Plenary Meeting 2016 | 247 Laksono, T. (2013). Pengaruh Jenis Katalis NaOH dan KOH serta Rasio Lemak dengan Metanol terhadap Kualitas Biodiesel Berbahan Baku Lemak Sapi. Skripsi. Program Studi Teknologi Hasil Ternak. Jurusan Produksi Ternak. Fakultas Peternakan. Universitas Hasanuddin. Makassar. 65 pp. Laurent, B.K. and Wirasanti, D. (2011). Pra Perancangan Pabrik Biodiesel dari Mikroalgae Chlorella sp. dengan Proses Esterifikasi dan Transesterifikasi Kapasitas Produksi 100.000 Ton / Tahun. Jurusan Teknik Kimia. Fakultas Teknik. Universitas Diponegoro. Semarang. 8 pp. Listiawati, A.P. (2007). Pengaruh Kecepatan Sentrifugasi terhadap Karakteristik Biodiesel Jarak Pagar (Jatropha curcas L.). Skripsi. Fakultas Teknologi Pertanian. Institut Pertanian Bogor. Bogor. 101 pp. Lubis, S.S. (2007). Studi Pengaruh Pencampuran Biodiesel Jarak Pagar dengan Solar terhadap Perubahan Karakteristik Fisikanya. Tesis. Program Studi Magister Ilmu Fisika. Universitas Sumatera Utara. 66 pp. Mahfud, M., Pramudita, R.A. and Marwanto, A. (2012). Pengaruh Metode Pencucian Pada Pembuatan Biodiesel Dari Minyak Jarak Pagar. Jurnal. Teknik Kimia. Fakultas Teknik Industri. Institut Teknologi Sepuluh November. Surabaya. pp. 219-227. Mufarihin, A., Lukiwati, D. R. and Sutarno (2012). Pertumbuhan dan Bobot Bahan Kering Rumput Gajah dan Rumput Raja Pada Aras Auksin yang Berbeda. Animal Agriculture Journal Vol.1 (12): 1-15. PT. Pertamina (Persero) (2007). Material Safety Data Sheet (MSDS). http://cdm.unfccc.int/filestorage/p/b/PJNQITL498H6OUCYGER2MZ0FK3XBS 7.pdf/Solar (english). 18 Februari 2014. 8 pp. Pusat Penyuluhan Kelautan dan Perikanan. (2011). Budidaya Rumput Laut. Pusat Penyuluhan Kelautan dan Perikanan. Jakarta. pp. 21-22 Rachmaniah, O., Yosta, E. and Harimurti, D. (2010). Ekstraksi Minyak Alga Spirulina sp. Menggunakan Metode Osmotik dan Perkolasi dan Pengaruhnya terhadap Komponen-komponen teresktrak. Fakultas Teknologi Industri. Institut Teknologi Sepuluh November. Surabaya. 12 pp. Romano, S. D and Sorichetti, P.A. (2011). Dielectric Spectroscopy in Biodiesel Production and Characterization, Green Energy and Technology. Springer-Verlag, London. pp. 7-8. Saifulloh, M.M. (2013). Karakterisasi Unjuk Kerja Mesin Diamond Type di 800 Sistem Injeksi Bertingkat Berbahan Bakar Biodiesel Kemiri Sunan dengan Perubahan Camshaft Fuel Pump. Tugas Akhir. Jurusan Teknik Mesin. Fakultas Teknologi Industri. Institut Teknologi Sepuluh Nopember. Surabaya. 61 hal. Setiawati, E. and Edwar, F. (2012). Teknologi Pengolahan Biodiesel dari Minyak Goreng Bekas dengan Teknik Mikrofiltrasi dan Transesterifikasi sebagai Alternatif Bahan Bakar Mesin Diesel. Jurnal Riset Industri Vol.6 (2), 117-127. Siswani, E. D., Kristianingrum, S. and Suwardi (2012). Sintesis dan Karakteristik Biodiesel dari Minyak Jelantah pada Berbagai Waktu dan Suhu. Seminar Nasional MIPA FMIPA UNY. Yogyakarta. 10 pp. SKK Migas (2012). Laporan Tahunan 2012. SKK Migas. Jakarta. pp. 45-48. Suhartanta and Arifin, Z. (2008). Pemanfaatan Minyak Jarak sebagai Bahan Bakar Alternatif Mesin Diesel. Jurnal Penelitian Saintek Vol.13 (1), 19-46. Wahyuni, G. (2007). Sintesis Metil Ester (Biodiesel) dari Minyak Biji Kemiri (Aleurites moluccana). Skripsi. Departemen Kimia. Fakultas Matematika dan Ilmu Pengetahuan Alam. Universitas Indonesia. Depok. 103 pp. 248 | Asea Uninet Scientific and Plenary Meeting 2016 Zakir, M., Raya, I. and Asbia (2012). Optimalisasi Proses Sintesis dan Karakteristik Biodiesel dari Minyak Alga Merah (Euchema cottonii) dengan Katalis Kalium Hidroksida (KOH). Indonesia Chimica Acta. Vol.3 (2), 42-54. MAIN CHALLENGES FOR INDONESIA TO BECOME MARITIME FULCRUM Professor Melda Kamil Ariadno Abstract Indonesia is the biggest archipelagic state in the world and has the second longest coastline in world after Canada. This great modality unfortunately not automatically forms Indonesia as the maritime countries, let alone maritime fulcrum as aimed by the current government. This paper tries to point out what are the current conditions of Indonesia, the main challenges to become maritime country as well as the recommendations that need to be taken into consideration by the ruling government as well as the Indonesia people to prepare Indonesia becoming maritime country and eventually maritime fulcrum. Keywords: archipelagic states, maritime country 1 INTRODUCTION In 13 November 2014, President of Indonesia, Mr. Joko Widodo, had given an interesting speech during the 9th East Asia Summit in Myanmar. The message conveyed to the participants of the summit was clear that Indonesia wish to reach its ideal goal as the largest archipelagic state in the world to be the “maritime fulcrum”, the country which is developed based on its maritime activities in various aspects of life. This intention is not easily accomplished because of various existing conditions in Indonesia that are quite away from a picture even as a maritime country. Major issue that is stressed in to achieve Indonesia’s aim is Indonesia’s willpower to rebuild maritime culture, build the maritime food security, build the maritime infrastructure and connectivity, build maritime cooperation as well as to form supremacy in maritime defense, also known as “five grand design” of maritime fulcrum. Such willpower is a clear consequence not least to mention that the majority of Indonesian government regime in the past did not take the sea into notice for quiet a long time, accordingly the “grand design” on marine was never completed up until now. If we try to look at the primary plan of Indonesia to be the “maritime fulcrum” one by one, then the fact that Indonesia as the largest Archipelagic State in the world has unfortunately not guaranteed the successful of Indonesia to be the “maritime fulcrum”. This paper is trying to point out what are hindrances for Indonesia to build up itself as a maritime country and even more what are main challenges to be conquest and eventually to discuss some of strategic recommendations to enable Indonesia becoming the “maritime fulcrum”. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 249 250 | Asea Uninet Scientific and Plenary Meeting 2016 2 MAIN CHALLENGES Indonesia is the largest archipelagic State in the world, consisting more than 17,000 islands, the second largest coastline after Canada and an extensive sea of almost 6 million km2, which includes the archipelagic waters, territorial sea, and exclusive economic zone.30 It started from the creation of Djuanda Declaration 1957 (13 December 1957),31 a unilateral action of Indonesia claiming that the surrounding waters, in between and waters connecting islands within, without looking at width of the water area. Indonesia has created a new regime that did not get any recognition and to fight to get its recognition during the 1st United Nations Conference on the Law of the Sea in Geneva, which then established four Conventions of the Law of the Sea in which Indonesia has failed to obtain its recognition on the claim. Indonesia did not stop there, when in the year 1960, Indonesia formulated Law No. 4 Year 1960 confirming unilateral action against claims on Indonesian archipelago waters where Indonesian baselines is drawn from the outermost point of the outermost islands so that the waters in between are considered as internal waters. It is assured at the time that such claim was not recognized and acquired by the international law of the sea, as baselines could only be drawn from each islands of the low water line, so that the internal waters is the land from the baselines where the territory towards the sea is called territorial sea. Diplomatic struggle was done continuously during the negotiations of the 3rd United Nations Conference on the Law of the Sea that lasted more than ten years until then produced a very comprehensive convention on law of the sea, known as the 1982 United Nations Convention on the Law of the Sea (1982 UNCLOS) ratified by Indonesia through the enactment of Law No. 17 Year 1985, obtaining de jure international recognition on the concept of archipelagic State that has been created and claimed by Indonesia unilaterally for 24 years. A large body of water as such should actually enable Indonesia to become a powerful maritime country with the large territory of sea, almost triple of its land. Extraordinary resources not only the living resources but also includes non living resources, not to mention the fact that international shipping makes Indonesia as the heart of economic intersection of the world where the sea is navigable by a fleet of the world trade since hundreds of years ago. Should the aspiration of President Jokowi is not difficult to achieve, but when we look at the fact that Indonesia is not yet a maritime state, let alone the maritime fulcrum is a big challenge for Indonesia to achieve. Five above grand designs are a large agenda and require a careful readiness of Indonesia in order to make it happen. Some of the weaknesses and also potentialities of Indonesia relating to those five issues especially those related to fisheries are explained below: 30 Ridwan Lasabuda, “Pembangunan Wilayah Pesisir dan Lautan dalam Perspektif Negara Kepulauan Republik Indonesia”, Jurnal Ilmiah Platax (Vol. 1-2, Januari 2013), hal. 92. Special thanks to my dedicated students : Aldi and Diena. 31 http://www.tabloiddiplomasi.org/current-issue/184-4-article/1590-wilayah-laut-indonesia-60kali-lebih-luas.html Asea Uninet Scientific and Plenary Meeting 2016 | 251 A few challenges that Indonesia needs to answer regarding the proposed “grand design” are as follows: 2.1 In Re-establishing a Maritime Culture Rebuilding maritime culture is not an easy especially after it has been neglected for quite a long time. The people of Indonesia have long been exposed to mainland perspective, the most important is to build on the land, and all interests must start from the interest of the land particularly the main land. Indonesia unfortunately has not designated the grand design of the ocean. The sea is deemed as the uniting factor of the land but it is nonetheless only seen as the object not as the subject. Everything has departed from the interest of the protection of the land and the people while sea has to support all of those purposes. Sea is never deemed as the strategic power that Indonesia should build up every aspects of its potentiality. Indonesia people is not accustomed to see themselves as the coastal community except those who lives by the coast thus the sea is never deemed as part of their life that needs to be guarded and developed sustainably. The young generation are not taught about the concept of archipelagic state, they heard about “wawasan nusantara” but they are not really understand what are the rights and obligation resulted by the recognition as an archipelagic state. The Law of Sea that is supposed to be understood by the key persons of government bodies, legal enforcers, sovereignty guardian, as well practitioners on the marine fields is not properly addressed and comprehended. In many law schools, the law of the sea is not a mandatory subject to be given to the students, but merely the subject for those taking international law specialization. The sea has been treated as the back yard where to throw out the garbage, coral reefs are not well protected, sea water is polluted as the biggest trash can and marine tourism is rarely pick out as the prioritized tour destination. Maritime perspective needs to be upheld by all parts of the nation and should be enshrined in state documents to provide directives for all state units to achieve its aims. Although the focus of maritime infrastructure development has been incorporated in the development agenda of Jokowi-Jusuf Kalla, it still needs to be proven how and when the targets will be achieved. Maritime development requires a lot of cost, availability of sufficient technology, and long term commitment. However, “quick wins” that will accelerate and trigger a snowball effect in the re-establishment of a maritime culture in Indonesia needs to be searched for. What needs to be understood is that culture is not an instant overnight result, but it will be formed when cultivated since young and practiced continuously in the society, then the young generation consisting of students will understand regarding Indonesia’s position as the world’s largest archipelago nation and the responsibility as well as the challenges following that status. One of President Jokowi's agenda is to prepare human resources regarding the maritime world by mainstreaming maritime knowledge in the education process. Indonesia also needs to prepare expertise in many maritime sectors, starting from technical, technological, to strategists and international maritime law experts. Government also needs to emphasis that Indonesia needs to strengthen Maritime Domain Awareness (MDA), but how can this be achieved is when studies regarding the seas and the laws that regulate it is not integrated in the national curriculum, from primary, secondary, till tertiary education. Seas cannot be taken for granted as a resource from God to be utilized, but the sea requires attention and proper management to ensure a sustainable pool of resource. Seas cannot be only considered as a large garbage can and the assumption that the sea base and the grounds beneath it can withstand so much pollution must be eliminated, because it is the habitat of fishes, which humans will consume. The minimata tragedy in Japan must not be forgotten, just like the Buyat case in our country. 252 | Asea Uninet Scientific and Plenary Meeting 2016 2.2 In building a Maritime Food Security Build Maritime food security is an ideal condition, however it needs to embed the seafood as a staple food for the people of Indonesia that means building on the habits of the public to eat fish as a main course of their everyday life, or “daily diet”. Such matter shall not be a problem for the coastal people, nevertheless must bear in mind that many Indonesian people are living in non-coastal area and do not have the habit of eating fish. In contrast to the strong habit of consuming fish at various States consisting of islands, among others are Japan and Maldives. The agenda of the Indonesian government is to achieve maritime food security in the sea for the people of Indonesia. World fish production has grown steadily in the last five decades, the supply of fish increased by an average 3.2 percent occupy the world population that is only 1.6 percent. World’s fish consumption per capita has also increased since the year 1960 with the average consumption of fish of 9.9 kg, where in the year 2012 the average consumption of fish has increased by 19.2 kg. This remarkable increase is supported by a combination of the addition of the total population, rising incomes and urbanization, as well as the expansion of fish production more efficient.32 But the level of fish consumption in Indonesia is much smaller compared to the other coastal states in the world. In 2011, the data reported by the FAO describes the level of fish consumption per capita in Indonesia with 12.8 kg consumption per capita, different for each regions, from southern Maluku consuming as much as 24.6 kg per capita to Yogyakarta consuming 4 kg per capita. More than 70 percent of the fish consumed is derived from marine fish, the fish obtained from the mainland reached 25 percent.33 Unavoidable reality is that even though Indonesia is one of the world’s largest tuna exporters, it is an unfortunate that Indonesia does not consume tuna as its daily menu. Indonesia has the largest fish resources at least in Southeast Asia but have we become the largest exporter? Unfortunately it is still far from reality, in Southeast Asia, Thailand is the "king of seafood" and "the biggest producers of canned tuna in the world" along with General Santos in the Philippines. But is true that their fishery raw materials comes from Indonesia? If it is done through legitimate trade channels, that would not be a problem, but what about the fact that our oceans have been drained by the Indonesian flag vessels but does not have a "genuine link" with the Indonesian and Indonesian legal entity? Of course this can not be allowed and we should find a way out of a "moratorium licensing". Moratorium is certainly a good step and should be followed by a bolder and more resolute step that Indonesia does not rely on ex-foreign ships with the fraudulent intent. Indonesia also had to combat the various Illegal Fishing modes, which has hurt and depleted Indonesia's fish resources tangibly. If Bagan Siapi-api was once the center of the construction of fishing vessels, if Bugis can make a ship that sailed the oceans get to Madagascar, then why Indonesia currently does not develop itself at the center of the construction of fishing vessels. It is certainly to be distinguished by the increase in capacity would lead to over exploitation, the development of fishing vessel equipped with environmentally friendly technologies and facilitate fishing. 32 Food and Agricultute Organization of the United Nations, The State of World Fisheries : Opportunities and Challenges, (Rome, 2014), Hal. 3 33 Ibid., Hal. 153. Asea Uninet Scientific and Plenary Meeting 2016 | 253 Quality fish should also be enjoyed freely in the domestic market and not only for export purposes. The Government of Japan has provided a subsidy to fishermen through output subsidy that guarantees the price of fish is not played around with by market fluctuations, and the Indonesian government can certainly do the same thing without being accused of violating international trade. It is a must to realize that this plan is to support fishermen in improving the quality of yield by intervening in post-capture process to produce a variety of products including the results of fish that can be favored by the people who live far from the sea. 2.3 In developing Maritime Infrastructure and Connectivity The geographical position of the Indonesia is very strategic because it is located between two continents, Asia and Australia, that make Indonesia as on of the busiest line and the centers of maritime traffic between continents. Foreign ships, which aim to the Australian continent from the North, for example, to shorten the voyage will pass through Indonesia. Foreign ships can pass through the territorial sea of Indonesia with "the right of innocent passage", and pass through the waters of the Indonesian archipelagic water with the right of archipelagic sealanes passage" subject to international regulations that have been set by the 1982 UNCLOS and national regulations set by Indonesia, as long as the national provisions are not intended and impacted on the reduction of the right of foreign ships to traverse. As an archipelagic state with huge coastal and marine areas, the number of interisland shipping and trading cannot be avoided. Trade between islands in Indonesia has been going on since long. Transporting goods between islands in Indonesia through the waters is an effective way to do. In addition to man transportation, vessels also have abundant goods to transport. Statistics show that the current loading and unloading for domestic trade are the three major ports in Central Java, Tanjung Emas Semarang, Tanjung Intan Cilacap and Tegal. Increasing the number of Indonesian-flagged merchant ships while implementing the cabotage principle has provided considerable influence on the national shipping industry, which currently has been dominated by ex-foreign vessels. The issuance of Presidential Instruction No. 5 of 2005 on the Empowerment of National Shipping Industry and Act No. 17 Year 2008 on Navigation has become the legal basis of cabotage principle in Indonesian water. According to article 8 of Law No. 17 Year 2008 the domestic sea transportation activities shall be carried out by domestic shipping line using Indonesian vessel, which at least Indonesian parties own 51% of the share. The development of maritime infrastructure and connectivity is a thing that has actually been long proposed, including the enactment of national shipping “cabotage principle”, which state that every point in shipping lines in Indonesia should only be served by the national fleet. As has long been known "supply and demand rule" does not apply reciprocity between islands in Indonesia. Many raw materials imported from Java to Kalimantan and Papua, but not vice versa, because the development is concentrated in Java for several decades. As made possible by the 1982 UNCLOS, Indonesia has set three Indonesian archipelagic sealanes (ALKI) from north to south and vice versa as the sealanes and air routes for ships or aircraft where are passed by 45% of the total value of world trade. Unfortunately up to now the ports in Indonesia is still considered less support in establishing Indonesia as a maritime fulcrum. Lack of these port facilities has an impact on freight transport of goods between the thousands of islands in Indonesia to be expensive, which according to data from the Indonesian Chamber of Commerce (Kadin), costs incurred to transport the transport of goods in the sea to spend a total of 15% of all business 254 | Asea Uninet Scientific and Plenary Meeting 2016 costs, while in other regional costs incurred up to 7%. The lack of efficiency of Indonesian ports can also be seen from the slow time of loading and unloading of ships coming to the ship left port (dwell). When compared with other ports in Southeast Asia, the main port of Tanjung Priok average time spent in loading and unloading of goods as much as 6.4 days, while Singapore is only about 1.5 days, and Malaysia as much as 3 days. In terms of the amount of cargo that can be accommodated, Indonesian ports still far behind compared to other ASEAN countries. The main port of Tanjung Perak is only able to hold charge as much as 2.85 Million TEUs (Twenty-foot Equivalent Units) (0.47% share of world cargo). The Port of Singapore is able to accommodate 31.64 Million TEUs, Port Kelang Malaysia accommodate 10:01 Million TEUs, the port of Laem Chabang Thailand holds 5.93 Million TEUs, the port of Ho Chi Minh City Vietnam accommodate 5:19 Million TEUs. In addition, Indonesia also still have a problem with the depth of its ports, which causes hindered large ships to pass, and infrastructure management that is still very weak, and the lack of trade access from sea to extensive land. This certainly shows how poor the utilization of the existing potentiality in Indonesian ports. To make Indonesia as the Maritime Fulcrum, port development agenda is first proposed by President Jokowi. The main port development with international standards would increase the profits of Indonesia in international freight transport and ensure better economic development for Indonesia. In addition to the construction of the port, the other agenda favored by President Jokowi is shipping corridor "Toll of the Sea". Sea toll is expected to become the backbone of Indonesian and shipping network for the movement of Corridor West Sea via the port of Belawan towards Corridor Java Sea via the port of Tanjung Priok, Tanjung Perak through the Corridor Sulawesi Sea through the Port of Makassar and finally through the Corridor East Sea is the Port of Sorong. This development is certainly a positive step in preparing Indonesia as the maritime fulcrum. Indonesia must succeed in creating a development plan in all areas, not just in the west but also in the east, thus it will create a sea traffic ensuring mutual trading so that the prices of basic commodities will be evenly distributed throughout Indonesia. Not only that, because of the many islands that are on the border and susceptible to influence from neighboring countries, international ports should be built and developed in accordance with the available resources, as how the Port of General Santos developed by the Philippine Government for tuna fish and pineapple products. If we reflect on the United States, it is seen that they develop all corners of the region as evidenced by the large international ports in both north, south, west and east (Seattle, New York, Los Angeles and Florida). While in Indonesia, most of the international port are located in Java (the port of Tanjung Priok, Tanjung Perak and Tanjung Emas), so why not develop an international port in western Sumatra, West and East Kalimantan, North Sulawesi, North Papua, South Java and South Bali-Nusa Tenggara ? Thus the products produced by Indonesia, both goods and fishery products can be immediately served and sent to various parts of the world without having to go through Singapore as how it is currently, in which Indonesia only becomes the feeder of Singapore. Indonesia must also be resolute in ensuring the right of passage of foreign ships in the territorial sea and archipelagic waters. If the setting of new ALKI is considered "partially-adopted" by the IMO as an international institution that is competent in the field of shipping, then for legal certainty Indonesia must dare to take a stand against the easternwestern path that has always been an international cruise lines under article 53, paragraph 12 1982 UNCLOS then foreign ships can sail there with "the right of archipelagic sea lanes passage" though not defined as ALKI. Rather than supervising a large span of sea, which is difficult, why not set ALKI to be east and west? So that "any similar convenient routes" will be deleted. Asea Uninet Scientific and Plenary Meeting 2016 | 255 In support of cabotage, Indonesia should build a passenger and cargo ship shipbuilding yard in accordance with the characteristics of the Indonesian archipelago. The principle of "cabotage" should be able to enrich the flow of inter-island shipping, given sea transport is the most economical and efficient option, especially for cargo. However, it should borne in mind that there will not be a cruise between islands if an inter-island supply and demand is not created, so the biggest challenge is to change the direction of development into equitable growth throughout Indonesia, where each area will be developed in accordance with the capabilities, potential and carrying capacity. Indonesia also have to ensure that the Indonesian-flagged fishing vessel that meets the "seaworthiness". Ports become very important tools for connecting between islands. Although ports in Indonesia is increasing, but note also the condition and the port facilities in order to function properly. Indonesia also have to serve the delivery of "international trade" goods which is derived from and will be sent to Indonesia, the Indonesian ship should be able to transport the goods directly to the State of destination and vice versa. In the past, the visible red and white fluttering on Indonesian ships in international ports abroad such as Rotterdam, Hamburg, Bremen, Los Angeles, it is time now Indonesia resubmit merchant fleets to various ports in the world, not just be a "feeder" for foreigner ships in Singapore. To achieve it, Indonesia must ensure that Indonesia has navigable waters because the safety and security of shipping is guaranteed. Indonesian Sea should be guarded 24 hours a day 365 days a year at each corner. For that, members of the House of Representatives (DPR) are honored to be supporting the improvement plan and increase the capacity of surveillance vessels of various sectors, especially that secures the sea area of maritime threats. 2.4 In Cooperation in Maritime Sector Cooperation in the marine sector can only be done effectively if the mutual respect and common interest between the State. In modern international relations, countries always give priority to diplomacy in solving problems together and for a framework of cooperation and mutual complementarity. The potential of maritime diplomacy can no longer be avoided to find a solution in helping Indonesia. Currently, maritime diplomacy is a significant part of President Jokowi’s agenda as a tool to solve problems on the sea, namely illegal fishing, violation of the state border, border disputes, piracy and marine pollution. One of Indonesia’s efforts in maritime diplomacy is to participate actively Indonesia in the Indian Ocean RIM Association (IORA). IORA itself is an entity that has a focus, which were related to defense and maritime security, trade and investment facilities, fisheries management, disaster control management, academic cooperation, technology and science, and cultural exchanges as well as tourist access.34 Besides participating in IORA, Indonesia also formed a partnership with China that is willing to provide assistance to realize the vision of President Jokowi. In 2013, President of People’s Republic of China (China), Xi Jinping explained regarding Maritime Silk Road (MSR) or China maritime agenda is in line with the development Indonesia maritime agenda as Indonesia has a major transit point from China trading activities.35 34 Mervyn Piesse, Op. Cit., Hal. 4. Ibid., Hal. 3. 35 256 | Asea Uninet Scientific and Plenary Meeting 2016 Indonesia has ratified the 1995 UN Fish Stocks Agreement (UNFSA) and becoming a member of the three Regional Fisheries Management Organization (RFMO), namely the Indian Ocean Tuna Commission (IOTC), Commission for the Conservation of Southern Bluefin Tuna (CCSBT), and the Western Central Pacific Fisheries Commission (WCPFC), which set up a global and regional measures related to the use of tuna as a highly migratory species. Indonesia has adopted the International plan of Action on Illegal, Unreported and Unregulated Fishing (IPOA-IUU) and is also very active in the Regional Plan of Action (RPOA) to Promote Responsible Fishing Practices Including Combating IUU fishing in the Region (RPOA-IUU). Indonesia also has a joint venture in protecting coral reefs through the Coral Triangle Initiative (CTI), which was developed to establish mechanisms for cooperation among the countries which have the purpose and the same view regarding the management of the environment and maintaining the sustainability of Natural Resources sea in the Coral triangle which includes six countries:36 Indonesia, Philippines, Malaysia, Timor Leste, Papua New Guinea, and the Solomon Islands. Other than the problems at sea that require cooperation to handle, the problem of illegal immigrants arriving to the territory of Indonesia is still unfinished and a chore for the Indonesian government. Although Indonesia is not included in the countries that have ratified the 1951 Convention on Refugees, Indonesia is unable to escape and to not pay attention about the fate of the immigrants who enter the territory of Indonesia claiming to be refugees or asylum seekers. These refugees fled their country because conflict and war, the unstable political situation, or poverty. These refugees who then caused a widespread of human smuggling by sea that occurred lately, has allegedly become an international network involving actors among countries as suppliers, which usually come from Middle East, whereas the intermediaries usually come from the countries of Southeast Asia, including Indonesian.37 The people smuggling phenomenon in Indonesia is actually involved not just the refugee with the reason of persecution but also those with the economic motive which actually requires specific treatment differentiated with those of refugee. In regards to the protection of the crew, Indonesia has acceded to the 1978 International Convention on Standards of Training, Certification and Watchkeeping for Seafarers in 1987 (1987 STCW), aimed to protect crew working in a commercial ship, however Indonesia still has not ratified the 1995 International Convention on Standards of Training, Certification and Watchkeeping for Fishing vessels personnel (1995 STCW-F), which is the same legal instrument specifically for the crews of fishing vessels. Indonesia has also become an easy target for distributor of illicit goods similar to drugs. The high demand and still weak law enforcement in Indonesia make the practice of smuggling illegal drugs are still happening today. Indonesian sea lane is a prone path to smuggle drugs. National Narcotics Body shows that 80% of drug smuggling is done through sea ports and sea transportation. Indonesian waters that are prone to drug 36 Ibid. Agus Subagyo dan Dadang Sibar Wirasuta, “ Penyelundupan Manusia dan Ancaman Keamanan Maritim Indonesia”, Jurnal Pertahanan, (Desember 2013), hal. 153. 37 Asea Uninet Scientific and Plenary Meeting 2016 | 257 distribution, among others, the Strait of Malacca, the Celebes Sea, and along the waters off Java south coast.38 In general, two methods used to smuggle drugs is through the container and harbor rats. The most distribution through the sea sums up to about 80%. The reason on why drug distribution is chosen through sea areas as intermediaries is because the control for incoming goods are not very strict, as the control taken at the airport. Head of Prevention Regional National Narcotics Body (Badan Narkotika Nasional Propinsi: BNNP) in Bali claimed that the drugs were smuggled by using a large ship at first, and when has entered the territorial waters of Indonesia, it is divided into several smaller vessels. Those small vessels are later infiltrated through small paths and are deposited on a fishing boat, such as by hanging the drugs under the water.39 Up until now, the government still continues to make efforts in preventing the entry of illegal drugs into the territory of Indonesia particularly by sea, through the relevant ministries. This includes placing personnel at ports that have been the entry of drug smuggling. It should also not be forgotten by Indonesia that this vast sea area does not only provide an abundance of fish but also an abundance of mineral resources and renewable energy that is in the sea. Submissions of Indonesia against "extended continental shelf" has been agreed by the Commission on the Limits of Continental Shelf (CLCS) as provided for in UNCLOS, 1982, Indonesia is now time to make real plans for utilization. Coordinating Ministry for the Maritime and Resources and the Ministry of Maritime Affairs and Fisheries (MMAF) must be "leading sectors" in developing cooperation in the maritime field. We must not get stuck in the affairs of MMAF to only be about fisheries. The seas store large energy that should be used for energy sources as has been done by many European countries for example by building a "wind mills" in the middle of the sea that proved effective and efficient. Indonesia should be "leading actor" in the field of fisheries, because Indonesia is the one with the biggest fish resources at least in Asia Pacific. When "management measures" have been established in the global and regional order it is necessary for Indonesia to implement it in national level, both in legislation and in practice in the field, including in "Combatting illegal, unreported and unregulated (IUU) Fishing" and " transnational organized crime related to Fishing Vessels ", to carry out its obligations as" coastal State, flag State "and " port State ". To prevent IUU fishing practices, Indonesia should be able to ratify the 1993 FAO Compliance Agreement and the 2009 Port State Measures Agreement. When Indonesia strictly regulates ships, then Indonesia must be prepared to protect and regulate good Indonesian citizens who work as crews in commercial ships and fishing vessels. Liabilities arising from the participation of Indonesia in the STCW must be met and will be more effective if carried out by means of cooperation with the ship's state of nationality or state of ship owners. However, Indonesia should also consider its “BNN: Perairan Indonesia Rawan Penyelundupan Narkoba”, 1 September 2015, diakses melalui http://www.voaindonesia.com/content/bnn-perairan-indonesiarawan-penyelundupan-narkoba/1863557.html pada 1 September 2015. 39 “Penyelundupan Narkoba Kebanyakan Melalui Jalur Laut”, 16 Maret 2015, diakses melalui http://balipost.com/read/headline/2015/03/16/31462/penyelundupan-narkoba-kebanyakanmelalui-jalur-laut.html pada 1 September 2015. 38 258 | Asea Uninet Scientific and Plenary Meeting 2016 participation in the STCW-F so that the Indonesian crews scattered in various foreign fishing vessels can be well protected and secured of their skills, at least meeting the standards of "worthiness". The fact that Indonesia has ratified UNFSA and is a member of the IOTC, CCSBT, and WCPFC does not by itself make Indonesia as the sole actor responsible for sustainable fisheries, particularly for tuna. It is necessary to ensure their implementation in the field and the existence of a common understanding among actors of fishery management, economic actors fisheries and law enforcement in the field of fisheries. Indonesia should cooperate to prevent and cope with "people smuggling" and "human trafficking" is done by sea. IUU fishing has become a global enemy and fishing boats are often used to carry out transnational organized crime such as "people smuggling", "drug trafficking" and "human trafficking" includes "forced labor". 2.5 In Building a Maritime Defense Power Forming supremacy in maritime defense is the most coveted by most Indonesian law of the sea observers. As the largest archipelago, building supremacy in maritime defense and security is a must. Most of the border has been agreed upon, however there is still under negotiation, including border of the exclusive economic zone of Indonesia and Malaysia in the straits of Malacca, the border between Indonesia and Malaysia in East Kalimantan which has resulted in the arrest of one another fishermen of both countries in the conflict maritime areas. On of the agenda in realizing Indonesia as maritime fulcrum is relating to the issues on settlement of maritime border and areas. By 2019 ahead, Indonesia has a plan to resolve the existing maritime boundary issues including East Timor, Thailand, and India.40 Last agenda in the realization of Indonesia as maritime fulcrum is the improvement of maritime defense supremacy. Sea is supposed to be secured from any illegal act and safe to navigate. The designated law enforcers in the field of fisheries (The Navy, Water Police, Civil Servant Investigator ) are now equipped by Maritime Security Agency( Badan Keamanan Laut/BAKAMLA), as established under Law No. 32 Year 2014 on Marine (Marine Act). One of the means that has been conducted by Indonesian Government to settle dispute on maritime boundary and territory is by conducting Border Diplomacy. Border Diplomacy is an implementation of foreign policy of dealing with boundaries issues including delimitation of land-water territory as well as management issues of international dimension.41 Delimitation of maritime boundary that is constantly being disputed is the Territorial Sea, Contiguous Zone, Continental Shelf, and the Exclusive Economic Zone (EEZ). Territorial sea is a sovereign territory of a coastal State, which include airspace above territorial sea, as well as the bed of the sea, and the subsoil of 12 nautical miles (nm) measured from the baseline.42 The Contiguous zone has the length of 12 nm measured from the territorial sea or 24 nm measured from the baseline. EEZ is an area beyond and adjacent to the territorial sea which has the length beyond 200 nm from the baselines from which 40 Mervyn Piesse, Op.Cit., Hal. 4 Arif Havas Oegrosono, Kebijakan Dasar Indonesia Dalam Penetapan Perbatasan Maritim, (Jakarta: Departemen Luar Negeri Republik Indonesia, 2006), Hal. 13. 42 http://www.pengertianpakar.com/2015/02/pengertian-zee-zona-tambahan-dan-laut.html#_ diakses pada tanggal 31 Agustus 2015 41 Asea Uninet Scientific and Plenary Meeting 2016 | 259 the breadth of the territorial sea is measured; in which a coastal State has the sovereign right to explore, conserve, and exploit its natural resources, whether living or non-living. Continental shelf of a coastal State compromises the seabed and subsoil of the submarine areas that extend beyond its territorial sea throughout the natural prolongation of its land territory to a distance of 200 nm measured from the baselines. Indonesia is located adjacent to 10 neighboring States that are, Australia, Malaysia, Philippines, Singapore, Thailand, Timor-Leste, Papuan New Guinea, Vietnam, India, and Palau.43 Some of the issues on maritime boundaries that is still being disputed and unresolved (not yet settled), among others:44 (a) (b) (c) Malaysia, Singapore, and Timor-Leste for Territorial Sea; India, Thailand, Malaysia, Vietnam, Palau, Timor-Leste for EEZ; Malaysia, Philippines, Palau, and Timor-Leste for Continental Shelf. The Government of Indonesia should control seas significantly either by the Navy, the relevant agencies and BAKAMLA established under Law No. 32 of 2014 on the Marine (Marine Act). Every inch of the sea must be maintained, both in the sovereign territory of Indonesia (internal waters, archipelagic waters and territorial sea) and in the Indonesian jurisdiction (contiguous zone, EEZ and continental shelf). Fleets of neighboring countries cannot be allowed to enter into the territorial waters of Indonesia to return the "illegal migrant" as has been done by Australia, and can not be allowed to the action illegal construction carried out by neighboring countries, as well as the development of navigation aids in Tanjung Datu as done by Malaysia. The doctrine of "zero enemy" cannot be enforced if it concerns the sovereignty of Indonesia and the effort to maintain it, this has been shown by many countries in the world including the United States and Australia. Indonesia must keep their entrances not only on the agreed borders but also to show "peaceful display of sovereignty" in areas that are still in dispute with neighboring countries. Indonesia should be able to secure the sea, so that the waters of Indonesia no longer be labeled as "black spots" in international shipping as many "sea armed robbery" in the territorial waters of Indonesia, which has resulted in high "insurance fee" for goods transported to and from Indonesia which resulted the high price of these goods. In summary Indonesia must build a defense fleet and security must be significant increased by increasing equipment and the ability to operate the equipment throughout the year in every region of Indonesia, including to enforce laws related to customs, taxes, immigration and health in additional zones as has been claimed by the Maritime Law. 3 RECOMMENDATION Finally, this paper tries to recommend the steps that Indonesia must take in order to become a maritime fulcrum, as observed through the eyes of an academician. 43 http://www.bphn.go.id/news/42/SEMINAR-TENTANG-MASALAH-HUKUM-BATASLAUT-INDONESIA diakses pada tanggal 1 September 2015. 44 Identifikasi Segmen-Segmen Batas Maritim antara Republik Indonesia dan 10 Negara Tetangga, Kementerian Luar Negeri RI, as of June 2015. 260 | Asea Uninet Scientific and Plenary Meeting 2016 3.1 To rebuild the maritime culture In rebuilding the maritime culture, Indonesia must be able to perform strategic actions such as, among others: (a) (b) (c) (d) (e) (f) 3.2 Fostering the awareness regarding the concept of an archipelagic State as early as possible, starting from primary education using methods that fits its level of absorption; Making the understanding of maritime law mandatory at least on university level and for government officials, especially those working in sectors related to the sea; Protecting and developing the traditional knowledge of the coastal society, especially those who are part of adat law community, regarding responsible & sustainable fishing and adapting with climate change; Institutionalizing the adat law that has been used for generations by codifying it into an authentic legal basis, and making it as “best practices” that can be brought forth to regional, national, and international forums; Implanting communal culture related to marine utilization as a main culture; Fostering societal awareness to protect the sea and preventing marine pollution or marine environmental destruction. To establish maritime food security The necessary steps to establish maritime food security are, among others: (a) (b) (c) (d) (e) (f) (g) Fixing fisheries data gathering system, so it becomes reliable and accountable; Fixing the licensing system, so it becomes effective and guaranteeing legal certainty by putting forward responsible & sustainable domestic fisheries; Fixing the ship registration and flagging system so it will weigh not only formal truth such as formal requirements, but also material truth. In efforts to prevent “reflagging” practices, Indonesia must consider to participate in the 1993 FAO Compliance Agreement; Developing a national fishing ships manufacturing industry that is internationally qualified by updating fishing ships facilities with advanced technologies and avoiding the use of ex-foreign ships unless due to a very strong reason or due to a “genuine link” that is materially proven to exist between the ship and its owner, who must be and Indonesian citizen or an Indonesian legal entity; Not opening chances for foreign industries to invest capital in the fishgathering sector, and only allow them to move in the processing and marketing sector of the industry if: the national industry is insufficient, it obliges “transfer of knowledge and technology,” and if it is of significant benefit for the national income; Expanding Indonesia from being the world’s biggest producer of fresh, frozen, and processed fish to also become the world’s biggest producer of canned fish; Implementing responsible and sustainable fishing methods, including regulating “fishing grounds, open/close season, marine protected areas, fishing gear, by-catch, on vessel storage and handling; Asea Uninet Scientific and Plenary Meeting 2016 (h) (i) (j) (k) (l) (m) (n) (o) (p) (q) (r) (s) (t) (u) 3.3 | 261 Developing a functional fishing ports to expedite the landing of fish catches and a fish processors equipped with cold storages and an effective fish packaging and marketing facility; Guaranteeing the availability of infrastructures for fish distribution, which includes making fish catches landing points and fish catches delivery points closer to each other; Increasing the attractiveness for domestic fisheries market; Guaranteeing the domestic supply of the best quality fresh and processed fish; Creating innovation in fish-based foods; Continuously campaigning fish-consuming culture, which includes developing fish-based cuisine in the archipelago; Protecting the interest of small scale fishermen and small scale fish workers by increasing their capacity in order to increase their quality of life, which includes expediting the trade chain so they are avoided from middlemen (“tengkulak”) that monopolized fish catches and marketing; Integrating the principle of sustainable utilization of fish resources in every policies in national or local level as well as between related ministries; Preventing and abolishing “Illegal, Unreported, and Unregulated (IUU) Fishing” by increasing the role of ports to prevent the entry of catches that failed to produce certificate of origin (“traceability”) and results of “transshipment”. In order to do that, Indonesia must ratify the 2009 Port State Measures Agreement; Creating national provisions regarding a more effective Monitoring, Controlling, and Surveillance (MCS), which includes synergizing our surveillance capacity that is currently being spread apart in multiple institutions (PPNS, TNI AL, Police, BAKAMLA); Putting forward security coordination to be able to cover larger areas in favor of sectarian ego such as “single agency multi-tasks” or “multi agencies single-task”. Making an integrated database supported with the latest technology regarding the threats to the fisheries resources (“illegal fishing” means) that could help create a more immediate and effective countermeasures; Creating criminal sanctions that induce a deterrent effect, which includes legitimizing the act of “burning and sinking both local or foreign vessels within the archipelagic waters, territorial waters, and EEZ,” as last resort punishment (“Ultimatum remedium”) against “Illegal Fishing”, as long as there is a clear SOP to regulate its implementation to avoid violation of human rights; and Developing “prompt release upon bond posting” system that suits the characteristic of fish catching in Indonesia by drafting a clear SOP as mandated by the law. To develop maritime infrastructure and connectivity Several steps that needs to be taken are: (a) Supporting the implementation of cabotage principle by creating a supply and demand chain between islands in Indonesia by developing a national industry that is equally spread in the archipelago; 262 | Asea Uninet Scientific and Plenary Meeting 2016 (b) (c) (d) (e) (f) (g) (h) 3.4 Strengthening the Indonesian shipping fleet by developing the national commercial vessel manufacturing industry that is highly competitive in quality so that Indonesia can be independent in manufacturing passenger ships and cargo ships for national, regional, and international interest while qualifying the international standard of seaworthiness; Securing the sea from any form of navigational safety and security threats, which includes improving the navigational support and safety patrol facilities at sea; Increasing the capacity of ports to become international port that fulfills the criteria for international trade; Increasing the “search and rescue” facility in facing dangers at sea; Implementing and improving the facilitation in the utilization of the Indonesia Archipelagic Sea Lane so it won’t detriment Indonesia’s interest Determining the East-West Indonesian Archipelagic Sea Lane to prevent the arbitrary use by foreign vessel because they utilized the partially adopted status of the Indonesian Archipelagic Sea Lane and the binding power of Article 53 Paragraph 12 of the 1982 UNCLOS; and Determining the “port limit and outer port limit” of each ports and developing the service sector related to sea transports, especially in areas usually used for international sea passages. To establish cooperation in the maritime sector Several steps that needs to be taken are: (a) (b) (c) (d) (e) (f) (g) (h) To lead in the cooperation in maintaining security and safety at sea without sacrificing national interest; Cooperating to increase the safety of voyage, protection of the marine environment, prevention and countermeasures of marine pollution and maritime security; Indonesia must cooperate in both regional and international level to protect Indonesia ship crews working in both Indonesian and foreign vessels by applying international standards, some of which are stipulated in the 1978 STCW and 1995 STCW-F; Initiating the birth of new regional and international norms and “best practices” that can be followed by other states in the field of fisheries and sea voyage; Cooperating with maritime law enforcement especially in places outside the jurisdiction of the State such as the high seas, especially in efforts to prevent international and transnational crime including piracy, drug trafficking, and human trafficking; Actively participate in fisheries MCS in high seas through RFMO; Establish cooperation to utilize extended continental shelf especially those that requires high technology that Indonesia does not have at the moment; and Participate in the utilization of the international sea bed area as a manifestation of common heritage of mankind. Asea Uninet Scientific and Plenary Meeting 2016 3.5 | 263 To build the strength of maritime defense Several steps that needs to be taken are: (a) (b) (c) (d) 4 Making sure that the definitive state borders are not breached by neighboring states; Conducting an active border diplomacy even before problem arises especially those correlated with fishermen activities near the borders; Complete all pending border disputes while putting forward national interest; and Making Indonesia a forerunner in the Asia-Pacific with regards to border defense, because a safe territory is the one that is carefully guarded. CLOSING REMARKS There are a lot of homework that must be done and that is unable to be specified one by one on this paper, but the big steps has been laid out by the Indonesian government which we hope will not end as mere slogans without any realization in the future government programs. The government along with the House of Representatives must be able to realize the vision and mission to become the world’s maritime fulcrum starting by fixing ourselves internally and the expanding its influence externally. Indonesia must be optimistic that with the large capital of being the biggest archipelagic state in the world, which is not obtained easily, Indonesia must become a strong and advanced maritime state. There should be a strong and consistent political will that will not shift between presidencies. This is not only the dream of President Jokowi, but also the dream of Indonesia, that everyone sitting in the government should fight for. The motto of the Indonesian Navy is perfect, Indonesia has to reign over the sea because the sea makes Indonesia great, JALESVEVA JAYAMAHE! REFERENCES BOOKS : Adisanjaya, Nyoman Ngurah. “Potensi, Produksi Sumberdaya Ikan di Perairan Laut Indonesia dan Permasalahannya.” Dibuat untuk Pendekatan Ekosistem dalam Pengelolaan Perikanan Indonesia, 2009. Agoes, Etty R. Batas Wilayah Laut Ditinjau dari Segi Hukum laut dan Kelembagaan. 2003. Dimyati, Muh. Kontribusi Strategis Iptek Untuk Mewujdukan Poros Maritim Dunia. Jakarta : Kementristek dan Dikti, 2004. Kusnadi, “Kebudayaan Masyarakat Nelayan”. Disampaikan dalam kegiatan JELAJAH BUDAYA TAHUN 2010, dengan tema “Ekspresi Buadaya Masyarakay Nelayan di Pantai Utara Jawa”, Balai Pelestarian Sejarah dan Nilai Tradisional, Kementrian Kebudayaan dan Pariwisata, Yogyakarta, 12-15 Juli 2010. Mellbye, Christian Svane, dan Erik W. Jakobsen. Norwegian Maritime Equipment Suppliers 2014. Norks Industri, 2014. Nijdam, Michiel H. dan Peter W. De Langen. “Leader Firm in the Dutch Maritime Cluster”. Paper dipresentasikan di ERSA 2003 Congress. Oegroseno, Arif Havas. Kebijakan Dasar Indonesia Dalam Penetapan Perbatasan Maritim. Jakarta : Departemen Luar Negeri Republik Indonesia, 2006. 264 | Asea Uninet Scientific and Plenary Meeting 2016 Piesse, Mervyn. “The Indonesian Maritime Doctrine : Realising the Potential of the Ocean”. Dalam Strategic Analysis Paper 22 January 2015. Future Directions International. Purnomo, Kartika. Kebijaksanaan Pengelolaan Pulau-Pulau Kecil Terluar dan Permasalahannya. Jakarta : Departemen Dalam Negeri Republik Indonesia, 2003. Starke, J.G. Pengantar Hukum Internasional. Bandung : Sinar Grafika, 1972. Trace, Keith, Barend Frielink dan Denis Hew. Maritime Connectivity in Archipelagic Southeast Asia: An Overview. Manila: Asian Development Bank, 2009. Articles : Anwar, Syaiful. Mengenal Jasa Transportasi Laut dan Udara(Agustus 2011). http://www.bppk.depkeu.go.id/webbc/images/stories/file/2011/artikel/upload %205%20agustus%202011/SYAIFUL%20ANWAR_Mengenal%20Jasa %20Transportasi %20Laut%20dan%20Udara.pdf. (1 September 2015). Aprilianto, Rizky. Abdul H., Ainul H. “Implementasi Asas Cabotage dalam Kebijakan Pelayaran di Indonesia”. Jurnal Administrasi Publik (JAP). (Vol. 2, No. 4). Hal. 758-764. Fajar, Ario. Pemberlakuan Asas Cabotage Dorong Bisnis Pengapalan Lokal (13 Januari 2015). http://swa.co.id/business-strategy/management/pemberlakuan-asascabotage-dorong-bisnis- pengapalan-lokal. (1 September 2015). http://aim-services.co.id/jumlah-kapal-niaga-nasional-capai-13-326-unit-2/. (1 September 2015). Lasabuda, Ridwan. “Pembangunan Wilayah Pesisir dan Lautan dalam Perspektif Negara Kepulauan Republik Indonesia”. Jurnal Ilmiah Platax (Vol. 1-2, Januari 2013).hal. 92 –101. Mardjoeki, H. “Pemberdayaan Masyarakat Pesisir Pantai Utara Daerah Kabupaten Cirebon.” Jurnal Ekonomi 1, no 1 (2012): 52-57 Maulana, Ridha. Strategi Peningkatan dan Pengembangan Kinerja Pelabuhan di Indonesia. (Fakultas Teknik Supil Unaya). http://www.academia.edu/5896016/Analisa_Stategei_Pengembangan_Pelabuhan. (1 September 2015). Muhsidin. “Pelabuhan Sorong dibangun Juli 2015”. Antara News(11 Mei 2015). http://www.antaranews.com/berita/495558/pelabuhan-sorong-dibangun-juli-2015. (2 September 2015). Nainggolan, Hermina, Krisna Fery Rahmantya, Anggie Destiti Asianto, Dadang Wibowo, Tri Wahyuni, and Walim Abdul Somad. Kelautan Dan Perikanan Dalam Angka Tahun 2014. Jakarta: Pusat Data, Statistik dan Informasi, 2014. Nikijuluw, Victor P.H. “Identification of Indigenous Coastal Fisheries Management (ICFM) System in Sulawesi, Maluku, and Irian Jaya” Jurnal Pesisir & Lautan 1, no. 2 (1998): 40-52 Pro, Supriyadu Pro. Hubungan Perdagangan Antar Pulau di Indonesia, 2013, http://www.sejarah-negara.com/2013/02/hubungan-perdagangan-antar-pulau-di.html. (pada 31 September 2015). Sudirman. “Potensi Sumberdaya Laut Perairan Indonesia Timur dan Tingkat Pemanfaatannya Ke Depan Oleh Masyarakat Pantai dan Nelayan Setempat.” Disajikan pada Semiloka Perikanan FK8PT di Universitas Nusa Cendana Kupang, 14 Oktober 2006. Wahyono, A., Sudiyono, dan F.I. Thufail, 1993. “Aspek-aspek Sosial Budaya Masyarakat Maritim Indonesia Bagian Timur. Hak Ulayat Laut Desa Para, Kecamatan Manganitu, Sangihe Talaud.” Seri Penelitian PMB-LIPI No.4 Asea Uninet Scientific and Plenary Meeting 2016 | 265 Wahyudin, Yudi. “Sistem Sosial Ekonomi Dan Budaya Masyarakat Pesisir.” Disampaikan pada Pelatihan Pengelolaan Kawasan Konservasi Perairan, di Kampus Pusat Diklat Kehutana, Institut Pertanian Bogor, Bogor, Jawa Barat, 5 Desember 2003. Reports: A Report by the Navi League of United States, America’s Maritime Industry – The Foundation of American Seapower ASEAN-India Centre at RIS, ASEAN-India Maritime Connectivity Report, (New Delhi: India Habitat Centre, 2014) D.G. Mare, Study on the Application and Implementation of the IUU Regulation – Final Report Maritime Administration, A Vision for the 21st Century, (Washington D.C., 2007) SmartComp Research Report No. 3, Maritime Sector Development in The Global Market. (October 2013) EU “YELLOW CARD” CRISIS AND ITS EFFECT ON THAI FISHERIES Assistant Professor Charit Tingsabadh, Ph.D. Charit.t@chula.ac.th Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract The “Yellow Card” warning by the EU, issued in 2015, reflected the crisis in the Thai fisheries system with strong relevance to the global fisheries policy. The main goal of IUU fishing measures of EU is to promote sustainable fishing and to conserve marine resources and food source for future generations. This is a very lengthy process, which requires a very large budget even when this is implemented within the EU region. In case of Thailand, the government gives priority to safeguarding the economic benefits of the fisheries sector and adopts urgent measures aiming to quickly remove Thailand from the IUU watch list, though the measures may still not fix the real problems. The short-term government measures and regulations which do not take into account sustainable development principles may not truly benefit the marine resources and may cause many other problems recently experienced in the fishing sector. The ineffective marine fisheries management had long been the problem in the Thailand for much longer time than the “EU’s Yellow Card” problem. This reflects the weakness of the marine fisheries management in Thailand, and there is a need for effective Ocean Governance. This is because marine fisheries is very complex in nature, especially within Thailand. The paper presents a discussion of issues and alternative strategies considered in Thailand for dealing with the situation. Keywords: EU Yellow Card, IUU fishing, Ocean Governance, Thai Fisheries, Common Fisheries Policy 1 INTRODUCTION Currently, there are heavy concerns about the unsustainable use of the seas and oceans in Thailand. Marine fisheries is one of the key components of human security both in term of food and economic security. However, marine fisheries is in critical danger due to overfishing and environmental degradation. Overfishing highly depleted the natural marine resources by taking out more fish than the natural system can replenish. Marine fisheries is considered as one of the renewable resources, which is significant to human security dimensions, especially in the field of food security. As mentioned above, over fishing in various areas pose more and more problems to relevant parties (see fig. 1); as a result, the Food and Agricultural Organization of the United Nations (FAO) has initiated the approach as to how to conduct fisheries with responsibility. Therefore, the notion has materialized in the form of the Code of Conduct for Responsible Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 266 Asea Uninet Scientific and Plenary Meeting 2016 | 267 Fisheries (CCRF), but under the voluntary basis. This code has developed into the International Plan of Action to Prevent, Deter and Eliminated Illegal, Unreported and Unregulated Fishing (IPOA-IUU). Furthermore, the Satellite Vessel Monitoring System (SVMA) is developed in order to monitor and inspect the marine fisheries in each country. There are also various agreements and regulations for fisheries, including the establishment of Regional Fisheries Management Organizations (RFMOs). All these initiations are considered as benchmark of regulations and criteria. Their raison d’être inevitably sends repercussions to individual countries which relies on revenue from the marine fisheries industry, both in their sovereign territorial waters and rights of coastal states and in the high sea. Figure 1 World marine fisheries during 1950 – 2012 Source: Food and Agricultural Organization of the United Nations (FAO) (2014) The United Nations Convention on the Law of the Sea of 1982 (UNCLOS 1982) is an international law, which was ratified by more than 162 countries worldwide. It is a foundation of other voluntary instruments used to regulate the fisheries sector. The Code of Conduct for Responsible Fisheries and the International Plan of Action to Prevent, Deter and Eliminate Illegal, Unreported and Unregulated Fishing (IPOA-IUU) were the two voluntary instruments, which were developed based on the principles of UNCLOS 1982. Therefore, the European Union (EU) as one of the largest seafood importers had developed, passed and implemented the Common Fisheries Policy (CFP) to implement these voluntary fisheries management instruments. The EU passed the Council Regulation (EC) No. 1005/2008 on 29th September 2008 which has been in effect since 1st January 2010. This regulation was issued in response to EU’s environmental concern as major end consumers in the food supply chain. 268 | Asea Uninet Scientific and Plenary Meeting 2016 THAILAND AND THE EU “YELLOW CARD” 2 2.1 “Yellow Card” as a warning and the EU recommendations Thailand has been categorized as a country with a marine captured fisheries production higher than 1 million metric tons. As one of the top seafood exporters, Thailand has faced many problems regarding IUU fishing over the past years and has received unofficial warnings from the EU from time to time. With no significant improvements in fisheries policies and regulations, the EU finally issued the “Yellow Card” warning on 21st April 2015. The EU has recommended Thailand to solve problem of fisheries with 3 points of consideration, as follows. (1) Thailand should amend the fisheries law (BE 1947) which currently remains implementing. The EU views that this law is out-of-date and not in accordance with international law; for example, no concrete measures for punishing fishing boats that intentionally violate the law by destroying natural resource of the sea. Thailand should add more legal punishment to that out-of-date law. (2) Thailand should apply the mechanism of traceability. The EU recommended that Thailand should have a surveillance system to monitor fishing boats both in Thailand’s territorial waters and in other countries’ territorial waters. It emphasizes that the VMS monitor should be installed to all fishing boats; this system will allow Thai officials to follow any fishing boats that are likely to violate the law by fishing in the prohibiting or conserving zones. Moreover, the boat owners should register their boats with Thai office of registrar so as to confirm their ownership with the implement of fisheries records by themselves; for example, the details about captain, crews, locations of fishing, type of fish caught from that locations and the number of fish caught, in order to compare the records with other countries to see if these fishing boat owners really conduct the legal fisheries. Furthermore, it is suggested to increase the number of notification centers for checking inand-out boats up to 28 points. These check points serves as facilitating and inspecting units for every fishing boat, including any boats with the import of raw materials from other counties to be processed in Thailand. In doing so, these activities could cover all responsibilities borne by the boat owners who sail in Thailand’s territorial waters. (3) Thailand should initiate the national plan of action or NPOA-IUU; the strategic planning recommended by the EU in an accordance with IPOA-IU. 2.2 The EU as Thailand’s Trade Partner The EU is one of the largest seafood importers in the world and is considered one of the most important seafood imports from Thailand. The EU’s imported seafood market has the highest value, compared to the other world’s food industries. According to the Office of Agricultural Economics, Seafood that was exported from Thailand to the EU was valued at the total of THB 27,688.91 in 2014. Please see the table below. Table 1 Volume and Export Value of Thailand to European Union from 2007-2015 Year Volume (ton) % of change Export Value (mil. baht) % of change 2007 2008 2009 2010 265,254.84 274,195.13 264,578.40 255,442.26 3.37 -3.51 -3.45 31,182.74 36,777.60 33,920.99 35,304.67 17.94 -7.77 4.08 Asea Uninet Scientific and Plenary Meeting 2016 2011 2012 2013 2014 2015 (first half) 239,440.81 106,627.30 194,281.00 167,978.52 72,322.63 -6.26 -13.70 -5.98 -13.54 -14.01 37,586.87 35,042.32 32,349.22 27,688.91 10,233.09 | 269 6.46 -6.77 -7.69 -14.41 -27.91 Source: International Fishery Products Trade Thinking Group, Fisheries Foreign Affairs Division and Custom Department, cited in IUU: Situation, Problems and Solutions by Faculty of Fisheries, Kasetsat University. The EU measures on IUU fishing will certainly affect Thailand’s economy and fisheries sector. The “Yellow card” is a warning for Thailand to improve its IUU fishing practices. Nevertheless, the EU had given Thailand 6 months to improve its act and solve this problem. The EU council will coordinate with the Thai government to help improve its fisheries law. If there has not been any progress, Thailand will be issued a “Red Card”, which will severely affects the Thai fisheries sector by banning all Thai fisheries products from entering the EU markets. 3 THAILAND’S INITIAL AND OFFICIAL REPONSES The Thai government, led by the Department of Fisheries (DOF), recognized the importance and the urgency of the issues. As a result, the Command Center for Combating Illegal Fishing (CCCIF) was established on 29th April 2015. The CCCIF consists of various governmental departments and relevant private sectors. The purposes of CCCIF are to expedite solutions to the IUU fishing problems; to promote a shift to sustainable fisheries and to raise standards of the Thai fishing industry up to international standards; as well as to alleviate the problems facing fisheries operators by issuing new regulations and measures. Some of laws and regulations issued by CCCIF are shown below,     The issuance of law for arresting illegal fishing boats without decriminalizing. This aims at acquiring the actual number of illegal fishing boats in order to assess Thailand’s Maximum Sustainable Yield (MSY), which is considered as the measure to standardize Thai fishing in order to meet the international and EU criteria on fisheries. The announcement of list of prohibited fishing equipments. The announcement of license withdrawal of fishing boats which do not comply with and report to the officials. The announcement of day-offs for fishing boats in order to lower the number of fisheries workforce in the sea at the same time. 1) 2) 3) The boats with otter trawl should change the day-offs from 1st - 3rd and 11th - 16th of every month to 1st – 3rd and 16th – 17th of every month. The boats with surrounding nets in Thai Bay (9 days) should change the day-offs from 1st – 3rd, 11th – 13th and 21st – 23rd of every month to 11th – 15th of waxing moon and 1st – 4th of waning moon. The boats with surrounding nets in Andaman Sea (5 days) should change the day-offs from 1st – 3rd and 11th – 12th to 13th – 15th of waxing moon and 1st – 4th of waning moon. Despite having issued further regulations as responses to the EU “Yellow Card” warning, the past government with these ongoing measures has gained both support and 270 | Asea Uninet Scientific and Plenary Meeting 2016 opposition from relevant stakeholders, especially from members of fisheries industry. The questions raised by the society include; what is root cause of problems and how appropriate the government solutions to problems in the past and the future. 4 SPECIAL ACADEMIC TASK FORCE The method the researcher employed in the present essay is the brainstorming of the relevant parties, especially those who specialize in the field of fisheries. In this light, academic institutions led by Chulalongkorn University and other relevant organizations in Thailand have shown their interest and became involved in information collection, successful seminars, and many social gatherings considered relevant to these pressing issues. The stakeholder engagement seminar and the report finding seminar, which were held at Chulalongkorn University on 7th and 28th September 2015 respectively has come up with useful information and policy recommendations. These findings and policy recommendations are summarized in the following sections. 4.1 Finding from the Meetings From the consideration of problems and suggestions at the first, second and third seminars, we are able to divided the findings into eight points, as follows. 1) 2) 3) 4) All relevant stakeholders have agreed upon the common challenge and problem that Thailand’s marine fisheries system is ineffective. The case of EU “Yellow Card” can be a lesson learn and an opportunity to find the way to systematically solve the problem, thereby eventually leading to sustainable future’s activities for all parties and taking on the positive dimension of creativity in problem solving. A number of measures issued by governmental agencies, Command Center for Combating Illegal Fishing in particular, resulted in a huge adjustment of upstream, middle stream, downstream stakeholders in the entire national fisheries, especially commercial fisheries. This adjustment is inevitably related to how to find the appropriate and possible gateway and practice together in an attempt to handle the change imposed by the above agencies and complaints from those who are affected by it. These complaints shows the hastening of decision making without reviewing and scrutinizing all relevant information from academic community and, if any, the participation or hearing from stakeholders, particularly the fishermen themselves. There are some questions as to how the problem has occurred and what the government’s result or failure is so that the “Yellow Card” was given to Thailand (so as to make use of them to solve the problem). It is because the EU has been sporadically warning Thailand for such a long time, but little was done to systematically tackle the problem or find a possible solution. It should also together seek for any appropriate regulations possible to the real implementation and resonating with the EU recommendations. All parties perceived the same problem but with different perspective. It is due to the complexity and uniqueness of problem concerning Thai fisheries context. This leads to the lack of common understanding. The problem might not be merely the “Yellow Card”. Or, how to deal with its Asea Uninet Scientific and Plenary Meeting 2016 5) 6) 7) 8) | 271 consequences might not solely lead to the way to sustainably solve the problems present to Thai fisheries industry. The problem should be addressed by every sector in society, which normally involves a number of stakeholders. This is considered basic problem of living for people in many level of a society; there are either positive (or seemingly not affecting) and negative consequences. The method of dealing with the problem should be more systematic, wellrounded and truly integrating with other relevant agencies. Or else, the intention to solve the problem would only turn out to be a stepping stone to other problems yet to come. The appropriateness, readiness and correctness of knowledge already applying to the problem solving in the first stage are under criticism, especially by the concerned academic groups who specialize in management of marine fisheries as one of national resources in Thailand. The sustainability of the tools to deal with the problem (such as CCCIF, Article 44 or other laws under the emergency period) remains questionable, in terms of appropriateness of the legal aspect of the fisheries and real implementation by stakeholders. The hastening process of problem solving in accordance with the EU warning (within 6 months) actually go against the real conditions of the problem and ultimate goal of complete solutions for marine fisheries. International Experience with the EU IUU Yellow card Since the EC IUU regulation came into force in 2010, experience has accumulated with its implementation. As of 2013, three countries were blacklisted-Belize, Cambodia and Sri Lanka. Warnings were given to South Korea, Ghana and Curacao, for reasons of insufficient progress in cooperating with the EU in addressing weaknesses in the control of fishing vessels and lack of action to address deficiencies in monitoring, controlling and surveillance of fishing activities. In 2014, the Yellow Card wa issued to the Philippines. In 2015, Taiwan and Comoros received the Yellow Card warning. The situation as of today(February 2016) is summarized below, based on available information. South Korea The Yellow Card to South Korea was lifted in 2015. According to EU statement, “ the decision to stop the procedure vis-à-vis of Korea(and Philippines) is explained by the constructive cooperation.. which have made significant reforms in their fishery management systems with the help of the Commission..(highlight by the author)” including introducing “new legislation and improved monitoring, control and inspection set-ups and revamped ..traceability sysems”. Another comment on Korea’s action reads:”Korea’s efforts to stop illegal fishing are unprecedented in the region and demonstrate a clear intent to deliver national and international leadership to combat IUU fishing..” However, the comment adds that “flag states need to maintain a firm grip on their ditant water fleet..the Korean industry, in particular Korean fishing vessel operators, must match the intention of their government, make sure they abide by the law and become an exemplary distant-water fleet.” Ghana Ghana received the Yellow card warning in 2013, and the warning was lifted in 2015. The EC stated the reason for lifting the wardning as follows: Ghana has “successfully addressed the shortcomings in their fisheries governance system .. amended the legal 272 | Asea Uninet Scientific and Plenary Meeting 2016 frameworks to combat IUU fishing, strengthened their sanctioning systems, improved monitoring and control of their fleets and are now complying with international law”. Papua New Guinea received the Yellow Card warning in 2014, and the warning was lifted in 2015 at the same time and for the same reasons as Ghana, (sees above). Curacao (no information) Philippines was issued the Yellow Card by the EU in 2014, on grounds of being challenged with the implementation of measures to address IUU fishing. The warning was lifted in 2015. Statements from the EU read:”The Philippines hastaken responsible action , amended its elgal systems and switched to proactive approach against illegal fishing.” It also cited “the improvement of the traceablity and catch certification schemes, reinforced cooperation with Papua New Guinea for inspection and control and coverage of the activities of the long distant fleet operating beyond Philippine waters.” In a statement welcoming the EU’s decision, the Philippines’ Department of Agriculture said that the decision was “a formal recognitionof the Aquino administration’s commitment to put an end to unsustainable fishing practices which compromised the country’s marine resources and the long-term livelihood of around 1.8 million fishery stakeholders.” Taiwan and Comoros In the case of Taiwan, the Yellow Card was issued for reasons of: “serious shortcomings in the fisheries legal framework, a system of sanctions that does not deter IUU fishing and lack of effective monitoring, control and surveillance of the long-distance fleet..and Taiwan does not systematically comply with Regional Fisheries Management(RFMO) obligations.” Comparative observations with Thailand’s case Based on the above summary accounts, the case of Thailand may be considered as follows. The Thai government has taken its time in responding to the EU preliminary approaches regarding the warning, until it was formally issued with the Yellow Card in 2015. There was clearly some problem with the legislative process in relation to the regulation of the fishery sector. The actions taken by the Thai government have focused on the revision of the fishery laws. A revised Act was issued in early 2015, then the Act was revoked in November 2015 and replaced with a Royal Decree, which provides for a more stringent and detailed regulatory system for the sector. In this way, it may be observed that there seems to be a clear commitment to address the problems of IUU fishing by the national authorities. As of now, the implementation of the new regulation has come up against some resistance from the small fishermen practicing artisanal fishery. How this will play out remains to be seen. The process of adapting the behavior of the various stakeholders within the fishery sector clearly takes time. But to conclude on a positive note, the EU IUU Yellow card has proved to be a wakeup call for the country to rethink its fishery management system, and hopefully will lead it to move on to a more sustainable mode of operation. 5 CONCLUSION AND SUGGESTIONS It is undeniable that the ineffective marine fisheries management has long been the problem in the Thailand for much longer time than the “EU’s Yellow Card” problem. This reflects the weakness of the marine fisheries management in Thailand, and there is a need for Asea Uninet Scientific and Plenary Meeting 2016 | 273 effective Ocean Governance. This is because marine fisheries is very complex in nature, especially within Thailand. Worse yet, the “Yellow Card” warning by the EU has reflected the crisis in the Thai fisheries system with strong relevance to the global fisheries policy. The main goal of IUU fishing measures of EU is to promote sustainable fishing and to conserve marine resources and food source for future generations. This is a very lengthy process, which requires a very large budget even when this is implemented within the EU region. In comparison to Thailand, the if the Thai government gives the importance to short-term economic benefits of the fisheries sector and adopts urgent measures aiming to quickly remove Thailand from the IUU watch list, this may not fix the real problems. The shortterm government measures and regulations which do not take into account sustainable development principles may not truly benefit the marine resources and may cause many other problems recently experienced in the fishing sector. The seminar on the fisheries problem and the EU “Yellow Cards” has resulted in 2 groups of solution: short-term implementations in dealing with the “Yellow Card” warning and long-term management to uphold the sustainability of Thai fisheries industry. Short-term implementations in dealing with the “Yellow Card” warning a) Recommendations on the day-offs for fishing boats - There should be a clear survey to acquire information about fisheries. - The day-off for fishing boats should be determined according to daily life of the fishermen in each area. b) Recommendations on the lowering of the number of boat and equipment - There should be the annual census on the type and number of fishing boat, as well as number of equipments. - If it is necessary to refer to the Maximum Sustainable Yield (MSY) or the Catch per Unit Effort (CPUE), there should be a study with the use of academic methodology to gain the findings as correctly as possible. - The evaluation of the number of fishing boat and equipment which is lowered should be conducted to see whether the policy is effective. - The government should reasonably pay the compensation to the fishermen. c) Recommendations on the ownership of unregistered fishing equipment in the boat. - Both entrepreneurs and governmental agencies need to be cooperating by stepping back to see if there are any miscommunications and find the common ground in dealing with the fisheries problems. - There should be the reconsideration of net-size prohibition due to the fact that the fisheries is not solely dependent on the size of the net. d) Recommendation on the registration of boats and license for fisheries. - The governmental agencies should speed up the process of permanent and temporary license issuance in order to lessen the difficulty the fishermen have to encounter and not to impede the flow of fisheries industry. e) Recommendation on the installation of Vessel Monitoring System (VMS) according to the time frame set by CCCIF. 274 | Asea Uninet Scientific and Plenary Meeting 2016 - The appropriate technology concerning the fisheries monitoring should be acquired inside Thailand, so as to lower the budget for purchasing and installing the said system. f) Recommendation on the problem of how to improve the tracing system. - It is necessary to assess with concrete feedback the consequences derived from the operation of the system. g) Recommendation on the problem of human trafficking. - There should be the registration of labor at the designated times. Long-term recommendations for sustainably managing Thailand’s fisheries system a) Recommendations on the lack of participation from academia, entrepreneurs and representatives from fishermen in giving useful information and drafting rule and regulation. - There should be a working group of think tank with which the governmental agencies could seek consultation. - The committee on appraisal of the actual requirements from IUU. - The change of attitude and trustworthiness between fishermen and officials should be promoted. - The children and students should be encouraged to involve and participate in this issue. b) Recommendation on the enforcement of new fisheries law. - The government should consider the foreseeable consequences on Thailand after the enforcement of new fisheries law, particularly regarding the control of number of fishing boat and equipment, the zoning of local and commercial fisheries, and the tracing of fisheries, prior to its official announcement. In addition to the above recommendations from seminars by working group, Phadermsak Jarayabhand et al. (2007) actually five components in dealing with this problem: 1) 2) 3) 4) 5) Academic knowledge; Management tools (developing policy and management recommendations); The Cabinet (responsible for coordinating at the policy level); Government departments (responsible for implementing policies, including ad-hoc body consisting of representatives from various departments working together; and, Civil society, which includes all relevant stakeholders, local communities, private sector, throughout the food supply chain and they should be involved in all processes from developing policy to implementation. All five components mentioned above are equally important and must be truly integrated to successfully solve the issues. The CCCIF is the only one component (part 4) of the overall management framework to achieve sustainable fisheries. This triggers the final question of “Would we successfully solve these issues?” And if the answer is “not” Asea Uninet Scientific and Plenary Meeting 2016 | 275 then every single Thai person will be affected at different level. An establishment of a Think Tank may be one answer to help solve these issues. A Think Tank is highly necessary to increase capabilities and effectiveness of the government and other relevant organizations in solving these issues. Moreover, solutions to IUU fishing practices require timeline and systematic plans, which are appropriate to the context and nature of Thai fisheries sector. It also requires a large sum of continual budget to support the implementation of the plans. However, the academic generally views that Thailand still has room for improvements that will allow the national fisheries production to return to productive status. It is important to start solving these issues today for the security, prosperity and sustainability of the country. REFERENCES In English Environmental Justice Foundation (EJF). (2015). Keeping Illegal Fish out of Europe. London: EJf. Food and Agriculture Organization of the United Nation (FAO). (2014). The State of the World Fisheries and Aquaculture. Rome : FAO Official Journal of the European Union. (2015). “COMMISSION DECISION of 21 April 2015 on notifying a third country of the possibility of being identified as a noncooperating third country in fighting illegal, unreported and unregulated fishing”. Retrived from http://eur-lex.europa.eu/legalcontent/EN/TXT/?uri=CELEX%3A32015D0429(02). In Thai Office of the National Security Council. (2014). Policy of National Security 2015-2021. Bangkok: Cabinet and Royal Gazzette Publishing Office. In Thai [สํานักงานสภาความมั่นคงแห่งชาติ. 2558. นโยบายความมั่นคงแห่งชาติพ.ศ. 25582564. กรุงเทพฯ: สํานักพิมพ์คณะรัฐมนตรีและราชกิจจานุเบกษา]. Phadermsak Jarayabhand, et al. (2007). Marine national interests: Current situations and suggestions. Bangkok: The Thailand Research Fund. In Thai [เผดิมศักดิ์ จารยะพันธุ์ และคณะ. (2550) ผลประโยชน์แห่งชาติทางทะเล: สถานการณ์และข้อเสนอแนะ. กรุงเทพฯ: สํานักงานกองทุนสนับสนุนการวิจัย. 64 หน้า. ISBN: 978-974-13-2751-5]. Sompong Sucharitkul, Thep Menasavet and Wichan Sirichai-ekkawat. (2014). The future (of Thai seas) that we want: 1st volume. Bangkok: Marine Knowledge Management Subcommittee (MKMS). In Thai [สมปอง สุจริตกุล, เทพ เมนะเศวต และวิชาญ ศิริชัยเอกวัฒน์. 2557. อนาคต (ทะเลไทย) ที่เราต้องการ : ลําดับที่ 1. กรุงเทพฯ : สํานักงานเลขานุการคณะอนุกรรมการจัดการความรู้เพือ ่ ผลประโยชน์แห่งชาติทาง ทะเล (อจชล.)] Wichan Sirichai-ekkawat. (2014). Thai seas: How to effectively and sustainably use marine resources in the challenge of Thai marine national interest management under the international regulations. Bangkok: The Thailand Research Fund. In Thai [วิชาญ ศิริชัยเอกวัฒน์. (2556). ทะเลไทย: ทําอย่างไรการใช้ทรัพยากรสัตว์นําจึงมั่นคงมั่งคั่งและยั่งยืนในความท้าทายการจัด การผลประโยชน์แห่งชาติทางทะเลไทยภายใต้กติกาสากล. กรุงเทพฯ: สํานักงานกองทุนสนับสนุนการวิจย ั ]. 276 | Asea Uninet Scientific and Plenary Meeting 2016 Online sources http://ec.europa.eu/fisheries/cfp/illegal_fishing/index_en.htm http://www.thaistopiuufishing.com http://www.iqnewsclip.com/selection/newsservice.aspx?uid=00000043 http://www.mkh.in.th/index.php/2010-03-22-18-03-43 http://www.greenpeace.org/ QUORUM SENSING INHIBITION AS AN ALTERNATIVE METHOD TO PROTECT PRAWN LARVAE FROM BACTERIAL INFECTION Pande Gde Sasmita J. pande.sasmita@unud.ac.id Dept. of Aquatic Resources Management, Faculty of Marine Science and Fisheries, Udayana University, Bali, Indonesia Abstract Aquaculture is the fastest-growing food-producing sector worldwide. One of the major aquaculture species is the giant freshwater prawn, Macrobrachium rosenbergii. However, diseases caused by various opportunistic pathogenic bacteria such as Vibrio spp. constitute a significant obstacle for the further expansion of M. rosenbergii cultivation. The wide and frequent use of antibiotics to control infections in aquaculture has resulted in the development and spread of antibiotic resistance. As this is gradually rendering antibiotic treatments ineffective, new strategies to control bacterial infections are needed for a sustainable further development of the aquaculture industry. Many bacterial aquaculture pathogens regulate their virulence gene expression through quorum sensing (QS) mechanism, the bacterial cell-to-cell communication, and consequently, quorum sensing inhibition has been suggested as a novel strategy to control infections. In this study, we performed enzymatic inactivation of quorum sensing signal molecules by application of QS signal molecule-degrading bacteria. The bacteria strain was isolated from the microalgae Chaetoceros muelleri culture. This isolate are able to degrade signal molecules i.e. acylhomoserine lactones (AHL) and protect M. rosenbergii larvae from disease caused by pathogenic Vibrio harveyi. Since the degradation of quorum sensing signal molecules has been shown to protect prawn larvae from bacterial infection, this method might be interesting novel biocontrol strategy for use in aquaculture. Keyword: AHL-degrading bacteria, larviculture, vibriosis. 1 INTRODUCTION Aquaculture comprises the farming of aquatic organisms, including fish, mollusks, crustaceans and aquatic plants. As the fastest growing food producing sector (Bostock et al., 2010), aquaculture plays an important role in the economic development worldwide, especially in many developing countries. One of the commercially important aquaculture species is the giant freshwater prawn Macrobrachium rosenbergii (de Man, 1879). Disease outbreaks are considered to be amongst the major obstacles to produce healthy and high quality seed of giant river prawn culture. Previous studies have shown that Vibrio spp., including Vibrio harveyi, are a major cause of diseases in the early life stages (larvae and postlarvae) of this species (Tonguthai, 1997). The frequent use of antibiotics to control vibriosis in shrimp hatcheries has led to the development and spread of antibiotic-resistant bacteria (Karunasagar et al., 1994), and Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 277 278 | Asea Uninet Scientific and Plenary Meeting 2016 alternative methods are needed to control these bacterial infections. Recently, it has become clear that the virulence of V. harveyi is under control of quorum sensing, a regulatory mechanism based on secreting and sensing small signal molecules called autoinducers (Henke & Bassler, 2004; Defoirdt et al., 2008; Natrah et al., 2011). V. harveyi contains a three-channel quorum sensing system, with three different types of signal molecules (HAI1, AI-2 and CAI-1, respectively) feeding a common signal transduction cascade (Ruwandeepika et al., 2012). We previously reported that V. harveyi quorum sensing regulates its virulence towards giant freshwater prawn larvae, in which the HAI-1 and the AI-2 mediated channels of the V. harveyi quorum sensing system are essential for full virulence to giant river prawn larvae (Pande et al., 2013). The use of signal molecule-degrading bacteria is one of the most intensively studied strategies to interfere with quorum sensing (Pande et al., 2015). The ability to inactivate acylhomoserine lactones (AHLs), one of the types of quorum sensing molecules, is widely distributed in the bacterial kingdom (Dong et al., 2007). As V. harveyi HAI-1 is an AHL and as this signal is essential for full virulence towards giant river prawn larvae, the use of AHL-degrading bacteria might be an effective strategy to protect the larvae from the pathogen. 2 2.1 MATERIAL AND METHODS Isolation of AHL-degrading bacteria from Chaetoceros muelleri culture Open culture of microalgae Chaetoceros muelleri was grown in Guillard’s F/2 medium (with an addition of silicate) in sterile 250 ml Schott bottles provided with 0.22 µm filtered aeration. All culture parameters were kept constant (pH 7, continuous light of 100 µmol photons.m-2sec-1, temperature of 24oC and 30 g.l-1 salinity). The cell density was measured using a Bürker hemocytometer. 50 µl of the culture was transferred to sterile erlenmeyer flasks containing 5 ml of sterile NaCl solution (30 g.l-1) containing 50 mg.l-1 N-hexanoyl-L-homoserine lactone (HHL). The erlenmeyer flasks were covered with aluminium foil to prevent the growth of the microalgae and were incubated on a shaker (120 rpm) at 24°C. The isolation was performed in four consecutive cycles (72h for the first cycle and 48h for the second to fourth cycle). At the end of each cycle, 50 µl of the suspension was transferred to a new flask. At the end of the fourth cycle, the suspensions were spread-plated on Luria-Bertani agar containing 30 g.l-1 NaCl (LB30) and after 48h incubation at 24°C, colonies were picked, suspended in a 30 g.l-1 NaCl solution and plated again. After 3 rounds of purification, isolates were grown in LB30 broth for 24h at 24°C and grown culture were stored at -80°C in 40% glycerol. The isolate was used in further experiments. 2.2 Bacterial strains and culture conditions Vibrio harveyi BB120 (Bassler et al., 1997), its mutant JAF548 (Freeman & Bassler, 1999) and the AHL-degrading isolate were stored at -80oC in 40% glycerol. The stocks were streaked onto LB agar and after 24 hours of incubation at 28oC, a single colony was picked and inoculated into 5 ml fresh LB broth and incubated overnight at 28 oC under constant agitation (100 min-1). 2.3 Quantification of N-hexanoyl-L-homoserine lactone (HHL) A plate diffusion method was used for quantitative detection of HHL using Chromobacterium violaceum CV026 as a reporter (Defoirdt et al., 2011). Briefly, CV026 was grown to an optical density of around 2 at 550 nm in buffered (2 g/l MOPS) LB Asea Uninet Scientific and Plenary Meeting 2016 | 279 medium (pH 6.5) containing 20 mg.l-1 kanamycin and spread over buffered (pH 6.5) LB plates. Subsequently, 10 µl of sample solution was applied to the centre of the plates and the plates were incubated at 28°C for 24h and 48h. After the incubation, the zone of purplepigmented CV026 was measured and the concentration of HHL in the sample was calculated based on a standard curve. 2.4 AHL degradation assay AHL degradation by the isolate was studied as reported previously (Defoirdt et al., 2011). Briefly, the isolate was inoculated at 108 CFU.ml-1 in buffered LB30 medium (pH 6.5) supplemented with 10 mg.l-1 HHL. At regular time intervals, 1 ml samples from each culture were taken and filtered over a 0.2 µm filter. The HHL concentration in the cell-free supernatants was determined as described above using C. violaceum CV026. 2.5 Giant freshwater prawn larvae challenge test Giant freshwater prawn challenge tests were performed as described in Pande et al. (2013). Briefly, larvae were obtained from a single oviparous female breeder. A matured female which had just completed its pre-mating molt was mated with a hard-shelled male. The female with fertilized eggs was then maintained for 20 to 25 days to undergo embryonic development. When fully ripe (indicated by dark grey color of the eggs), the female was transferred to a hatching tank (30 l) containing slightly brackish water (6 g.l-1 salinity). The water temperature was maintained at 28°C by a thermostat heater. After hatching, the newly hatched larvae with yolk were left for 24 hours in the hatching tank. The next day, prawn larvae with absorbed yolk were distributed in groups of 25 larvae in 200 ml glass cones containing 100 ml fresh autoclaved brackish water (12 g.l-1 salinity). The glass cones were placed in a rectangular tank containing water maintained at 28°C and was provided with aeration. The larvae were fed daily with 5 Artemia nauplii/larva and acclimatized to the experimental conditions for 24 hours. During the experiments, water quality parameters were kept at minimum 5 mg.l -1 dissolved oxygen, maximum 0.5 mg.l-1 ammonium-N and maximum 0.05 mg.l-1 nitrite-N. Larvae were challenged by adding 106 CFU.ml-1 of V. harveyi BB120 to the rearing water on the day after first feeding. The AHL-degrader isolate was added at 105 CFU.ml-1. Survival was counted daily in the treatment receiving V. harveyi BB120 only, and the challenge test was stopped when more than 50% mortality was achieved. At this time point, larval survival was determined in all treatments by considering that only those larvae presenting movement of appendages were alive. The larval stage index (LSI) was determined according to Maddox and Manzi (1976) by randomly sampling 5 larvae from each treatment and calculated as: LSI = Σ Si/N Si : stage of the larva (i = 1 to 12) N : the number of larvae examined. 2.6 Statistical data analysis Statistical analyses were performed using the SPSS software, version 20. Giant freshwater prawn survival data were arcsin transformed in order to satisfy normal distribution and homoscedasticity requirements. Data were analyzed by one way ANOVA, followed by Tukey multiple range tests with a significance level set at 0.05. 280 | Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 RESULTS Isolation of AHL-degrading bacteria from Chaetoceros muelleri culture AHL-degrading strain was isolated from open culture of Chaetoceros muelleri by sequentially culturing in a medium containing N-hexanoyl-L-homoserine lactone (HHL) as the sole carbon and nitrogen source. The isolate was inoculated at 108 CFU.ml-1 in buffered LB medium supplemented with 10 mg.l-1 HHL in order to determine whether they were able to degrade AHL. The isolate was able to degrade HHL with degradation rate of 0,75 mg.l-1.h-1 (Fig. 1). [HHL] (mg.l-1) 12 10 8 6 4 2 0 0 3 6 9 12 Time (h) Figure 1. N-hexanoyl-L-homoserine lactone (HHL) degradation by the isolate. 3.2 Impact of the isolate on AHL quorum sensing in Vibrio harveyi Because bioluminescence is one of the phenotypes that are regulated by quorum sensing in V. harveyi, we used bioluminescence as a read-out of quorum sensing activity and determined the impact of the isolates on bioluminescence of wild type V. harveyi BB120. In order to compensate for the competition for nutrients, we mixed BB120 with its mutant JAF548 as a control. JAF548 has a completely inactive quorum sensing system (and therefore is not luminescent; Freeman & Bassler, 1999). The results revealed that the isolate decreased quorum sensing-regulated luminescence of V. harveyi in co-culture (Fig. 2). Importantly, the isolates did not affect the growth of V. harveyi in co-culture (Table 1). Asea Uninet Scientific and Plenary Meeting 2016 | 281 Figure 2. Quorum sensing-regulated bioluminescence of V. harveyi BB120 in coculture with the AHL-degrader isolate. A co-culture with the dark mutant of BB120, JAF548, served as control. Error bars represent the standard deviation of 6 replicates Bioluminscence intensity (cps) 1000000 BB120 + JAF548 100000 BB120 + isolate 10000 1000 100 10 0 2 4 6 8 Time (h) 10 12 . Table 1. Impact of the isolates on cell density of V. harveyi BB120 after 12 hours of coculture as determined by plate counting of luminescent cells. Treatment BB120 + JAF548 BB120 + Isolate Cell density (x 108 CFU/ml) 4.7 ± 0.5a 4.6 ± 0.2a Values in the same coloumn with different superscript letters are significantly different (p<0.05) 3.3 Impact of the AHL-degrader strain on the survival and growth of giant freshwater prawn larvae challenged with Vibrio harveyi The previous research showed that AHL quorum sensing is essential for full virulence of V. harveyi towards giant river prawn larvae (Pande et al., 2013). Hence, since the isolate was able to interfere with quorum sensing in V. harveyi, we went further to investigate whether this isolate was able to protect giant river prawn larvae from the pathogen. Addition of the isolate to the rearing water indeed resulted in a significantly improved survival of challenged prawn larvae (Table 2). Consistent with our previous work, we found no difference in growth (as assessed by determining the larval stage index) between the different treatments. Table 2. Survival and growth (as expressed by the larval stage index -LSI) of giant freshwater prawn larvae after 6 days of challenge with V. harveyi BB120 (average ± standard deviation of 5 replicates). “Control” refers to unchallenged larvae that were otherwise treated in the same way as the other larvae. Treatment Control BB120 BB120 + Isolate Survival (%) 83 ± 7c 42 ± 8a 67 ± 5b LSI 4.4 ± 0.5a 4.4 ± 0.5a 4.6 ± 0.5a Values in the same coloumn with different superscript letters are significantly different (p<0.05) 282 | Asea Uninet Scientific and Plenary Meeting 2016 4 DISCUSSION This study focused on quorum sensing disruption by acyl-homeserine lactone (AHL)degrading bacteria isolated from microalgae culture. Microalgae are an important constituent in many aquaculture systems, especially in the so-called green-water systems, which are characterised by high levels of microalgae in the rearing water (Hargreaves, 2006). These green-water systems are currently used to culture various aquaculture animals and empirical evidence points to a better growth and survival in these systems when compared to the conventional clear water aquaculture (Muller-Feuga, 2000). However, the mechanisms by which green-water exert a beneficial effect are still poorly understood, especially the potential beneficial effects of bacteria associated with micro-algae remain largely unexplored (Natrah et al., 2013). The AHL-degrader strain was isolated from open culture of Chaetoceros muelleri. The isolate showed HHL degradation rates that were similar to those of Bacillus sp. strains isolated from the intestinal tract of shrimp and fish (0.7-0.9 mg.l-1.h-1) (Defoirdt et al., 2011). HHL was used as test compound because it is relevant to aquaculture. Indeed, it is produced by pathogenic bacteria such as Aeromonas hydrophila, Aeromonas salmonicida, Edwardsiella tarda and Vibrio salmonicida (Defoirdt et al., 2011). The AHL molecules produced by different bacteria all shares the homoserine lactone moiety, but they differ in the length and substitution of the acyl side chain (Dong & Zhang, 2005). The structural features of AHLs (Fig. 3) suggest that there may be at least four types of enzymes that could degrade AHL signals, Among them, lactonases and decarboxylases hydrolyze the lactone ring at the positions marked as 1 and 2, while acylases and deaminases separate the homoserine lactone moiety and acyl side chain at sites 3 and 4, respectively (Dong & Zhang, 2005). Figure 3. AHL structure and its potential cleavage sites by AHL inactivating enzymes To date, only two groups of AHL-degrading enzymes have been demonstrated enzymatically and structurally to inactivate AHL substrates, i.e., AHL lactonases and AHL acylases (Dong & Zhang, 2005). Several Bacillus species have been reported to produce AHL lactonases, which inactivate AHLs by hydrolysing the lactone ring (Dong & Zhang, 2005). Lactonases are intracellular enzymes capable of inactivating a wide range of AHLs, varying in acyl chain length and substitution (Dong et al., 2007). Meanwhile, Pseudomonas species have been reported to produce AHL acylases, which cleave AHLs by aminohydrolysis into homoserine lactone and fatty acid (Dong & Zhang, 2005). Our in vivo challenge test revealed that the isolate significantly increased the survival of giant freshwater prawn larvae challenged with V. harveyi, whereas the isolate had no effect on larval growth. This is consistent with our previous work showing that AHL quorum sensing is essential for full virulence of V. harveyi towards giant freshwater prawn larvae (Pande et al. 2013) and previous reports documenting that AHL degraders are able to improve the survival of prawn larvae (Cam et al. 2009) and turbot larvae (Scophthalmus Asea Uninet Scientific and Plenary Meeting 2016 | 283 maximus L.) (Tinh et al. 2008) in the presence of exogenous AHL (which caused mortality in both species; probably by triggering pathogenicity mechanisms in pathogenic bacteria that were naturally present in the cultures). Hence, the use AHL-degrader bacteria molecules might be an interesting new type of probiotics for aquaculture with a defined mode of action. Along this line, AHL-degrading Bacillus sp. have been shown to inhibit the protease production, hemolytic activity and biofilm formation of A. hydrophila strain YJ-1, and to significantly improve the survival of zebrafish (Danio rerio) challenged with this pathogen (Chu et al. 2014). Further research is needed to reveal the efficacy of the isolate in different aquaculture host–pathogen systems. REFERENCES Bassler, B.L., Greenberg, E.P., Stevens, A.M. (1997). Cross-species induction of luminescence in the quorum sensing bacterium Vibrio harveyi. J. Bacteriol. 179:4043-4045. Bostock, J., McAndrew, B., Richards, R., Jauncey, K., Telfer, T., Lorenzen, K., Little, D., Ross, L., Handisyde, N., Gatward, I., Corner, R. (2010). Aquaculture: global status and trends. Phil. Trans. R. Soc. B. 365:2897-2912. Cam, D.T.V., Nhan, D.T., Ceuppens, S., Hao, N.V., Dierckens, K., Wille, M., Sorgeloos, P., Bossier, P. (2009). Effect of N-acyl homoserine lactone-degrading enrichment cultures on Macrobrachium rosenbergii larviculture. Aquaculture 294:5-13. Chu, W., Zhou, S., Zhu, W., Zhuang, X. (2014). Quorum quenching bacteria Bacillus sp. QSI-1 protect zebrafish (Danio rerio) from Aeromonas hydrophila infection. Sci. Rep. 4:5446. Defoirdt, T., Boon, N., Sorgeloos, P., Verstraete, W., Bossier, P. (2008). Quorum sensing and quorum quenching in Vibrio harveyi: lessons learned from in vivo work. ISME J. 2:19-26. Defoirdt, T., Thanh, L.D., Van Delsen, B., De Schryver, P., Sorgeloos, P., Boon, N., Bossier, P. (2011). N-acylhomoserine lactone degrading Bacillus strains isolated from aquaculture animals. Aquaculture 311:258-260. Dong, Y.H., Zhang, L.H. (2005). Quorum sensing and quorum-quenching enzymes. J. Microbiol. 43:101-109. Dong, Y.H., Wang, L.H., Zhang, L.H. (2007). Quorum-quenching microbial infections: mechanisms and implications. Philos. Trans. R. Soc.Lond. B. Biol. Sci. 362(1483):1201-1211. Freeman, J.A., Bassler, B.L. (1999). Sequence and function of LuxU: a two-component phosphorelay protein that regulates quorum sensing in Vibrio harveyi. J. Bacteriol 181:899-906. Hargreaves, J.A. (2006). Photosynthetic suspended-growth systems in aquaculture. Aquacult. Eng. 34:344-363. Henke, J.M., Bassler, B.L. (2004). Three parallel quorum sensing systems regulate gene expression in Vibrio harveyi. J. Bacteriol. 186:6902-6914. Karunasagar, I., Pai, R., Malahti, G.R., Karunasagar, I. (1994). Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture 128: 203–209. Maddox, M.B., Manzi J.J. (1976). The effects of algal supplements on static system culture on Macrobrachium rosenbergii (de Man) larvae. Proc. World Mariculture Soc. 7:677-698. Muller-Feuga, A. (2000). The role of micro-algae in aquaculture: situation and trends. J. Appl. Phycol. 12:527-534. 284 | Asea Uninet Scientific and Plenary Meeting 2016 Natrah, F.M.I., Ruwandeepika, H.A.D., Pawar, S.D., Karunasagar, I., Sorgeloos, P., Bossier, P., Defoirdt, T. (2011). Regulation of virulence factors by quorum sensing in Vibrio harveyi. Vet. Microbiol. 154:124-129. Natrah, F.M.I., Bossier, P., Sorgeloos, P., Yusoff, F.M., Defoirdt, T. (2013). Significance of microalgal-bacterial interactions for aquaculture. Rev. Aquacult. 5:1-14. Pande, G.S.J., Natrah, F.M.I., Flandez, A.V.B., Kumar, U., Niu, Y., Bossier, P., Defoirdt, T. (2015). Isolation of AHL-degrading bacteria from micro-algal cultures and their impact on algal growth and on virulence of Vibrio campbellii to prawn larvae. Appl. Microbiol. Biotechnol. 99:10805–10813. Pande, G.S.J., Natrah, F.M.I., Sorgeloos, P., Bossier, P., Defoirdt, T. (2013). The Vibrio campbellii quorum sensing signals have a different impact on virulence of the bacterium towards different crustacean hosts. Vet. Microbiol. 167:540-545. Ruwandeepika, H.A.D., Jayaweera, T.S.P., Bhowmick, P.P., Karunasagar, I., Bossier, P., Defoirdt, T., (2012). Pathogenesis, virulence factors and virulence regulation of vibrios belonging to the Harveyi clade. Rev. Aquacult. 4:59-74. Tinh, N.T.N., Yen, V.H.N., Dieckens, K., Sorgeloos, P., Bossier, P. (2008). An acyl homoserine lactone-degrading microbial community improves the survival of firstfeeding turbot larvae (Scophthalmus maximus L.). Aquaculture 285:56-62. Tonguthai, K. (1997). Diseases of the freshwater prawn, Macrobrachium rosenbergii. The Aquat. Anim. Health Res. Inst. Newsletter 4(2):1–9. GROWTH AND MOTILITY OF CORAL`S DINOFLAGELLATE ENDOSYMBIONT SYMBIODINIUM SP. AT ELEVATED TEMPERATURES Widiastuti Karim E-mail: widiakarim@yahoo.co.id* Marine Science Program, Faculty of Marine Science and Fisheries, Udayana University, Bukit Jimbaran Campus, Jimbaran 80361, Bali, Indonesia Michio Hidaka hidaka@sci.u-ryukyu.ac.jp Faculty of Science, University of The Ryukyus, Okinawa 903-0129, Japan (Corresponding Author *) Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract The worldwide outbreak of coral bleaching, in response to global climate change, initiates the rupture of coral reef ecosystems. Coral bleaching terminates the mutual partnership between coral host and dinoflagellate endosymbiont from the genus Symbiodinium. The variation of physiological characteristics among Symbiodinium phylotypes determines its sensitivity to environmental stressors. The objective of this study was to investigate growth, photosynthetic performance and motility in five Symbiodinium strains at elevated temperature. Growth and photochemical efficiency decreased rapidly in thermally sensitive strains, B-K100 and A-Y106 (clade followed by strain name), but not in thermally tolerant ones, F-K102 and D-K111. Growth and photochemical efficiency were uncoupled in strain C-Y103. This strain may redistribute energy from growth to repair of impaired photosynthetic apparatus. The number of motile cells declined as increased temperature in thermally sensitive strains. The warming seawater may limit the Symbiodinium`s growth and its capacity to infect host that ultimately limit the distribution of coral host. The restriction of corals diversity may change the ecosystem and the communities which their lives depend on it. Keywords: Symbiodinium; thermal stress; growth; photosynthetic activity; motility 1. INTRODUCTION Dinoflagellate endosymbiotic from the genus Symbiodinium supports the energy supply in Scleractinian reef builder animal through translocating up to 90% of its photosynthesis products in nutrient poor waters (Muscatine and Porter, 1977; Falkowski et al., 1984). Global climate change, particularly excessive irradiances associated with high temperature, cause the breakdown of this mutual partnership, Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 285 286 | Asea Uninet Scientific and Plenary Meeting 2016 indicated by the losses of Symbiodinium cells and/or its pigmentation; a phenomenon refered as coral bleaching (Fitt et al., 2001; Lesser, 2011). The mechanism of coral bleaching is remained unknown clearly. However, studies have reported that inability of algal cell to dissipate the excessive light energy associated with high temperature may create oxidative stress which can result apoptosis, autophagy, and necrosis of coral host and Symbiodinium cells (Weis, 2008; Lesser, 2011; Roth, 2014). Symbiodinium recently classified into nine phylotypes (A–I; Pochon and Gates 2010) which each of them shows different response to thermal stress both cultured (Robison and Warner 2006; Ragni et al. 2010; Karim et al. 2015) and inhospite (Goulet et al. 2005; Frade et al. 2008; Ulstrup and van Oppen 2003; Hennige et al. 2011; Bhagooli and Hidaka 2003). These variation in thermal sensitivity are likely due to rearrangement of photosynthetic units (Iglesias-Prieto and Trench 1997), modification of pigment concentration (Frade et al. 2008), different rate of photodamage and repair capacity (Warner et al. 1999; Takahashi et al. 2004, 2009; Ragni et al. 2010; Hill et al. 2009, 2012) and photoprotection mechanism (Warner and Berry-Lowe 2006; Krämer et al. 2012). Since physiological attributes vary inter- and intra phylotypes of Symbiodinium, therefore studies on the photosynthesis performance and growth response under elevated temperatures are important for examining the symbiosis vulnerability. As one of cell`s characteristics, motility is apparently strongly related to growth phase (Domotor and D`Elia, 1986). There are 80-85% of Scleractinian corals acquire their symbiont from the environment (Richmond and Hunter, 1990; Baird et al., 2009), thus the motility ability of Symbiodinium at high temperature might determine the capacity to infect the hosts (Trench, 1979). The objective of this study was to investigate the effect of high temperature on growth rate, photosynthetic activity and motility of six different Symbiodinium cultures. We hypothesized that thermal stress affected the growth and photosynthetic activity in Symbiodinium spp. differently. We also expected that motility might suppress in thermally tolerant strains as the ceased growth. 2. MATERIALS AND METHODS Cultures and growth conditions The cultures of Symbiodinium spp. were belonged to five clades: Y106 (clade A, from the bivalve Tridacna crocea), K100 (clade B, from thesea anemone Aiptasia pulchella), Y103 (clade C, from the bivalve Fragum sp.), K111 (clade D, from the soft coral Sarcophyton glaucum) and K102 (clade F, originally from the scleractinian coral Montipora verrucosa). The phylotypes of Symbiodinium were identified based on 28S rDNA RFLP analysis using the restriction enzyme TaqI. The cultures will be referred to as A-Y106, B-K100, C-Y103, D-K111, and F-K102 (clade type followed by culture name). These stock cultures had been maintained in f/2 medium (Sigma-Aldrich, St Louis, MO, USA) at 25 °C under a photon irradiance of ±10μmol photons m−2·s−1 (12 h light:12 h dark photoperiod cycle) provided by a white fluorescent lamp (Toshiba FL2022-BRN/18, Fuzhou, China) for more than 20years. Cultures were inoculated to a new medium and transferred to another incubator (LH70CCFL-CT, NK System, Tokyo, Japan) at the control condition (25 °C, 22–49μmol photons m−2·s−1) for two weeks prior to the experiment. Asea Uninet Scientific and Plenary Meeting 2016 | 287 Standard curves of Symbiodinium cell densities and in Vivo chlorophyll fluorescence The growth rate of Symbiodinium cells at different temperatures was measured by changes in in Vivo fluorescence. Firstly, we established a standard curve for the relationship between algal cell density and chlorophyll fluorescence intensity for each strain one day before the experiment. The cell densities of stock cultures were measured using a Neubauer improved hemocytometer (Hirschmann, Eberstadt, Germany) under a light microscope (Nikon, Optiphot-2, Tokyo, Japan). Culture of Symbiodinium cells at known density (2 x 106 cells mL−1) was made up using the hemocytometer, and a series of dilutions (between 1 x 104 and 1 x 106 cells mL−1) were prepared. We then measured the chlorophyll a fluorescence intensities of tubes containing various concentrations of Symbiodinium cells using a fluorometer (TD700, Turner Design, Sunnyvale, CA, USA) equipped with excitation (436 nm) and emission (680 nm) filters, and a daylight white lamp. The fluorescence intensities were plotted against actual densities of Symbiodinium cells to obtain standard relationships between fluorescence intensity and Symbiodinium cell density. The standard curves were linear in the following range: 1 x 104 to 1 x 106 cells mL−1, which was used in the following experiment. Growth rate of Symbiodinium cells at different temperatures To compare the physiological responses of the five strains of Symbiodinium, we measured the growth rates of cultured cells of each strain at temperatures of 25 °C, 30 °C, and 33 °C and the photochemical efficiency (Fv/Fm) of the algal cells after 21 days of temperature treatment. For each strain, we prepared 12 borosilicate glass tubes (10 mL, Fisherbrand, Pittsburgh, PA, USA) filled with 6 mL of f/2 medium containing Symbiodinium cells at an initial density of 5 x 104 cells mL−1. The 12 tubes were separated into three temperaturetreatment groups, which were incubated at 25 °C, 30 °C or 33 °C in separate incubators (LH-70CCFL-CT, NK System, Tokyo, Japan). The cultures were illuminated by fluorescent lamps (NK System LH-55/70CCFL-CT), which provided a photon irradiance of 22–49μmol photons m−2·s−1 (12 h light:12 h dark photoperiod). Each temperature treatment was replicated four-fold. The control tubes contained cell-free filtered seawater subjected to the same treatments. To avoid the effect of different light levels on the growth rate, we changed the position of tubes randomly, everyday during the experimental period. Measurement of the photochemical efficiency of Photosystem II (PSII) The photochemical efficiency of PSII (Fv/Fm) was determined at the end of the growth inhibition experiment (day 21). After vortexing, 3 ml of Symbiodinium cell suspension were removed from each tube using a syringe. The cells were collected on a Millipore filter (13-mm diameter, 0.45-μm pore size; Millipore, Cork, Ireland). Each filter bearing captured cells was sandwiched between two glass slides held in place with transparent adhesive tape. Cells mounted in this manner were immersed in filtered seawater and darkadapted for 20 min in a custom-made acrylic black box at room temperature. We measured Fv/Fm using a Mini-PAM (pulse-amplitude modulated) fluorometer (Walz, Effeltrich, Germany) (measuring light 8, saturation pulse intensity 8, width 0.8; gain = 2) (Maxwell and Johnson, 2000). 288 | Asea Uninet Scientific and Plenary Meeting 2016 Number of motile cells The ratio of non- (coccoid) and motile cells were estimated at the end of 21 incubation days. The cell suspensions were measured by changes in in Vivo fluorescence, considered as the number of motile cells. The suspensions were subsequently transferred into sterile tube. Due to strong attachment of non-motile cells at the side and bottom of culture tube, it was counted by rubbing the surface of culture tube. Then the tube was filled with f/2 and followed by estimation of the cell densities. Statistical analysis Mean growth rates (µ) and mean Fv/Fm values of Symbiodinium cells were compared among treatments using Analysis of Variance (ANOVA) and Tukey’s honestly significant difference (HSD) test when the data met requirements of inferential parametric tests. Normality and homogeneity of variances were tested using Kolmogorov-Smirnov & Lilliefors and Levene’s tests, respectively. The data were square root and arcsine transformed when necessary. When transformed data did not meet requirements of parametric testing, the non-parametric Kruskal-Wallis ANOVA followed by multiple comparisons tests was applied. All statistical analyses were performed using Statistica 6.0 software (StatSoft Inc., Tulsa, OK, USA). 3. RESULTS Growth and photosynthetic activity of Symbiodinium cells at different temperatures The growth curves differed among strains and among treated temperature (Fig. 1). The growth curves at 25 and 30C similarly formed positive growth for each of the six Symbiodinium strains. Cell densities reduced in three strains (F-K102, D-K111, and CY103) one day after the inoculation. Afterward, growth developed linearly for 5–6 days in all cultures. The linear growth consequently, then followed by a stationary phase with a slower growth rate. The growth at high temperature (33C) was lower than those at 25 and 30C, except in strain F-K102, therefore defined as thermally tolerant strain, which had exhibited similar curves at all temperatures (Fig. 1). Strains D-K111 and C-Y103 moderately grew at high temperature, while strains B-K100 and A-Y106 grew negatively after 6–8 days. Mean growth rates (µ) at high temperature were significantly decreased in all Symbiodinium strains except F-K102 (Fig. 2.A; one-way ANOVA; P <0.05). Mean growth rates ceased when incubated at 33C in strains B-K100 and A-Y106, hence defined as thermally sensitive strain. Strain D-K111 demonstrated a significant slower of growth rate at 33C than at 25 or 30C, however this strain tended to adhere to the tube walls, making the cell density data unreliable. Photochemical efficiency of PSII of Symbiodinium cells Photochemical efficiencies of PSII (Fv/Fm) in were significantly lesser at 33C than at 25C in strains F-K102 and D-K111 (Fig. 2.B; one-way ANOVA; P <0.05). Nonetheless, strain C-Y103 comparably stable of Fv/Fm values than those at 25C. Despite significant effect of high temperature (Fig. 2.B; one-way ANOVA; P <0.05), strains F-K102 and D-K111 were likely able to maintain Fv/Fm at high level (0.4–0.6) at 33C. The steeply declining of cell Asea Uninet Scientific and Plenary Meeting 2016 | 289 density at high temperature in strains B-K100 and A-Y106 resulted no data for Fv/Fm in both strains. Motility of Symbiodinium cells The number of non-motile cells were higher up to 60% than motile ones at 25 and 30C in strains B-K100 and A-Y106 (Fig. 3). Strain C-Y103 had no differences between motile and non-motile cells at control temperature. However, the number of motile cells rapidly declined as increased temperature which reached ±20% of total cells. Both non- and motile cells decreased at high temperature in C-Y103, but the motile cells were lower than the non motile cells. The highest number of motile cells were observed in strains F-K102 and DK111 at all temperatures that reached more than 50% . 4. DISCUSSION High temperature had significant different impact among Symbiodinium phylotypes. The relatively stable of F-K102`s growth at elevated temperatures indicated the tolerant capacity of it`s photosynthetic apparatus under high temperature. Our suggestion was supported by nonsignificant different of photochemical efficiency (Fv/Fm)`s values at all temperatures. Studies have reported that thermal stress changed the composition of thylakoid membrane (Tchernov et al. 2004) or suppressed the re-synthesis of D1 protein (Takahashi et al. 2010). In contrast, the severely dropped growths and photochemical efficiencies at high temperature in strains B-K100 and A-Y106 revealed the detrimental effect of heat stress to photosynthesis performance of Symbiodinium. The uncoupled between growth and photochemical efficiency (Fv/Fm) in C-Y103, in which Fv/Fm was relatively high at low growth rate at high temperate, might imply the variation of thermal stress avoid strategy in Symbiodinium. We suggested that this Symbiodinium redistribute the energy, instead of growing it allocates to fix the damaged photosynthesis machineries such as PSII through re-synthesis D1 and other thylakoid proteins at high temperature as proposed by Robison and Warner (2006) and Krämer et al. (2012). In addition, the uncoupled between growth and Fv/Fm apparently indicated thermal stress may impact some photosynthetic pathways other than PSII as previously reported. Since the motility represents the growth phase of Symbiodinium, therefore the high number of motile cells of strains F-K102 at high temperature exhibited the strong tolerance against thermal stress. Whereas, other strains (B-K100, C-Y103 and A-Y106) had lower percentage of motile cells as increased temperatures. We suggested that high temperature impaired the photosynthesis pathway, in turn it may eliminate the energy production for motility. The low number of motile cells is likely indicated the depressed growth at high temperature. Our result corresponds to the study by McBride et al. (2009). The inability of thermal sensitive Symbiodinium strains to grow and motile under warming sea temperature episodes may restrict the distribution of coral host and eventually collapse the ecosystems. The survivorship of both thermally and tolerant Symbiodinium strains is essential since they have a vital role to support the coral host. The high diversity in coral reef ecosystem greatly contribute to the more than 100 million people and other marine communities who depend their lives in this ecosystem. REFERENCES Baird, A.H., Bhagooli, R., Ralph, P.J., & Takahashi, S. (2009). Coral bleaching: the role of the host. Trends Ecology Evolution, 24: 16-20. 290 | Asea Uninet Scientific and Plenary Meeting 2016 Bhagooli, R. & Hidaka, M. (2003). Comparison of stress susceptibility of in hospite and isolated zooxanthellae among five coral species. Journal of Experimental Marine Biology and Ecology, 291: 181-197. Domotor, S.L. & D`Elia, C.F. 1986. Cell-size distributions of zooxanthellae maintained in laboratory culture. The Biological Bulletin, 170: 519-525. Falkowski, P.G., Dubinsky, Z., Muscatine, L., & Porter, J.W. (1984). Light and the bioenergetics of a symbiotic coral. Bioscience, 34: 705-709. Fitt, W.K., Brown, B.E., Warner, M.E., & Dunne, R.P. (2001) Coral bleaching: interpretation of thermal tolerance limits and thermal thresholds in tropical corals. Coral Reefs, 20: 51-65. Frade, P.R., Englebert, N., Faria, J., Visser, P.M., & Bak, R.P.M. (2008). Distribution and photobiology of Symbiodinium types in different light environments for three colour morphs of the coral Madracis pharensis: is there more to it than total irradiance?. Coral Reefs, 27(4): 913-925. Goulet, T.L., Cook, C.B., & Goulet, D. (2005). Effect of short‐term exposure to elevated temperatures and light levels on photosynthesis of different host‐ symbiont combinations in the Aiptasia pallida/Symbiodinium symbiosis. Limnology and Oceanography, 50(5): 1490-1498. Hennige, S.J., McGinley, M.P., Grottoli, A.G., & Warner, M.E. (2011) Photoinhibition of Symbiodinium spp. within the reef corals Montastraea faveolata and Porites astreoides: implications for coral bleaching. Marine Biology, 158: 2515-2526. Hill, R., Larkum, A.W.D., Prášil, O., Kramer, D.M., Szabó, M., Kumar, V., & Ralph, P. J. (2012). Light-induced dissociation of antenna complexes in the symbionts of scleractinian corals correlates with sensitivity to coral bleaching. Coral Reefs, 31(4): 963-975. Hill, R., Ulstrup, K.E., & Ralph, P.J. (2009). Temperature induced changes in thylakoid membrane thermostability of cultured, freshly isolated, and expelled zooxanthellae from scleractinian corals. Bulletin of Marine Science, 85: 223-244. Iglesias-Prieto, R., & Trench, R.K. (1997). Acclimation and adaptation to irradiance in symbiotic dinoflagellates. II. Response of chlorophyll–protein complexes to different photon-flux densities. Marine Biology, 130(1): 23-33. Karim, W., Nakaema, S., & Hidaka, M. (2015). Temperature ffects on the growth rates and photosynthetic activities of Symbiodinium cells. Journal of Marine Science and Engineering, 3(2): 368-381. Krämer, W.E., Caamaño-Ricken, I., Richter, C., & Bischof, K. (2012). Dynamic regulation of photoprotection determines thermal tolerance of two phylotypes of Symbiodinium clade A at two photon fluence rates. Photochemical Photobiology, 88: 398-413. Lesser, M.P. (2011). Coral bleaching: causes and mechanisms. In Coral reefs: an ecosystem in transition, Eds.; Springer: Netherlands; pp. 405-419. Mcbride, B.B., Muller‐Parker, G., & Jakobsen, H.H. (2009). Low thermal limit of growth rate of Symbiodinium californium (Dinophyta) in culture may restrict the symbiont to southern populations of its host anemones (Anthopleura spp.; Anthozoa, Cnidaria). Journal of Phycology, 45: 855-863. Maxwell, K. & Johnson, G.N. (2000). Chlorophyll fluorescence_a practical guide. Journal of Experimental Botany, 51: 659-668. Muscatine, L., & Porter, J.W. (1977). Reef corals: mutualistic symbioses adapted to nutrient-poor environments. Bioscience, 27: 454-460. Asea Uninet Scientific and Plenary Meeting 2016 | 291 Pochon, X. & Gates, R.D. (2010). A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai’i. Molecular Phylogenetic and Evolution, 56: 492-497. Ragni, M., Airs, R.L., Hennige, S.J., Suggett, D.J., Warner, M.E., & Geider, R.J. (2010). PSII photoinhibition and photorepair in Symbiodinium (Pyrrhophyta) differs between thermally tolerant and sensitive phylotypes. Marine Ecology Progress Series, 406: 57-70. Richmond, R.H. & Hunter, C.L. (1990). Reproduction and recruitment of corals – Comparisons among the Carribean, the tropical Pasific, and the Red Sea. Marine Ecology Progress Series, 60: 185-203. Robison, J.D. & Warner, M.E. (2006). Differential impacts of photoacclimation and thermal stress on the photobiology of four different phylotypes of Symbiodinium (Pyrrhophyta). Journal of Phycology, 42: 568-579. Takahashi, S., Milward, S.E., Yamori, W., Evans, J.R., Hillier, W. & Badger, M.R. (2010). The solar action spectrum of photosystem II damage. Plant Physiology, 153: 988– 993. Takahashi, S., Whitney, S.M., & Badger, M.R. (2009). Different thermal sensitivity of the repair of photodamaged photosynthetic machinery in cultured Symbiodinium species. Proceedings of The National Academy of Sciences of The United States of America, 106: 3237–3242. Takahashi, S., Nakamura, T., Sakamizu, M., van Woesik, R., & Yamasaki, H. (2004). Repair machinery of symbiotic photosynthesis as the primary target of heat stress for reef-building corals. Plant Cell and Physiology, 45: 251–255. Roth, M.S. (2014). The engine of the reef: photobiology of the coral–algal symbiosis. Front Microbiology, 5: 422. Trench, R.K. (1979). The cell biology of plant-animal symbiosis. Annual Review of Plant Physiology, 30: 485- 531. Tchernov, D., Gorbunov, M.Y., de Vargas, C., Yadav, S.N., Milligan, A.J., Häggblom, M. & Falkowski, P.G. 2004. Membrane lipids of symbiotic algae are diagnostic of sensitivity to thermal bleaching in corals. Proceedings of the National Academy of Sciences of the United States of America, 101: 13531-13535. Ulstrup, K.E. & van Oppen, M. (2003). Geographic and habitat partitioning of genetically distinct zooxanthellae (Symbiodinium) in Acropora corals on the Great Barrier Reef. Molecular Ecology, 12: 3477–3484. Warner, M. E., & Berry-Lowe, S. (2006). Differential xanthophyll cycling and photochemical activity in symbiotic dinoflagellates in multiple locations of three species of Caribbean coral. Journal of experimental marine biology and ecology, 339(1): 86-95. Warner, M.E., Fitt, W.K., & Schmidt, G.W. (1999). Damage to photosystem II in symbiotic dinoflagellates: a determinant of coral bleaching. Proceedings of The National Academy of Sciences of The United State of America, 96: 8007–8012. Weis, V.M. (2008). Cellular mechanisms of Cnidarian bleaching: stress causes the collapse of symbiosis. Journal of Experimental Biology, 211: 3059-3066. 292 | Asea Uninet Scientific and Plenary Meeting 2016 8.0 B-K100 D-K111 6.0 F-K102 4.0 25 °… 2.0 0.0 0 2 4 6 8 10121416182022 -1 Log (cells ml ) 0 2 4 6 810121416182022 7.0 A-Y106 C-Y103 6.0 5.0 4.0 3.0 2.0 1.0 0 2 4 6 8 10 12 14 16 18 20 22 0.0 0 2 4 6 8 10 12 14 16 18 20 22 Incubation time (d) Fig. 1. Growth curves of five strains of Symbiodinium at different temperatures. Changes in mean cell density (n = 4 for each strain) are plotted over a 21-day period. Asea Uninet Scientific and Plenary Meeting 2016 A. 2.1 1.7 APPENDIX * Growth rate and incubated for 21 days * 1.3 * * * | 293 25°C 30°C 33°C * 0.8 0.4 0.0 K100 K102 K111 Y103 Y106 -0.8 * * 0.7 B. 0.6 * 0.5 * * * * 0.4 * 0.3 Fv/Fm Growth rate (µ) -0.4 0.2 0.1 0 B-K100 F-K102 D-K111 C-Y103 A-Y106 Symbiodinium spp. Fig. 2. Growth rate and photochemical efficiencies (Fv/Fm) of five strains of Symbiodinium cells. A. Growth rates (μ) of cells cultured at different temperatures. B. Fv/Fm measured after 21 days of temperature treatment. *, significant differences between treatments (oneway ANOVA followed by Tukey’s HSD tests, p < 0.05 for all strains. Values are means ± SD (n = 4). 294 | Asea Uninet Scientific and Plenary Meeting 2016 2.4E+06 Cell density of motile and non-motile cells (cell ml ) -1 B-K100 2.0E+06 F-K102 D-K111 Non- 1.6E+06 1.2E+06 8.0E+05 4.0E+05 0.0E+00 25°C 30°C 33°C A-Y106 C-Y103 76 25°C 30°C 33°C 25°C 30°C 33°C Temperature (°C) Fig. 3. The number of motile and non-motile cells. Symbiodinium cells were measured after 21-days incubation at different temperatures (n = 4 for each strain). THE ENSO SIGNAL ANALYSIS OF INDONESIAN SEAS BASED ON EIGHTEEN YEAR SATELLITE REMOTE SENSING DATASET I Dewa Nyoman Nurweda Putra nurweda14@unud.ac.id* Faculty of Marine Science and Fisheries, Udayana University, Campus Bukit Jimbaran, Badung 80361, Bali, Indonesia. Center for Remote Sensing and Ocean Science (CReSOS), Udayana University, PB Sudirman Street, Denpasar 80232, Bali, Indonesia. Tasuku Tanaka tttanaka@yamaguchi.ac.jp Graduate School of Science and Engineering, University of Yamaguchi, 755-8611 Yamaguchi Ken, Ube Shi, Tokiwadai 2-16-1, Japan. Center for Remote Sensing and Ocean Science (CReSOS), Udayana University, PB Sudirman Street, Denpasar 80232, Bali, Indonesia. Presented at the ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract The characteristics of Sea Surface Temperature (SST) in the Indonesian Seas have been studied based upon data analysis of satellite observed dataset for the 18 years period from December 1997 – December 2015. The long term averaged, climatological and anomalous dataset were produced in order to recognize the possible connections of the coupled ocean–atmosphere phenomenon in the Pacific Oceans, El Nino-Southern Oscillation (ENSO), on SST of the Indonesian Seas. The analysis shows that, during the El Nino 2015, SST characteristics in the Inner Indonesian Seas have no significant different in term of temperature condition with the area of the Central Pacific Ocean (Nino 3.4). On the El Nino event, the SST of Nino 3.4 area tend to be warmer than normal condition, but the Inner Indonesian Seas show condition with no significant anomaly of SST. Theoretically, because of the warm SST in the warm pool area shift to the central Pacific Ocean, the SST surrounding Indonesian Seas should be cooler than normal condition. Based on these results, it is important to note that the SST of Indonesian Seas has no clear response to the ENSO signal. Keywords: Sea Surface Temperature (SST), Indonesian Seas, ENSO, Normal condition, Satellite observed dataset. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 295 296 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION The availability of eighteen years of the spatio-temporal satellite remote sensing dataset gives us a new challenge for the comprehensive study of possible connections of the El Nino-Southern Oscillation (ENSO) on Sea Surface Temperature (SST) of the Indonesian Seas. The ENSO event is well known as a coupled ocean–atmosphere phenomenon in the Pacific Oceans (Trenberth et al, 1998; Diaz et al, 2001). This phenomenon is recognized as an unusual condition of SST in the Central Pacific Ocean, Nino 3.4 area (NOAA, 2003). In addition, on the anomalous condition, the warmest SST area (warm-pool) near the Indonesian Seas tend to be shift into another areas of Pacific Ocean. These shifting processes become an important factor on the global change of climate surrounding the Indonesian Seas. In order to get the complete understanding of SST condition in the Indonesian Seas during the El Nino 2015, the characteristics of SST have been studied based upon data analysis of multi sensor satellite observed datasets for the 18 years period from December 1997 – August 2015. The present study is aimed at analyzing the spatial averages of the monthly satellite images to produce the long term averaged, climatological and anomalous dataset surrounding the Indonesian Seas. These dataset were used as a preliminary observation of the normal condition and possible connection of ENSO signal in the Indonesian Seas. 2 MATERIALS AND METHODS / EXPERIMENTAL An advantage of 18-year periods (December 1997 – December 2015) of microwave measurements on the Tropical Rainfall Measuring Mission (TRMM) Microwave Imager (TMI) satellite (Wentz et al, 2015) and the Advance Microwave Scanning Radiometer (AMSR-2) Sensor (Wentz et al, 2014) were used to reveal the characteristics of monthly SST. These level 3 products of dataset were compiled by the Remote Sensing Systems (http://www.remss.com), which has horizontal resolution of 0.25˚ × 0.25˚ and physical dimension of [deg. Celsius]. Figure 1. The research location and bottom topography map (scale in meter) of the Indonesian Seas derived from ETOPO 2 minutes (Smith and Sandwell, 1997). To determine the SST characteristics, a number of 217 monthly images dataset for all grid points were analysed (Figure 1). The long term averaged and climatological for all of monthly SST were calculated from the baseline data (Yi). The anomalous analysis of SST Asea Uninet Scientific and Plenary Meeting 2016 | 297 are then obtained by subtracting the climatological signal from the monthly dataset. The long term averaged (Xi), climatological (Ci) and anomalous (Ai) dataset for each pixel in the images are calculated by applying the equations (1), (2) and (3), respectively. 3 3.1 RESULTS AND DISCUSSION The Normal Condition In this research, as shown in Figures 2, we calculated the long term averaged of SST in the Indonesian Seas based on eq. (1). This figure indicates the 18 years averaged of monthly SST dataset. It is clearly depicted the warm pool pattern in the equatorial area. This condition is related to the westerly wind that derives the warm SST to the Western part of Pacific Ocean. On the other hand, the cooler SST exist on the Eastern part of Pacific Ocean. Based on these analysis, we can clearly understand the normal condition of Indonesian Seas. Figure 2. Long Term Averaged of SST 298 | Asea Uninet Scientific and Plenary Meeting 2016 3.2 The Climatological and Anomalous Conditions The Climatological dataset of Indonesian Seas, as shown in the left panel of Figures 3, 4, 5 and 6, were calculated by applying eq. (2). The figures of climatological dataset indicate the monthly normal condition of the Indonesian Seas. These dataset are used as a reference on the analysis of El Nino signal during the year of 2015. Based on the comparison of climatological and monthly dataset (Figures 3, 4, 5 and 6), the possible connections of SST with the ENSO phenomenon can be clearly recognized in the Equatorial area. Starting from February 2015 (Figures 3c and 3f) until March 2015 (Figures 4a and 4d), it is easily to recognize that warm pool area tend to be shift into the Central part of Pacific Ocean and the Western part of Pacific Ocean becomes cooler than normal condition. On the other hand, at the same time, SST condition also increased in the Inner Indonesian Seas. Theoretically, because of the warm SST in the warm pool area shift to the central Pacific Ocean, the SST surrounding Indonesian Seas should be cooler than normal condition. Unfortunately, the warm SST comes from the Indian Ocean and it’s moved to the Western part of Pacific Ocean. As the result, SST of the Inner Indonesian Seas have no clear response to the ENSO signal. The anomalous dataset analysis (Figures 7) shows the spatial deviation of SST from normal condition. It is clearly shown that SST has significant anomaly during El Nino 2015. The El Nino Signal can be detected as a positive anomaly of SST on the Pacific Ocean (Figures 7f, 7g, 7h, 7i, 7j, 7k, 7l). The Inner Indonesian Seas only shows negative anomaly on September 2015 (Figure 7j) and October 2015 (Figure 7k). This condition related to the supply of warm water from Indian Ocean that prevent the anomaly of SST become negative in the Indonesian Seas throughout the year. (a) December (d) December 2014 (b) January (e) January 2015 (c) February (f) February 2015 Figure 3. The December-January-February (DJF) Comparison between Climatological (left panel) and Monthly (right panel) SST dataset Asea Uninet Scientific and Plenary Meeting 2016 (a) March (d) March 2015 (b) April (e) April 2015 (c) May (f) May 2015 | 299 Figure 4. The March-April-May (MAM) Comparison between Climatological (left panel) and Monthly (right panel) SST dataset (a) June (d) June 2015 (b) July (e) July 2015 (c) August (f) August 2015 300 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 5. The June-July-August (JJA) Comparison between Climatological (left panel) and Monthly (right panel) SST dataset (a) September (d) September 2015 (b) October (e) October 2015 (c) November (f) November 2015 Figure 6. The September-October-November (SON) Comparison between Climatological (left panel) and Monthly (right panel) SST dataset (a) December 2014 (a) (b) January 2015 (b) Asea Uninet Scientific and Plenary Meeting 2016 (c) February 2015 (d) March 2015 (e) April 2015 (f) May 2015 (g) June 2015 (h) July 2015 (i) August 2015 (j) September 2015 (k) October 2015 (l) November 2015 Figure 7. The anomalous SST dataset during El Nino 2015. | 301 302 | Asea Uninet Scientific and Plenary Meeting 2016 4 CONCLUSIONS Based on the results of the 18 years spatio-temporal analyses of satellite remote sensing dataset, it can be concluded that: 1) 2) 3) 4) 5) The normal and anomalous analyses can be used to recognize the possible connections of SST with the ENSO phenomenon in the Indonesian Seas. The SST characteristics in the Inner Indonesian Seas have no significant different in term of temperature condition with the area of the Central Pacific Ocean (Nino 3.4) during the El Nino 2015. The SST condition of Nino 3.4 area tends to be warmer than normal condition on the El Nino event of 2015. The anomalous maps indicate that SST of the Inner Indonesian Seas have no significant anomaly on the El Nino event of 2015. It is important to note that the SST of Indonesian Seas have no clear response to the ENSO signal of 2015. ACKNOWLEDGEMENTS We appreciate the support of Udayana University, CReSOS and JAXA to our research. We express our sincere gratitude to these organizations. We also thank the Remote Sensing Systems for TRMM-TMI and AMSR-2 dataset. We appreciate the enthusiastic support of Dr. Takahiro Osawa who helped us make our data scientifically sound. REFERENCES Diaz, H. F., M. P. Hoerling and J. K. Eischeid, 2001, ENSO variability, teleconnections and climate change, Int. J. Climatol., (21), 1845-1862. NOAA, 2003, NOAA gets U.S. consensus for el nino/la nina index, definitions, Available online at www.noaanews.noaa.gov/stories/s2095.htm (accessed 1st June 2012). Smith, W.H.F. and Sandwell, D.T., 1997, Global seafloor topography from satellite altimetry and ship depth soundings, Science, (277), 1957-1962. Trenberth, K. E., G. W. Branstator, D. Karoly, A. Kumar, N.-C. Lau and C. Ropelewski, 1998, Progress during TOGA in understanding and modeling global teleconnections associated with tropical sea surface temperatures, J. Geophys. Res., 103(C7), 14291-14324, 10.1029/97JC01444. Wentz, F.J., T.Meissner, C. Gentemann, K.A. Hilburn, J. Scoot, 2014, Remote Sensing Systems GCOM-W1 AMSR2 Monthly Environmental Suite on 0.25 deg grid, Version 7.2, Remote Sensing Systems, Santa Rosa, CA., Available online at www.remss.com/missions/amsre (accessed 29th September 2015). Wentz, F.J., T.Meissner, C. Gentemann, K.A. Hilburn, 2015, Remote Sensing Systems TRMM TMI Monthly Environmental Suite on 0.25 deg grid, Version 7.1, Remote Sensing Systems, Santa Rosa, CA., Available online at www.remss.com/missions/tmi (accessed 25th September 2015). HUMANITIES, CULTURE AND MUSIC Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 303 CLIMATE ADAPTATION AND MITIGATION OF MAJAPAHIT’S HOUSING 13TH – 16TH CENTURY IN EAST JAVA Yosafat Winarto* yoshwinarto@gmail.com Doctoral Student, Department of Architecture, Institut Teknologi Sepuluh Nopember (ITS), Indonesia Happy Ratna Santosa Sri Nastiti Nugrahani Ekasiwi Department of Architecture, Institut Teknologi Sepuluh Nopember (ITS), Indonesia Abstract Majapahit was the largest empire in Nusantara at the 13th until 16th century. Territory of Nusantara in the Majapahit era covered whole of the Indonesia country, and parts of south east Asia. Majapahit culture was the forerunner of a long period of Javanese and Balinese culture now. As a nation with a great civilization in the past, cultural and community life of Majapahit harmony with nature and their environment. Majapahit region located in the tropics-humid climate environment, which is the most difficult climate to anticipate, where there are extreme environments with high solar radiation, high rainfall and humidity. In the fields of architecture, Majapahit housing is very interesting to explore the indigenous culture in anticipation of climate as between man and architecture can be in harmony with nature and the environment, and it can sustain for hundreds of years in the form of traditional Balinese architecture today. This study aims to dig deeper and developed theories about the architecture local wisdom community of Majapahit in adapting and mitigate to the climate in the housing and the environment. Research using mixed quantitative – qualitative methods by Neuman (2006). The main data is the site Segaran settlements in the former capital of Majapahit. The main data matched with the secondary data, in the form of many temple reliefs in Majapahit era, Majapahit artifacts and all sources of Majapahit manuscripts. The main data and the secondary data were analyzed by descriptive (descriptive research) and interpreted (historical - intrepretive research). The aims of the research is to findings the housing of Majapahit form that adaptive to climate and mitigated to climate change. The results from this study are expected to explain the local genius of Majapahit culture adaptation to the local climate at urban housing of Majapahit in Trowulan. Keywords : local genius of Majapahit, climate adaptation, climate adaptive architecture, Majapahit’s housing Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 304 Asea Uninet Scientific and Plenary Meeting 2016 1 | 305 INTRODUCTION Climate change is an important issue today. Air temperature increase, rainfall patterns changes, melting of polar glaciers and raise the average global sea level. These changes will continue and estimated the world will have more frequent extreme weather events. Floods and droughts will become more frequent and intense. Scientific debate was currently focused on the need to formulate effective policies for adaptation and mitigation of climate change (Pinto, 2014). In the context of culture, local architecture able to respond to local climate in a way that is most appropriate (Manriquez et al, 2006). Climate adaptation and mitigation in architecture associated with the local culture gave rise to much curiosity. In the area around the equatorial line was a region of tropics-humid climate. This region will be much impacted by global climate change. The main fundamental climate problems in this region was high solar radiation, high rainfall and high humidity (Lippsmeier, 1997). In architecture, to achieve room thermal comfort, tropics-humid was the most difficult climate to anticipate (Szokolay, 2001). This study aims to explore the cultural roots of the past Javanese architecture in harmony with nature and the climate. Java was a region with a great civilization and culture in the past and lies in the tropics-humid climate. The research focuses on Majapahit was the largest kingdom in Java (currently included in the territory Republic of Indonesia) at the age of 13th to the 16th century. Majapahit Kingdom was considered to represent an important cultural Java architecture that was able to adapted and mitigated against tropicshumid climate at that time. This statement proved by continuity and sustainability of majapahit architecture for centuries and its influence remain stable until today in the form of Balinese traditional architecture (Munandar, 2011). Remnants of the Majapahit empire current condition was not very good so it is important to be researched before evidence of the important history of civilization getting damaged or even lost. This research covered the housing on the former capital of Majapahit, in Trowulan, East Java. Architectural adaptation to climate implies architectural culture adjustment to the local climate. While the architectural mitigation to climate in terms of efforts to reduce the impact of disasters caused by climate. Adjustments and these efforts through a process of trial and error in a very long period of time. The result of a long process of architectural culture that is responsive and can be adapting to tropics-humid climate. This is expected to provide important knowledge for the historical of the Javanese architecture of the past. From the history and culture of the past, we can learn how Majapahit traditional societies in Java in a sensible and wise to live in harmony with nature. 2 RESEARCH THEORY AND METHODS Majapahit was founded in 1293 by Prince Raden Wijaya or Harsawijaya (Pararaton version), or Dyah Wijaya (NāgaraKṛtāgama version) or Nararya Sanggramawijaya (inscriptions Kudadu-1294M version). He was the son of Mahesa Campaka, a prince of royal Singasari (Adji, 2013). For about 234 years of existence, Majapahit has been ruled by the 12 leaderships of the kingdom, which consists of ten Kings and two Queens. From some historical sources it can be concluded that the setback to the collapse of Majapahit was due to several causes : Demak attack (Slametmulyana, 1968); famine in the 1426 (Adji, 2013); Natural disasters such as earthquakes and volcanic eruptions in the period of Queen Dyah Kertawijaya between 1447-1451 (Adji, 2013); Prolonged internal conflict. Prof. Dr. N.J. Krom argues that the collapse of Majapahit caused by the attack by other Hindu kingdom in Kediri, from Girindrawarddhana dynasty. This dynasty successfully invaded majapahit and then continuing the government until for some time. 306 | Asea Uninet Scientific and Plenary Meeting 2016 The main religion in the Majapahit era was Hindu Ciwa - Buddha. Hindu who worships Shiva and Mahayana Buddhist with patterned of Tantra is not merged into one, but coexist in parallel in a special relationship (Kieven, 2014). Islamic religion is also already in Majapahit (Djafar, 2012). The note from China traveler named Ma Huan and NāgaraKṛtāgama manuscript portray that Majapahit people in the era of King Hayam Wuruk very prosperous and advanced life (Munandar, 2011). The study of the Majapahit begins by finding a copy of the Majapahit manuscript in lontar leaf and found on Lombok at the colonial era in 1894 and was called NāgaraKṛtāgama by C.C. Berg (Riana, 2009). This manuscript depicts the Majapahit empire under the reign Rājasanagara (Hayam Wuruk) who ruled between 1350 - 1389. NāgaraKṛtāgama tells the kingdom of Majapahit, the royal family, the palace and many parts of the region (Zoetmulder, 1983). Pupuh VIII to XII says a lot about the city environment, castles and settlements. Findings of NāgaraKṛtāgama were followed Pont in 1924 to create a reconstruction map of Trowulan city as a capital of Majapahit kingdom. His research by the method of archaeological findings match with the NāgaraKṛtāgama manuscript. This research continued and completed by Oesman (1999) and Sasongko (2009) regarding the form of the Majapahit housing. Research methodology was developed from a mixed methods qualitativequantitative research by Neuman (2006) (see figure 1). Figure 1. Outline terms of the research process Research study divides the main work of research in two major jobs: quantitative research phase and qualitative research phase. Quantitative research phase include preparing work, standardize and codify the objects of research into practice research with clear rules. Quantitative phase also makes the standard procedure of research and research techniques are valid. Whereas qualitative research phase includes the process to build a practical logic to arrange the interpretation of the objects of research that has been through a phase of quantitative process. The results of these interpretations are expected to answer the research question. Secondary data research in the form of manuscripts NāgaraKṛtāgama, bas-reliefs, Majapahit artefacts and the results of previous studies. Secondary data matched with the primary data research that Segaran settlement site at the Asea Uninet Scientific and Plenary Meeting 2016 | 307 former capital of Majapahit, Trowulan. The interpretation of a form of Majapahit housing that can be inferred from these data was analyzed the extent to which Majapahit culture efforts and both adapted and mitigated intelligently to the tropics-humid climate in the main climate problem: high solar radiation, high rainfall and high humidity. 3 3.1 RESULTS AND DISCUSSION Housing Pattern and Orientation NāgaraKṛtāgama manuscript much describes the pattern of the structure and description of the Majapahit capital. Trowulan as the capital of Majapahit very regularly arranged in a pattern of rectangular blocks. Majapahit capital city is not a city within the walls but it is a large residential complex consisting of subgroups of small settlements. Settlement blocs are very neatly arranged in groups in accordance with the position or social class owners (see figure 2). Figure 2. Settlements Blocks Group on the Reconstruction Map of Trowulan by Pont (1924) Crossroads (catus patā) was an important part of the city pattern of Trowulan. NāgaraKṛtāgama manuscript tells the crossroads spacious and beautiful. The open spaces 308 | Asea Uninet Scientific and Plenary Meeting 2016 in the form of alun-alun, square, wide field, many referred in NāgaraKṛtāgama (Pupuh VIII until Pupuh IX). In the capital city of Majapahit groups of small settlements separated from each other by open fields and wide roads (Figure 2). The open field was used for the public interest, such as market and meeting places. Trowulan city pattern indicate walls as the main elements of the boundary fence of an house yard. Kori as the entrance was an important artifact as a territorial marker of house yard. The existence of vegetation and trees becomes an important part in the housing environment in Segaran settlement. Housing at Segaran settlement groups in the same orientation, the axis of the wind east - west and north - south on the north slope of the rotary axis 12° towards the Northeast. 3.2 The Housing Shape and Function Figure 3 shows a picture overview that was the results of the analysis by digital graphics coloring of Majapahit dwelling on one of reliefs at Minakjinggo temple, Trowulan, East Java. Figure 3. Picture show Majapahit house on the relief at MinakJinggo temple in 14th century Its show Majapahit house figure with a wall enclosed courtyard as the main concept of Majapahit houses. The mass composition inside the courtyard were varies. But in principal, Asea Uninet Scientific and Plenary Meeting 2016 | 309 there are two kinds of building mass typology, the open wall building were called bale, and the wall covered building called meten. Open wall building model shown in Figure 4 below. This is one of the artifacts found in the former capital city of Majapaht in Trowulan, show a pattern of open wall building (Bale) with four columns (sakepat). Archaeological evidence also suggests other open bale with six or eight columns (Figure 5). Source: Majapahit Museum, Trowulan, 2013 Figure 4. Majapahit artifact miniature : Bale Sakepat (four poles) Figure 5. Overview of the Apsari residence in relief of Jago temple in Tumpang, Malang. Wall covered building was a building with wall coverings, equal to the basic structure of the open wall building (bale). Consists of a batur as a basis, umpak as a foundation columns, the columns and roof. The realization of the building shown in evidence miniature artifacts found in Trowulan (Figure 6). Artifacts show variations in roof meterials and wall covering materials, but in the similar form. Meten form a wall covered building was also seen in the reliefs of temples of Majapahit era in East Java, as shown in Figure 7. There were several types of roofs on Majapahit houses (kuwu). The dominant mode of occurrence frequency is limasan (hipped roof) and tajug (pyramid hip roof). Although the type of gable roof (kampung) had been seen at Majapahit house miniature artifacts, but is not found in the depiction of the relief at the temple in Majapahit era. The same roof 310 | Asea Uninet Scientific and Plenary Meeting 2016 types found in traditional Balinese housing. Predicted the roof structure is still not much changed compared to Majapahit house (kuwu). There were split level patterns on the yard landscape in kuwu. The split level was made in the terracota brick structure. The split level structure include access and pedestrian path, batur, and other house equipments in a kuwu. Source: Majapahit Museum, Trowulan, 2013 Figure 6. Meten at Majapahit House Figure 7. Meten as a bedroom at Jago temple reliefs in Tumpang, Malang. 3.3 Elements, Ornaments and Materials Fence wall was the dominance view of the exterior of Majapahit housing façade. The concept of Majapahit house was the integration of nature - environment - human being in a yard (karang kuwu) as a little universe (jagad alit). This concept was similar in traditional Balinese house. Kori was the entrance gate from the universe world towards little universe in Majapahit house. Social strata house owners show from grandeur shape and size as well as ornaments in their Kori. The courtyard consists of access and pedestrian path, batur, and Asea Uninet Scientific and Plenary Meeting 2016 | 311 other house equipments. The buildings in the yard was being built and its existence in accordance with its function. The existence of batur was very dominant, it always appears in the reliefs of the Majapahit temple, as well as the real artifacts visible on the Majapahit settlement site of Segaran II, Segaran IV and Segaran V, in Trowulan. The batur structure were found to Majapahit house was made by terracota brick. Batur pattern was still visible on the traditional settlements in Bali. Just like in the Majapahit era, Batur is used as the base foundation of buildings in a traditional Balinese house. Umpak be a pedestal or base mounting column (saka). Its existence appeared in bas-reliefs, artifacts and Majapahit settlements sites. Some original form pedestals were still visible on the Segaran IV settlement site. Umpak still continue to be used in the next stage of traditional architecture in Bali and Java post-Majapahit until the present era. Building column (saka) was a body structure of the main building on the Majapahit building. Saka sit on pedestals that support the roof. Column (Saka) were often found on the depiction of relief at Majapahit temple and artifacts totaling four column (sakepat), six column (sakenem) or even more. Saka as a column structure of the building were sitting on pedestals still preserved as a traditional architectural structures in Bali and Java today. 3.4 Climate Adaptation & Mitigation The concept of Embodies the world universe in the coutyard of a Majapahit house (kuwu) was a Majapahit community effort to harmonize themselves with nature. Humans do not subdue the forces of nature, but humans synergize himself with nature – little world (bhuwana alit) in the yard of the Majapahit house (karang kuwu). Majapahit people's daily activities are relatively not be inside the building. Human activities within a small scope of the world, was in the yard. Interpretation of Majapahit house shown in Figure 8. The concept of Majapahit house was the embodiment little world (bhuwana alit) on a yard bordered by a fence. Inside the wall fence there was an open wall building (bale) and the wall covered building (meten). As the entrance to the coutyard was Kori (a). In the yard there were open wall buildings - bale (b), and the wall covered building was meten (c). In the middle of the yard there are ground (d) with the pavement as a variety of household activities. Majapahit society live and activities in a shade that avoid the sun and rain. The shade can be a building roof or canopy of trees in the yard of the house (figure 8). The sunlight was given entrance in the courtyard, shading only on the parts that need to be protected from the sun. Rainfall was not avoided, but controlled. Rainwater falls on the building and slope form of the roof drain the water falling into the courtyard. Rainwater in the yard run with open drainage, to eventually seep into the ground or drained out of the yard. In the Majapahit settlement at Segaran sites were found open drainage channels. Rainwater was channeled through drainage networks or to the environment which height under the yard. Air flow allowed to freely move between the masses of buildings and trees. Open bale shape can stream airflow more quickly and evenly to all residential yard. The physiological effects of mass composition and vegetation pattern can lower the temperature and humidity inside the yard. Open wall buildings and vegetation in the yard serves as forming the microclimate inside the house yard. Open wall building (bale) was dominated in relief temples at Java Hindu kingdom era in 12th – 16th century during Singasari-Majapahit kingdom as seen in Penataran temple, Jago temple, Minakjinggo temple, Surawana and Sukuh temple. Serves as a sitting room or a daily activity center. Open wall building without the presence of the wall. Bale was highly adaptive to climate, where the roof can withstand the heat radiation of the sun and 312 | Asea Uninet Scientific and Plenary Meeting 2016 rain, creating shading, but the air can freely move so as to create physiologically termal comfort conditions for a human underneath the building. Meten was a building with enclosed walls. The building serves as a bedroom or kitchen. Meten was an organic modular buildings covered with wood frame and woven bamboo or wooden planks walls. Meten will protect occupants from wind and rain splashes. Although the wall without existence of windows, but the air circulation and humidity maintained relatively stable at the condition with the outside air because the woven bamboo wall or wood planks wall has a gap that allows air can pass through in the wall (breathing wall). Asea Uninet Scientific and Plenary Meeting 2016 | 313 Figure 8. Interpretation of Majapahit houses varies in A and B models based of the Majapahit evidence Figure 9 (a) shows the overall form of reconstruction meten. The dimensions not too large, on the Segaran site measuring 5.2 meters x 2.15 meters. This proportion to adapts of high-dimensional body of the human inhabitants. Meten serves as a bedroom. The roof and the overhang eaves (b) and (c) with a certain slope to protect the building from solar radiation and precipitation. In the detail 9 (b) show terracotta tile pattern installation to anticipate leaks when it rains. Majapahit culture has both anticipated and mitigation against leakage and high water discharge flowing on the tile. The composition tile made from terracotta made intermittent. The flow of water through critical gap does not fall down, but flows in the middle of the panel precarious. The slope of the roof drain rainwater into the yard. Batur (d) was the base and foundation of the building. Floor elevation function the batur as a main hall of the building and also function for anticipation the puddle of rainwater or flooding. Tropics-humid climate in Java, high rainfall triggered flooding and overflowing rivers. Majapahit society and both adaptation and mitigation to the climate and natural conditions by raising the batur’s floor level making it safe from inundation and flooding in the rainy season. Also visible in the image (e) the existence of open drainage channels for rainwater right side of the Batur. On the building model of reconstruction Meten (a), the wall cavity between the wooden planks that allows the wall pores to breathe, the air stream sufficiently in order to protect the occupants of the low temperatures, strong 314 | Asea Uninet Scientific and Plenary Meeting 2016 winds and rainfall splash. The pore walls can also serve as ventilation that can lowers the relative humidity in the room so it is more convenient. source : author’s analysis from Majapahit’s house replica at Majapahit Museum, Trowulan. Figure 9. Bale Meten (part of Kuwu) reconstruction details Javanese architectural culture developed consider by local climate and the environment for centuries make Majapahit house able to adapting climate and mitigation to climate change. Majapahit architectural in synergy with nature and the environment makes the occupants of the house part of the nature. The concept of shading and cooling of buildings is done in a natural way and simple. Sunlight is controlled by shading by the roof and vegetation. Open masses building able to breathe and vegetation creates a microenvironment that can control the climate discomfort. Wind allowed to move freely into the yard and pass each part of the open spaces. The wind did not stop, but remain free to flow into the surrounding environment. The range of motion of air at ground level is able to reduce the temperature and humidity of the environment. Large water discharge, inundation and flooding can also be controlled because the yard with a small mass of providing additional rain catchment area. Concept of Majapahit housing can also be developed in the future into an ecology and friendly architecture that efficient in energy. The concept of space and mass were fit with the occupants making to be very efficient building, kind of material, the energy needed for building operations and maintenance. The concept of pluralistic masses creating a mass that can customize according to their needs and function space. Natural lighting and cooling can also be optimally planned. The concept was ultimately also able to reduce the massive exploitation of nature for building materials demands. Asea Uninet Scientific and Plenary Meeting 2016 4 | 315 CONCLUSION Adaptation and mitigation to climate have become part of the local architectural genius of Majapahit culture. This wisdom sublime into a knowledge of the local culture in response to the climate, based on ethical values, norms and acts are contextual to the local environment. Noble knowledge and local culture made traditions by Majapahit people in traditional housing through of long experience process and hereditary in a bond of mutual benefit to achieve ecological balance and sustainability. The concept of Majapahit housing align themselves with the environment in the local culture context, becoming an important knowledge that can be developed in the future in an effort to explore the wisdom of local architecture that is able to both adapt and mitigation to climate. Architecture was not against nature, but the architecture synergy itself with the natural. The architectural concept in synergy with the natural universe starting from the smallest universe. That was human residences. The concept puts the architecture as a critical science to preserve nature and the environment. REFERENCE Adji, K. B. (2013), Majapahit (Menguak Majapahit berdasarkan Fakta Sejarah), Araska, Yogyakarta. Djafar, H (2012), Masa Akhir Majapahit-Girindrawarddhana & Masalahnya, Komunitas Bambu, Depok Dwijendra, N.K.A. (2010), Arsitektur Rumah Tradisional Bali – Berdasarkan Asta Kosalakosali, Udayana University Press, Denpasar Kieven, L (2014), Menelusuri Figur Betopi dalam Relief Candi Zaman Majapahit : Pandangan Baru terhadap Fungsi Religius Candi-candi Periode Jawa Timur Abad ke-14 dan ke-15, Kepustakaan Populer Gramedia, Jakarta Lippsmeier, G (1994), Bangunan Tropis (terjemahan ), Erlangga, Jakarta Manriquez, R; et al (2006),”Traditional architecture and Bioclimatic Design Case of Study : Tecozautla, Hgo. Mexico, in Proceeding PLEA2006, Conference on Passive and Low Energy Architecture, Geneva, Switzerland. Marfai, M. A. (2012), Pengantar Etika Lingkungan dan Kearifan Lokal, Gajah Mada University Press, Yogyakarta Munandar, A. A. (2011), Catuspatha, Arkeologi Majapahit, Wedatama Widya Sastra, Jakarta Munandar, A. A. (2011), Proxemic Relief Candi-Candi Abad Ke-8-10, Wedatama Widya Sastra, Jakarta Munandar, Agus Aris (2013), Tak Ada Kanal di Majapahit, Wedatama Widya Sastra, Jakarta Nababan, A. (1995), “Kearifan Tradisional dan pelestarian Lingkungan di Indonesia”. Jurnal Analisis CSIS : kebudayaan , kearifan Tradisional dan Pelestarian Lingkungan. Tahun XXIV No.6 Tahun 1995 Neuman, W. L. (2006), Social Research Methods : Qualitative and Quantitative Approaches, Pearson, USA Oesman, O (1999), Rekonstruksi Bangunan Hunian Di Situs Kota Majapahit Trowulan Jawa Timur, Thesis S-2, Program Pascasarjana Universitas Indonesia, Jakarta. Olgyay, V (1994), Reka Bentuk Berdasarkan Iklim (terjemahan), Dewan Bahasa dan Pustaka Kementrian Pendidikan Malaysia, Kuala Lumpur Pigeaud, Th. G. (1960-1963), “Java in the Fourteenth Century: A Study in Cultural History. The Nagarakrtagama by Rakawi Prapanca of Majapahit, 1365 A.D”. dalam 316 | Asea Uninet Scientific and Plenary Meeting 2016 Martinus Nijhoff (ed), The Hague, 5 Vols. (Vol. I, 1960;Vol. II, 1960; Vol. III, 1960; Vol. IV, 1962; Vol. V, 1963) Pinto, F (2014), “Urban Planning and Climate Change, Adaptation and Mitigation Strategies”, in TeMA, Journal of Landuse, Mobility and Environment, Naples, Italia Prijoharijono, M. R. (1984), Bangunan Tempat Tinggal Pada Relief Candi-Candi Jaman Majapahit, Fakultas Sastra Universitas Indonesia, Jakarta. Rappoport, A. (1969), House, Form and Culture (Foundation of Cultural Geography Series), Englewood Cliffs, NJ Riana, I. K. (2009), Kakawin Desa Warnnana uthawi Nagara Krtagama-Masa Keemasan Majapahit, Buku Kompas, Jakarta. Sangkertadi (2013), Kenyamanan Termis di Ruang Luar Beriklim Tropis Lembab, Alfabeta, Bandung Santoso, M. (2001), “Harmoni di Lingkungan Tropis Lembab : Keberhasilan Bangunan Kolonial”, dalam Jurnal Dimensi Teknik Arsitektur, Vol. 29, No. 1, Juli 2001, FTSP UK Petra, Surabaya Sasongko, S. et al (2009), “Menelusuri Bentuk Bangunan rumah Tinggal penduduk pada jaman Kerajaan Majapahit (Dalam rangka Rekonstruksi Bangunan Situs Arkeologi untuk Kawasan Wisata Budaya Majapahit di Trowulan)”, Laporan Penelitian Tahun-1 Hibah Perguruan Tinggi, Fakultas Sastra dan Seni Rupa Universitas Sebelas Maret, Surakarta Sasongko, S. et al (2010), “Menelusuri Proporsi Bangunan rumah Tinggal penduduk pada jaman Kerajaan Majapahit (Dalam rangka Rekonstruksi Bangunan Situs Arkeologi untuk Kawasan Wisata Budaya Majapahit di Trowulan)”, Laporan Penelitian Tahun-2 Hibah Perguruan Tinggi, Fakultas Sastra dan Seni Rupa Universitas Sebelas Maret, Surakarta Slametmulyana, R.B (1968), Runtuhnja Keradjaan Hindu-Djawa dan Timbulnja Negaranegara Islam di Nusantara, Bhatara, Djakarta. (republished edition : Runtuhnya Kerajaan Hindu-Jawa dan Timbulnya Negara-negara Islam di Nusantara, (2005), LKiS, Yogyakarta] Stutterheim, W.F (1948),” de Kraton Majapahit”, VKI, VII s-Gravenhage : Martinus Nimhoff Szokolay, S.V (1981), “Thermal Mass for Climate Control”, The Queensland Master Builder, September 1981 Zoetmulder, P. J. (1983), Kalangwan, Sastra Jawa Kuno Selayang Pandang, Penerbit Djambatan, Jakarta SMALL-SCALE HOUSING DEVELOPMENTS AND THEIR IMPLICATIONS ON THE DEVELOPMENT OF URBAN INFRASTRUCTURE AND FACILITIES Ispurwono Soemarno isp4251@yahoo.com Purwanita Setijanti psetijanti@arch.its.ac.id Endy Yudho Prasetyo endy_yudho_prasetyo@yahoo.co.id Lecturer at Architecture Department, Institut Teknologi Sepuluh Nopember (ITS) Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract ‘Adequate shelter for all’ is one of the aims of the Millennium Development Goals. It should be achieved by 2015, while the sustainable urban settlements be reached by 2020. A safe housing and healthy environment will need the availability of infrastructure and the adequacy of public facilities and utilities. Based on the current Indonesia regulation, to achieve a healthy residential environment, the housing developers have to provide approximately 30% – 40% of his land for the infrastructure, facilities and public utilities. However, many small-scale housing developers built only a limited number of houses in one area. The greater number of small-scale housing developers, the more limited facilities and infrastructure available within the city. This situation will certainly affect the environmental conditions of the housing area as well as the city as a whole. This study attempts to find the above problems in the context of housing development. This is an evaluation of the current housing development to examine whether infrastructure and facilities which should have been provided by the developer were actually built and handed over to the local authorities. Interview to the related parties and field study used as the method. The obstacles encountered are recorded and categorized and then efforts to solve the problem are proposed. Initial observation suggests that, there are at least two types of problems which, based on the physical condition and administrative. Recommendations for problem resolution are organized by typology of problems found. Keywords: facilities and infrastructure provision, small-scale urban housing developer Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 317 318 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION To function properly, each residential neighborhood should be equipped with a variety of infrastructure, facilities and utilities (prasarana, sarana dan utilitas or PSU). The type of PSU and their quantity set by the government, and must be provided by the housing developers. By the time all the house was completed, the PSU must be submitted to the local government to be maintained further. Each city with rapid residential development, should prepare regulations regarding the provision and delivery of housing PSU, as the umbrella policy for all housing providers (government, private/developer and the community) so that any problems can be addressed with the same understanding. Indonesian Law No. 1 of 2011 on Housing and Settlement Area has outlined a definition of infrastructure, facilities and public utilities (PSU). Infrastructure is the physical basis of completeness in residential environments that meet certain standards for decent living needs, healthy, safe, and comfort that is at least composed of roads, drainage, sanitation and drinking water network. Facilities means a part of the neighborhood that serves to support the implementation and development of social life, culture and economy, in minimum basis should provide house of worship and green open space (ruang terbuka hijau or RTH). Meanwhile, public utilities are complete support for minimal servicing residential neighborhood consist of the electrical and telephone network. In general, total land area used for PSU is 30% - 40% of the total housing land area. This study intends to observe the real condition of the above rules implementation regarding PSU in Blitar, East Java. Blitar is a small town where the growth of the property sector is just starting, and is still on a small scale, with the area below 1 hectare. With an area less than 1 hectare the developers find it difficult to fulfill the obligation in providing land for the PSU which is about 30%-40% of the total land area of housing. Therefore, it can be found a lot of housing built with minimum PSU in Blitar. 2 THE CITY OF BLITAR AND THE HOUSING DEVELOPERS. Blitar is a municipality within East Java Province. It composed of three districts, namely: Sananwetan, Kepanjenkidul and Sukorejo. This is the capital city of Blitar Regency which lies between 112o, 14’ - 112o, 28’ East longitude and between 8o, 2’8o, 8’ South latitude. Administratively, Blitar is a municipality with land area of 32.58 km2. This municipality is divided into 3 districts and 21 villages. Based on data from the local statistic office, total population of Blitar city in 2013 is 146,602 inhabitants. The male and female population are 73,250 and 72,352 inhabitants respectively. The population growth rate in 2013 was 0.9%/year, while the population density was 4499.96 inhabitants/km2. The population density of Blitar is uneven. Sananwetan district has the largest population, but the highest population density is the Sukorejo district reaching 5008.97 inhabitants/km2. Asea Uninet Scientific and Plenary Meeting 2016 EAST JAVA PROVINCE | 319 BLITAR REGENCY BLITAR CITY Source: Blitar Development Plan for Housing and Settlement Area (RP4D Blitar), 2013 Figure 1: The city of Blitar location within East Java Province. The topography of Blitar city is a lowland area with an average altitude of 156 meters above sea level. The average altitude of northern part is about 245 meters with an inclination of 2˚ - 15˚, the center area has an average altitude of 185 meters with an inclination of 0˚ - 2˚, and the southern part has an average altitude of 140 meters with an inclination ranging from 0˚ - 2˚. The Masterplan (Rencana Tata Ruang Wilayah or RTRW) of Blitar city (2011 - 2030) has set the broad direction for residential land area of 1,078 hectares for high, medium and low density housing. This RTRW has also been mentioned residential area development plan in Blitar include: 1) the control of residential development areas, especially for areas that function as catchment areas; 320 | Asea Uninet Scientific and Plenary Meeting 2016 2) 3) 4) the arrangement of neighborhoods by improving the quality of environment infrastructure or rejuvenation of residential neighborhoods; the development of vertical housing in the form of low storey rental flat (rusunawa); and the requirement for housing developers to provide minimum facilities of the green environment and infrastructure. The physical expansion of Blitar city was originally developed linearly along the transportation path of the subregion between Blitar - Kediri, Blitar - Tulungagung and Blitar - Wlingi - Kepanjen - Malang. Along with those development paths, the city center has started to change massively into a regional center of trade/services, residential centers and the centers of other farming activities. From downtown, development progress continue towards North and South, and then to the East. Source: Blitar Development Plan for Housing and Settlement Area (RP4D Blitar), 2013 Figure 2: Land use development in Blitar Asea Uninet Scientific and Plenary Meeting 2016 3 | 321 THE PROBLEMS. The total population of the town of Blitar in 2013 based on data from the local statistical office is 146 602 people. The male population and female population 73 250 people 72 352 inhabitants. The population growth rate in 2013 was 0.9% / year, while the population density in 2013 was 4499.96 inhabitants / km2. Population density is uneven. Sananwetan sub-district has the largest population, but the highest population density is in the district Sukorejo reaching 5008.97 inhabitants / km2. Within one year (2012 - 2013) there is a growing population of 1,302 inhabitants in Blitar. This growth is relatively large compared with the area of Blitar which only 32 km². However, this population growth rate was lower than the growth in the previous year. The population growth rate in 2013 was only 0.9%, while in 2012 it was 1.45%. Tabel 1: The population of Blitar in 2013. Districts Population Sukorejo Kepanjenkidul Sananwetan Total in 2013 2012 2011 2010 2009 25,026 20,835 27,328 73,250 Men Households Women 24,686 21,119 27,556 73,352 Men + Women 49,712 41,945 54,945 146,602 145,300 143,218 140,574 139,471 17,459 13,058 17,995 48,512 Source: Blitar in figures, 2014 In addition to its population, the location of housing distribution is also distributed unevenly. The concentration of residential areas and population density in Blitar, are presented in the following table. Tabel 2: The population density of Blitar in 2013. No. Districts/Villages Population (person) Area (Ha) Population density (person/ha) A. Sukorejo District 49.712 992,46 50.09 1 Tlumpu 2 Karangsari 3 Turi 4 Blitar 5 Sukorejo 6 Pakunden 7 Tanjungsari B. Kepanjenkidul District 3.498 5.430 3.083 4.419 14.426 10.131 8.296 41.454 101.53 88.24 50.86 133.21 146.62 226.2 245.81 1050,23 34.45 6.15 60.62 33.17 98.39 44.79 33.75 39.47 1 2 3 4 8.190 5.803 6.127 5.374 86.7 61.33 68.03 151.85 94.46 94.62 90.06 35.39 Kepanjenkidul Kepanjenlor Kauman Bendo 322 | Asea Uninet Scientific and Plenary Meeting 2016 5 Tanggung 6 Sentul 7 Ngadirejo C. Sananwetan District 5.140 7.424 3.396 54.563 223 268.3 191.02 1215,16 23.05 27.67 17.78 44.90 1 2 3 4 5 6 7 Total 2.948 4.396 4.529 7.269 13.931 10.831 10.659 146.602 84.43 153.07 124.81 179.54 212.79 195.52 265 3257,85 34.92 28.72 36.29 40.49 65.47 55.40 40.22 45.00 Rembang Klampok Plosokerep Karangtengah Sananwetan Bendogerit Gedog Source: Blitar in figures, 2014 Population growth would increase the demand for housing. In addition, the limited land available for housing will ultimately increase the price of housing. Meanwhile, the decline in agricultural commodity prices, also causes urban agricultural land conversion into other activities that economically more profitable like housing development. However, the limited area of land for housing activity have resulted in the limited supply of housing PSU. Some problems in the provision and delivery of housing PSU in urban areas, among others are: 1) 2) 3) The development of formal housing in small towns is often uncontrolled and has no clear pattern, because the local authorities has not anticipate the implementation of the housing development regulation since the beginning. PSU in a residential area in a growing small town, especially lowincome housing or housing on a small scale are often not sufficiently available in accordance with Law No. 1 of 2011 on Housing and Settlement Area. The difficulty of implementing handover of PSU housing from developers to the local governments. This is due to the rights and obligations associated with the provision of housing development and delivery of PSU in the housing area has not been spelled out clearly in the regulation at the local level. 4 THE METHOD. This research was conducted with qualitative descriptive methods tailored to the facts on the field to generalize and define concepts. This study will explore the barriers faced by the housing developers in providing and handing over public infrastructure and facilities (PSU) of housing by taking samples of formal housing in Blitar. Data were collected through field surveys to obtain primary and secondary data related to the provision and delivery of PSU housing by developers as well as the relevant parties. These parties include: the housing developers, the City Asea Uninet Scientific and Plenary Meeting 2016 | 323 Development Planning Board, some related city/local government offices and the City Statistical Office. Aspects of the research that will be examined including physical aspects of PSU and non-physical aspects (such as the related institutions and PSU regulations). Information and data obtained from the above sources are then compared with each other and the fact from the field. 5 FINDINGS AND DISCUSSIONS Settlements in Blitar are generally divided into two categories, namely self-help housing (built independently by the citizens) and formal housing (held by the government or private developers). The tendency of the settlements’ development in Blitar is a combination of linear and grid pattern. Formal housing began to develop in Blitar within the last 5 years and growing evenly throughout the city. Housing data from the Blitar Office of Integrated Services (Kantor Pelayanan Terpadu/KPT) shows that there were 38 residential locations around Blitar registered in the period 2011 to 2014. 23 locations are only residential while the other 15 locations has shop-housing (ruko). All residential locations are still classified as smallscale housing as they are built on less than 1 hectare of land. Only one private housing and one rental low rise flat (rusunawa) built by the city government have over 1 hectare of land. Until 2013, the area of land that has been used as a residential area is 1308.48 Ha. Meanwhile, in Masterplan (RTRW) of Blitar 2011-2030, residential areas and settlements area were only planned of 1,078 Ha. Thus, the area of land settlements have exceeded the allotment of land in the layout, with 230.48 hectares irregularities. Based on the Minister of Home Affairs Regulation No. 9 of 2009, there are three main aspects that should be provided in residential areas so that it can function properly: infrastructures, public facility and utilities. Every aspects consists of several items as follows:    Infrastructures: road network, sewerage, drainage channels and solid waste landfills. Public utilities: commercial or trade, public services and government facilities, educational facilities, medical facilities, religious facilities, recreational and sports facilities, cemetery, landscaping and open spaces as well as parking facilities. Utilities: clean water, electricity, telephone networks, gas networks, transportation networks, fire and street lighting. In Blitar, to apply for a building permit, the following attachment are required:     Proof of land ownership/certificate or lease agreement if the land is leased from other party; Site plan. Statement of approval by neighboring housing development which witnessed by the (village) authority. Permit principles and planning advice. Planning Advice is published by the Department of Public Works and Housing. Out of 23 residential locations in Blitar, 15 residential locations were surveyed for this study. In the survey, the extent and nature of PSU elements that have been built 324 | Asea Uninet Scientific and Plenary Meeting 2016 in the field were compared to the related existing regulation. The following pictures show the results of the field survey of some housing development in Blitar, either are under construction or has already been occupied. Source: Field survey, 2015 Figure 3: Some site plan examples of housing development in Blitar with area that less than 1 hectare Cemara Green View Housing is located in Tlumpu village, Sukorejo district. This housing project which occupies an area of 15,947 m² is built by private individuals, not by developers or business entity. Housing units here is of small to medium-sized houses. Most are Type 45 with a 135 m² lot area. So far 15 housing units has been built when the survey took place. Not all PSU elements are available in this housing project. The main road paved with concrete paving blocks are equipped with a drainage channel of 30cm width and 50 cm depth and in relatively good condition. There has been a reforestation efforts by planting shade trees along the road environment. Trash-bin is available in front of each house. Electricity network has been available. The green open space (RTH) such as neighborhood parks, children's playgrounds and sports fields has not been built in this residential neighborhood. Asea Uninet Scientific and Plenary Meeting 2016 Source: Field survey, 2015 Figure 4: Cemara Green View Housing. | 325 326 | Asea Uninet Scientific and Plenary Meeting 2016 Source: Field survey, 2015 Figure 5: Ciliwung Green Family Housing. Ciliwung Green Family Housing located in Ciliwung road that connects the city of Blitar with natural tourist sites Mount Kelud and Penataran Temple. The housing occupancy rate has reached nearly 100%. This is small-scale housing type with an area of each house-unit is between 35 - 45 m². In this housing area, the neighborhood road use concrete paving block and equipped with drainage channel of 30cm width and of 50 cm depth. Neighborhood road here is only 3 – 3.5 m wide. Trash-bin is available in front of each house. The greeneries is very limited. This is indicated from the lack of trees planted along the road. The existence of facilities such as mosque and guard posts have been seen in this housing area. Other PSU element available is the electricity network which has reached into every housing unit. The third housing project surveyed, Tirtomadu Residence housing is built by private individuals, which is located in Karangtengah village, Sananwetan district. It is a medium-sized housing types, with 75 m² housing-unit on plot area of 100 m². 20 housing units have been built so far. Electricity network is available and equipped with street lighting from the state owned electricity company (PLN). Asea Uninet Scientific and Plenary Meeting 2016 | 327 Source: Field survey, 2015 Figure 6: Tirtomadu Residence Housing. The road network in this housing area is paved with concrete paving blocks and equipped with both closed and open drainage in some locations. The greening efforts has been carried out individually in front of each house. The width of neighborhood road here can be passed by two cars with ease. With limited land area for the housing poject, the housing developer face difficulties in providing the overall type of PSU on housing. The common PSU types provided are usually a network of neighborhood roads between 3 - 4m wide, simple drainage network, electricity and telephone networks, green lanes and neighborhood parks are limited to a few residential projects. For green open space, such as the neighborhood park, children's playground and sports field are still lacking or very limited. The provision of the cemetery land, usually the developers pay compensation to the village around one million rupiah for each housing unit built. This compensation is then managed by the village to expand or improve the quality of existing graves and the residents of the housing can then used it in the event of death. The survey on formal housing condition and the availability of PSU on the development of formal housing in Blitar are described below. Land area for housing project built by housing developers in Blitar, is below 1 ha (75% locations). In average only 25% of surveyed housing projects has land area between 1-5 ha and no single developer build housing on land with an area of more than 5 hectares. This shows that the majority of housing developers in Blitar is a small developer. Meanwhile, to ensure the availability of homes for low-income people, the Government has issued a regulation requiring housing developers to build three medium-class houses and six small-sized houses for each of luxury house built by the developer. At the request of the developer, the regulation was converted into 2 medium houses and 3 small-sized houses for each of the luxury house built by the developer. Associated with these regulations, in average, residential area built by the developer in Blitar has only one type of housing, namely medium housing (71-125 m² type) at 13% the housing location and small-sized houses (21-70 m² type) as much as 60% of locations surveyed. No single developer build housing specifically for luxury homes (> 125 m² type) in Blitar. Only in 27% of sites that the developer has met the above regulation of housing construction. The majority of which is a 328 | Asea Uninet Scientific and Plenary Meeting 2016 mix between small-sized house and medium house. Developers who build houses with the mixed type only found in the Griya Melati Indah in Kepanjen Kidul village, Kepanjen Kidul district. The housing composition here is 85 luxury housing units (MW) : 69 medium house (RM): 70 small-sized house (RSH). Source: Field survey analysis, 2015 Figure 7: Percentage formal type of house built in Blitar Thus, the balance of the regulation residential building luxury houses : medium houses : simple house with a composition of 1: 2: 3 can not be applied completely in Blitar. As for the lack of development of type luxury houses, it is associated with a lower market demand and the ability of house buyers in Blitar that do not require luxury houses type. In other words, luxury houses has not been a top priority for the Blitar citizens. Related to the allocation of the provision of land for PSU by the developer at the time of filing the permit, the survey results show that 60% of developers set aside land for PSU from 30.1 to 40% and the remaining allocated land at 20.1 to 30% of the surveyed housing locations. This suggests that most developers already meet the requirements to provide the PSU for housing when applying for housing construction permits to the Department of Public Works and Housing of Blitar. Source: Field survey analysis, 2015 Figure 8: The percentage allocation of the provision of land for PSU Asea Uninet Scientific and Plenary Meeting 2016 | 329 In reality, the provision of land for PSU in some housing was not in accordance with the existing allocation in the site plan of housing used for the submission of license. Housing developers realize the PSU housing land allocation was in accordance with the site plan (from 30.1 - 40% of land allocation for PSU) only as much as 33% residential locations (60% of the allocation plan). While the provision of land developers who realize the PSU at 20.1 - 30% only 33% of housing sites (40% of the allocation plan). The remaining 7% of housing sites only provide the land PSU at 10.1 to 20% and as much as 27% more residential location only provide land for housing PSU 1 -10%. Source: Field survey analysis, 2015 Figure 9: The percentage of realization of the provision of land for PSU The above discussion shows that there have been irregularities in the implementation of housingdevelopment. Land allocation for PSU as outlined in the site plan and agreed upon by both parties (the Department of Public Works and the Housing Developers), was not realized in accordance with its provisions. Moreover, this condition indicates a lack of oversight of the stakeholders on the implementation of formal housing development in Blitar. The field survey on the provision of housing PSU also assessed the provision of housing PSU per type. In accordance with the Minister of Home Affair Regulation No. 9 of 2009, that the housing PSU composed of infrastructure, facilities and public utilities. Housing infrastructure consists of five types: (i) road network, (ii) sewerage network, (iii) network of rainwater drains (drainage) and (iv) temporary waste disposal (TPS). The survey shows that housing developers who provide all types of infrastructure (4 types) is present in 20% of residential location, while housing developers who provide 3 types of infrastructure reaches 47% of housing location and those who provide only 1-2 types of infrastructure reach 25% residential location. 330 | Asea Uninet Scientific and Plenary Meeting 2016 Source: Field survey analysis, 2015 Figure 10: The percentage of availability of housing infrastructure type. Network of roads and drainage infrastructure is always provided in every housing, because it is the basic of housing infrastructure. However, the road network and drainage condition in some area were much less adequate, for example: unpaved road, the neighborhood road which width is too narrow, the volume of drainage not according to standard and so on. The housing infrastructure that does not exist in the surveyed housing area is the network of sewage and temporary waste disposal (TPS). Waste water problem is still resolved in their housing plot using septic tank and leach. Waste management system carried out by the occupants to throw garbage in the bins provided in front of each house, then periodically transported by a collector to be disposed to temporary waste disposal (TPS), which is located outside the housing area. The collector is usually selected independently by the inhabitants and his monthly salary is paid by occupants dues. In addition, developers’ reason to not provide TPS is because the occupants did not want it. The existence of TPS in the housing is not only disturbing the aesthetics, but will also cause a bad odor and be a source of disease if not properly managed. 6 CONCLUSIONS AND SUGGESTIONS Of various description above, it can be concluded that in general the problems of housing and settlements in Blitar, among others are:    Most of the formal housing in Blitar developed by the developer in an area of less than 1 hectare. This situation would complicate the provision of 30% land allocation for the provision of infrastructure, facilities and public utilities (PSU) in the settlements. The existing condition of formal housing that is not in accordance with the standards of the provision of PSU housing obligations, especially the provision of green open space (RTH) and firefighters. The Government of Blitar have no comprehensive legal basis yet on housing and settlements at the municipal level in particular local government Asea Uninet Scientific and Plenary Meeting 2016   | 331 regulation or Mayor Regulation on the provision and handing over of PSU housing from the developer to the Government of Blitar. Legal basis is needed to maintain the continuity of maintenance of the PSU after the developer completed the residential project. This legal basis can be used as a tool to remind developers to provide housing PSU in accordance with the existing regulations. The housing data in Blitar has not been recorded properly and not informative. This situation include the initial data of business permit to the stage of housing development that has completely been built. Untidiness of this data will complicate Blitar city government in overseeing the future development of housing activities in Blitar. Blitar city government also does not have a master plan for drainage yet. Thus small-scale residential development that spread sparsely, will probably cause flooding problems in the future. With the various problems mentioned above, it is necessary to find a solution to the availability of housing activities that supported by the existence of adequate PSU and reinforce the environmental sustainability. Various parties related to the housing development should discuss the solutions of the existing problems. The solution is then formulated into the concept of the implementation of housing and settlements in Blitar that can be used as technical material for the local government regulation or Mayor Regulation. This regulation would be the legal basis of all the organizers of housing and settlements activities in Blitar. REFERENCES: ------, 2007, Peraturan Menteri Negara Perumahan Rakyat Nomor 10/PERMEN/M/ 2007 tentang Pedoman Bantuan Stimulan Prasarana, Sarana, dan Utilitas Umum (PSU) Perumahan dan Permukiman. (The Regulation of the State Minister of Housing No. 10/PERMEN/M/2007 regarding the Stimulants Guidelines on Infrastructure, Facilities and Public Utilities of Housing and Human Settlement). ------, 2009, Peraturan Kementerian Perumahan Rakyat Nomor 2 Tahun 2009 tentang Tata Cara Pelaksanaan Bantuan Stimulan Prasarana, Sarana, dan Utilitas Umum (PSU) Perumahan dan Permukiman Rumah Sederhana Sehat (RSS). (The Regulation of the Ministry of Housing No. 2 of 2009 regarding the Implementation Procedures on Stimulants support for Infrastructure, Facilities, and Public Utilities of Simple and Healthy Housing). ------, 2009, Peraturan Menteri Dalam Negeri Nomor 9 tahun 2009 tentang teknis penyerahan PSU tersebut kepada Pemerintah Daerah. (The Regulation of the Minister of Home Affairs No. 9 of 2009 on the Technical Delivery of Infrastructure, Facilities, and Public Utilities (PSU) to local governments). ------, 2011, Undang-Undang Nomor 1 Tahun 2011 tentang Perumahan dan Kawasan Permukiman. (The Republic of Indonesia’ Law number 1 of 2011 on Housing and Settlement areas). Badan Pusat Statistik Kota Blitar, 2013, Blitar Dalam Angka (Blitar in Figures), Blitar. Doebele, W. A., 1980, ‘Some Unexamined Aspects of Urban Land Markets: Proposals for Research’, in World Congress on Land Policy, Lexington Books, Lexington, Massachusetts. 332 | Asea Uninet Scientific and Plenary Meeting 2016 Doebele, W. A., 1983, ‘The Provision of Land for the Urban Poor: Concepts, Instruments and Prospects’ in Land for Housing the Poor, S. Angel, R.W. Archer, S. Tanphiphat and E.A. Wegelin, pp 348-374, Select Books, Singapore. Payne, G., 1997, Urban Land Tenure and Property Rights in Developing Countries: A Review, Intermediate Technology Publications, London. Rapoport, A., 1977, Human Aspect of Urban Form, Toward a Man Environment Approach to Urban Form and Design, Pergamon, England Soemarno, I., 2011, Urban Land Policy and Housing Development in Indonesia: Surabaya as a case study, LAMBERT Academic Publishing, Saarbrucken, Germany. Struyk, R.J., M. L. Hoffmann, et al, 1990, The Market for Shelter in Indonesian Cities, The Urban Institute Press, Washington DC. Turner, John. F.C and Fitcher, R., 1972, Freedom to Built, New York, USA, the Macmillan Company KAMPUNG INNOVASION IN SUPPORT OF SMART CITY Happy Ratna Santosa happy_rs@arch.its.ac.id * Johan Silas johansilas@arch.its.ac.id Purwanita Setijanti psetijanti@arch.its.ac.id Department of Architecture, ITS Surabaya Rita Ernawati myreeta80@gmail.com PhD Student Department of Architecture, ITS Surabaya Abstract Recently, many countries have implemented programme to improve the condition of low-income settlements. The intervention mostly started from improving the basic infrastructure to organizing the community in increasing their capacity to do more by and for themselves. Introducing the use of ICT follows it. Smart City concept is not only concerned with the tangible aspects but also the intangible aspects related to the behavior and people's understanding of the concept. Thus, a city needs to increase its social services, health care, and to apply it in economic activities, to include educating the public on the concept of smart city as a whole. In Indonesia several cities have implemented the concept of smart city such as Bandung, Balikpapan, Makassar and Surabaya. By now, cities in Indonesia apply different approaches to the concept of smart city. It is therefore interesting and important to study and understand the differences applied in different time and different place. Surabaya use a holistic approach from the macro (city) to the micro (kampung) level is an interesting case to look into the experience gained. Kampung as the dominant form of low income housing in the city of Surabaya is the object for the development of smart city as it is implemented by the city government. Kampung that is cultural diverse and some with long history is a potential challenge in the implementation of smart city concept. In fact the kampungs in Surabaya show indication of the ability of the respective inhabitants in accepting the concept and further developing into various innovations. Based on the above description, the study intends to reveal the many form of innovation made by kampung communities in developing and complementing to the smart city of Surabaya. Results of the study are the source to formulate the characteristics of innovative society and will contribute to the development of smart city elsewhere and can be used as reference for other towns and cities in Indonesia and beyond. Keywords: kampung, innovation, technology, smart, housing and settlement Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 333 334 | Asea Uninet Scientific and Plenary Meeting 2016 1 RESEARCH BACKGROUND Smart City concept is not merely concerned with the physical aspects but also non-physical aspects relating to behavior and people's understanding of the concept. Thus, a city needs to increase social services, health care, and educate the public about the concept of smart city. Smart city is synonymous with the use of technology and information to maximize existing resources. By building an intelligent infrastructure to maximize resources services to citizens are expected to be more effective and efficient. Three conditions must be owned by a town to be called as a Smart City is environmentally friendly with green open space (RTH), efficient use of energy are realized with the availability of public transport is adequate, the application of appropriate technology in line with the addition of infrastructure in order to more easily, efficiently and flexible. The goal is the implementation of a holistic concept of smart city, not just the icon. In Indonesia there are several cities that have implemented the concept of smart city including Bandung, Balikpapan, Makassar and Surabaya. In developing the smart city, Bandung City Government will develop Bandung Techno-Polis on 400 hectares of land that will become a prototype smart city in Indonesia. Additionally, Bandung also has developed internet access in public spaces by installing 5000 wifi, social media-based services, etc. Surabaya city in developing the smart city apply an approach through the development of information technology-based services, ranging from population data collection, health services, transportation management etc. Provision of Internet access not only to the scale of the city public space but also can be accessed on a scale of settlements (kampungs). In 2011 the city of Surabaya won the event Smart City Award 2011 in the category of Smart Environment, Smart Living and Smart Governance. Differences in approach to the cities in Indonesia in applying the concept of smart city, be interesting to study diversity. Surabaya city with a holistic approach at the macro level to the micro is an interesting one. Kampung which is the dominant form of housing in the city of Surabaya is the object of the development of smart city conducted by the city government. Kampung community cultural diversity can be a potential challenge even in the implementation of smart city. In fact the kampung in Surabaya shows indication of ability in accepting this concept, by developing various innovations. Based on the above description, the study sought to reveal the form of innovations that made by the kampung communities in developing smart city in Surabaya. Results of this study are expected to formulate the characteristics of the innovation society is able to contribute to the development of smart city, which can be a reference for other regions in Indonesia. 2 RESEARCH METHOD This research will be done with quantitative and qualitative approaches. A quantitative approach is applied in measuring the level of innovation that is made public by scoring techniques. The qualitative approach is done in order to reveal the reason people make innovations for improving the quality of the kampung. Primary data were collected with a structured interview techniques and in-depth interviews. Gather secondary data obtained from credible sources both at the level of municipalities and kampung. A series of stages that will be passed in this study include: 1) 2) Study literature to define the indicators and parameters of kampung’s innovation for the development of smart city. The collection and review of secondary data. Asea Uninet Scientific and Plenary Meeting 2016 3) 4) 5) 3 | 335 The collection of primary data through observation and interviews with kampung community. Processing and analysis of quantitative data based on indicators and parameters have been determined. Synthesis of the results of quantitative analysis and in-depth interviews will elaborate with triangulation techniques to define the characteristics of the innovation community. SURABAYA SMART CITY Surabaya City in 2015 was awarded as the best city in applying the concept of smart cities. The result is evidence that the development of Surabaya comprehensively meet the satisfaction of the people. In implementing smart city, the city government is using the basic concept formulated by Cohen (2012) that includes six variables: smart economy, smart environment, smart government, smart living, smart mobility and smart people. Surabaya city has a long history in the implementation of smart city concept. In the nineties, an e-procurement (electronic procurement) system was introduced. It was intended to speed up the process, open to be scrutinized and participated by the public as well as deterring further the potential for corrupt activity. In the beginning it was an uphill effort as many vested interest parties anticipate the loss of comfortable earning. Only through persistence and courage the e-procurement system was be accepted and adopted widely to include as high as the national government and big commercial entities. By now ICT developed by local university is applied widely in the running of the city of Surabaya. Now, the Mayor of Surabaya can easily control and manage the running of the city by using a simple mini tablet from anywhere at any different time of the day. The Mayor can sign a letter from say Buenos Aries when needed using e-signature. Many CCTVs are installed in many part of the city by also respecting the individual privacy of the citizens. It use to measure the length of the car queue to controls the duration of the traffic light. Or to know how many waste has been disposed to the final disposal ground. Internal city government from employee to finance is managed by e-system. If some intend to visit to a health clinic certified by ISO, one can register on-line and receive a registration slip. When visiting the clinic the slip can be used to obtain queuing number. When finally meeting the doctor, he or she has the health record of the patient and enter the intervention taken into the patient’s data. When leaving the clinic at the dispensary the medicine recommended by the doctor is ready to be taken home, all free of charge by showing a Surabaya ID card. Information and license can be obtained by using the Internet. Hundreds e-kiosk are available to be used by anybody and anytime to contact the city government agencies. The difficult part of the smart city approach is the development of smart people. Next to free elementary, secondary and high school education is free and ICT is available, many Broadband Learning centres are established 336 | Asea Uninet Scientific and Plenary Meeting 2016 where anybody can come to learn using the Internet free of charge and instructors are available if certain skill need to be trained. Table1 Smart City Concept Implemented in Surabaya No Smart City Variable Smart City Implementation in Surabaya 1 Smart Government 2 Smart People 3 Smart Living 4 Smart Mobility 5 Smart Environment 6 Smart Economy The use of ICT in public administration activities. These efforts succeeded in optimizing the performance of services to the community. Applications that are used are: Financial Management System Organizing Human Resource Education Monitoring Permit Health Information The use of ICT in school academic activities and training in information technology extensively. Broadband Learning Centre Online Tryout New Students Admission Student Online Expression The use of ICT in facilitating the process for accessing various public facilities. Health Facility Demography Services The development of environmental friendly and technology based mobility systems. Mixed Model Access Disaster Mitigation System Media Communication Traffic Intelligent Transportation System Smart innovation by the community in implementing environment management. The government support and developed tools in optimize the performance. Green and Clean Program Waste Management Control Generate local economic development by supporting home based enterprise. 4 KAMPUNG INNOVATION IN SUPPORT OF SMART CITY Kampung in the city of Surabaya occupies 30% of built up area and holds more than 70% of the population of the city, so the existence of the kampung is an important part of urban development (Silas, 1992). The existence of kampung with the communities and quality improvement program in Surabaya still persist in efforts to adapt to modernization and globalization (Setijanti, 2009). Public awareness on environmental development in Surabaya, through creative innovations, makes the kampung as a livable settlement for the Asea Uninet Scientific and Plenary Meeting 2016 | 337 people’s lives. Currently, the kampung in Surabaya indicates the phenomenon not just a place to life but also as a place for the inhabitants to actualize themselves. The inhabitants have a high sense of belonging to the kampung that raises awareness to protect and preserve the environment. Kampung in Surabaya as a home for 70% of the population continues to increase along with the growth of the city. Kampung should be able to adapt in order to survive as a livable settlement. Kampung which is home to a large low-income people in general have environmental problems. However, through creative innovations of the community with the support of the city government, the kampung in Surabaya is able to transform to be green kampung with green economic activity (Ernawati, et.al, 2012). Here are some innovations of the kampung inhabitants. Table 2. Dimmension of Innovation in Kampung No Kampung Innovative Potention Dimensions of innonvative space 1 Revegetated by the inhabitants 2 Reuse-reuse-recycle approach on solid waste management Waste Water Treatment Green kampung as product of the community innovation Solid waste management as a process to be liveable settlements settlements Waste water treatment as a proces, product of the community innovation As an process to maintain the sustainability of the kampung 3 4 Environmental facilitators and volunteers Source: Ernawati, et.al (2012) The table above shows that the kampung has the potential to be developed as a smart innovative settlement. The efforts of the community have proven successful in increasing the economic value and improve image of the kampung. Through this innovative approach, communities are able to develop creativity to solve problems even on a small scale in smart ways. 338 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 2 Innovative Water Treatment Technology by the Community Figure 3 Innovative Garbage Product by the Community 5 CONCLUSION The main purpose of the research is to further develop the Five Capital model in term of the way people developed the elements of the five capitals and how it is linked to the wider urban system. People in the kampungs have unique way in doing things more adaptive to local condition, effective and innovative in operation with reasonable high achievement rate. The difference in criteria term of the five elements needs to be compared to the urban scale and system. The city of Surabaya has a big challenge to develop innovative kampung in order to achieve a smart city. Integrative and continuous efforts are needed to ensure successful implementation. This paper proposed to research deeply on the innovative effort by community in supporting smart city through all dimension. Asea Uninet Scientific and Plenary Meeting 2016 | 339 REFERENCES Bossom.M, Hawkins.G, (2015), Starting A Smart Community Evolution The Journey To Urban System Resilience, Black & Veatch Holding Company, Overland Park. Cohen. B, (2012) “The top 10 smartest European cities,” www.fastcoexist.com/ 1680856/the-top-10-smartest- european-cities, [Des 3, 2015]. Ernawati, Santosa, Setijanti (2012) The Potential of The Kampung Towards Liveable Settlements with Innovative Approach In Surabaya, International Seminar: Innovative and Smart Settlements, Department of Architecture ITS Surabaya, December, 12, 2012 IKCI (2015) Bagaimana Proses Pemeringkatan Kota Cerdas 2015 ini Dilakukan?, http://lipsus.kompas.com/kotacerdas/about, [Des 3, 2015]. Setijanti,P (2009) Sustainable Concept and Approach in Improvement of Lives for Slum Dwellers: Surabaya’s Practices, Journal of Architecture and Environment Volume 8, No 2, October 2009 (92-111) Silas, J. (1992) Government - community partnerships in Kampung improvement programmes in Surabaya, Environment and Urbanization, vol. 4, No. 2, Sage Publising FORMULATING LOCAL MEASUREMENT FOR SMART SETTLEMENT IN INDONESIA Purwanita Setijanti psetijanti@arch.its.ac.id Johan Silas johansilas@arch.its.ac.id Department of Architecture, ITS Surabaya Rita Ernawati myreeta80@gmail.com PhD Students, Department of Architecture, ITS Surabaya Abstract In the new century, globalization and rapid technological changes have affected the development of towns and cities significantly. In developing country, cities faced competition and sustainable urban development challenges simultaneously. Smart city became a popular term in urban development and encourages city government to implement the concept in several urban aspects. In last 20 years, many institutions have formulated smart city index in different ways and perspectives to measure the achievement of many urban development issues. In this respect Forbes focuses on two overarching benefits of smart cities: sustainability and efficiency. The British Standards Institution (BSI) has developed different standards and strategy for smart cities in the UK called PD 8101. Centre of Regional Science (SRF) at Vienna University of Technology propose another smart cities ranking for European medium-sized cities based on six characteristics, namely economy, people, governance, mobility, environment and living condition. Currently in Indonesia smart city concept is understood in a many forms. The smart city concept is understood and developed based on the application of information technology. Some of these concepts are significantly different to the formulation of the six-wheel smart city model that is comprehensive and covers wider aspects. Based on the above description, it should be formulated indicators of smart city that is more comprehensive and relevant in Indonesia. Taking into account the quality and availability of data are relatively less accurate at the macro level, the study was initiated smart city development indicators at the level of settlements. Another consideration is to know in real implementation of the smart city concept in the field. Keywords: smart city, settlements, formulation, urban development, sustainability and efficiency Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 340 Asea Uninet Scientific and Plenary Meeting 2016 1 | 341 INTRODUCTION Globalization and fast technological changes has very substantial effects on city development to all cities. Cities in developing country face the challenge of combining competitiveness and sustainable urban development simultaneously. This challenge is mostly to have an impact on issues of Urban Quality such as economy, culture, social, housing, and environmental conditions. Smart city became a popular term in the urban development that encouraged city government to implement the concept in various urban aspects. According to Caragliu, et.all (2012) a city can be defined as ‘smart’ when investments in human and social capital and modern transport and communication infrastructure fuel sustainable economic growth and a high quality of life, with a wise management of natural resources, through participatory governance. Since over last 20 years, many institutions formulate smart city index in different perspective regarding urban development issues. For example, Forbes in research collaboration with Steffen Sorrell from Juniper Research focuses on two overarching benefits of smart cities: sustainability and efficiency. Smart city in Forbes perspective consists of five essential components: technologies, buildings, utilities, transportation & road infrastructure and the smart city itself. Citizens are not the only factors to consider in the evolution of cities into smart cities. Governmental and commercial entities are going to play increasingly important roles in development and implementation of technologies that pave the way for a smart city (High, 2015). With all the consideration Forbes released five top smart city that are Barcelona, New York, London, Nice and Singapore. The British Standards Institution (BSI) in collaboration with The United Kingdom (UK) Department for Business, Innovation and Skills have developed a standards strategy for smart cities in the UK that is called PD 8101. The role of smart city standards is to support the widespread adoption of common approaches to the implementation of smart city products and services in order to facilitate the rapid development of an effective smart city market (BSI, 2014). Based on that standard BSI released top ten smart city in Europe that are Barcelona, London, Paris, Copenhagen, Vienna, Berlin, Stockholm, Nice, Amsterdam, and Zurich. Centre of Regional Science (SRF) Vienna University of Technology in a collaborative work with the Department of Geography at University of Ljubljana and the OTB Research Institute for Housing, Urban and Mobility Studies at the Delft University of Technology propose smart cities ranking of European medium-sized cities based on six smart cities characteristic by Cohen. Boyd Cohen in 2012 formulate smart cities wheel as a framework for understanding six key components of a smart city. The six components of the Smart Cities Wheel are Smart Environment, Smart Economy, Smart Government, Smart Mobility, Smart Housing and Smart Living. Based on that component, Luxembourg became the best medium sized smart city in European. In Indonesia, the latest development of smart city concept was exposed in 2015, with Surabaya selected for the Smart City Award 2015 in the category of Smart Environment, Smart Living and Smart Governance. Besides Surabaya as the smartest city, several other cities that have also developed the concept of smart city were recognized to Bandung, Balikpapan and Makassar. In Indonesia, the smart city concept is basically new and understood in variety perspectives. According to Supangat (2014) Smart City is a concept that presents information in the state of a city in a comprehensive manner and in real time, and can be accessed via a control room, with the goal to support the development of a transparent and sustainable city. According to the Appraisal Committee of Indonesia Smart Cities Index, smart city is a city that uses digital technology to improve its performance, reduce costs 342 | Asea Uninet Scientific and Plenary Meeting 2016 and consumption usage, as well as to further engage actively and effectively with its citizens. There are at least three factors for assessing smart city, such as smart economic, smart social, and smart environment. The concept of smart city in Indonesia was understood to rely heavily on the use of information technology for urban development. This is in contrast to the formulation of the six-wheel smart city model that is more comprehensive and covers various aspects. Although the formulation of assessment indicators for smart city is comprehensive, but still it gives rise to conflict and criticism by various parties. “It is never easy determining the correct number of indicators to use for such a significant task like benchmarking smart cities, which is a very complex concept. The hope is to have as many cities (large and small) from around the globe participating in a way that permits them to benchmark themselves against other similar cities, and of course, to facilitate knowledge sharing amongst the private sector and citizen groups” (Cohen, 2014). City-rankings tend to neglect complex interrelations in regional development. Based on the above discussion, indicators for smart city should be formulated more comprehensive and relevant to the condition in Indonesia. Taking into account the quality and availability of data that in macro level (the city) are relatively less accurate, the study initiates smart city development indicators at the lower level of settlements (kampung). Another consideration is to know the real implementation of the smart city concept in the field. 2 SMART CITY PERSPECTIVE IBM, a leading provider of smarter solutions in formulating smart city concept views a city as a tripod - the three pillars being the people, infrastructure and the operations, which relies on strong support among each of its pillars. Accordingly, three basic services have been identified namely human services, infrastructure services and services pertaining to city planning and management. Human services include education, healthcare and social programs whereas energy, water and transportation describe the infrastructure services. Services need to be provided for the overall management of the city including city governance, public safety, urban planning and managing natural resources. Another concept developed by Hitachi as one of the leading smart solution provider defined Smart City as “an environmentally conscious city that uses information technology to utilize energy and other resources efficiently”. In their vision, a Smart City is one that seeks to satisfy the desires and values of its residents, with the use of advanced IT to improve energy efficiency and concern for the global environment as prerequisites, and in doing so maintains a “well-balanced relationship between people and the Earth”. Smart Cities Wheel Model Proposed by Boyd Cohen identifies six key dimensions along which a city can be identified or ranked, namely smart economy, smart environment, smart governance, smart living, smart mobility, and smart people which can also be regarded as the six key components that constitute a Smart City. Smart Environment is to be established through the intervention towards environmental protection such as green Asea Uninet Scientific and Plenary Meeting 2016 | 343 buildings, green energy and green urban planning. Smart Governance comprises the aspects of enabling supply and demand side policy, transparency and open data, ICT and eGovernance. Building up a culturally vibrant community and enhancing the quality of life of citizens in the aspects of health, safety and happiness are envisioned through smart living. Availability of integrated Information and Communication Technologies along with transportation systems that encourage mixed-modal access and clean, non-motorized options are identified as the drivers towards achieving smart mobility. People empowered by 21st century education who are also enriched with creativity are among the aspects of smart people. It also promotes the concept of inclusive society. Cohen (2012) proposes some important steps that need to be followed in adopting the above framework. Initially a vision for the city needs to be defined with the involvement of its citizens. In realizing the set vision, the cities should first develop a baseline or measurement that can be used as a starting point before establishing forward looking, numerical targets. Then they can set target indicators. The cities must develop their own benchmarks and target indicators based on their own needs and existing opportunities while following the best practices of the leading Smart Cities around the globe. The needs and challenges based on the population density, topography and existing infrastructure are different from one city to another and defining the city’s own vision and the way towards realizing its vision by their own, can be viewed as indispensable in any attempt made towards developing a Smart City model that is applicable to a city of any scale. Another important guideline is to go lean. The cities should follow lean start up principles. They should identify the targets that can be achieved easily while building plans for long-term actions. Based on previous description, six wheel smart city model by Cohen show the comprehensive formulation. Many institutions have adopted the concept. Centre of Regional Science (SRF), Vienna University of Technology adopt this formulation in measuring medium smart city index in European. From the number of smart city factor describe into many indicator. The characteristic and factor of smart city describe bellow. Table 1 Characteristics and Factors of a Smart City (Centre of Regional Science (SRF), Vienna University of Technology) Factor Indicator Level Innovative Spirit R&D expenditure in % GDP regional Employment rate in knowledge-intensive regional sector Enterpreneurship Patent applications per inhabitant regional Self-employment rate local New businesses registered local Economic image & Importance as decision-making center trademarks regional Productivity local GDP per employed person 344 | Asea Uninet Scientific and Plenary Meeting 2016 Factor Indicator Level Flexibility of Unemployment rate regional labour market Proportional in part-time employment local International embeddedness Companies with Head Quarter in the city local quoted on national stock market Level qualification Air transport of passengers regional Air transport of freight regional of Importance as knowledge centre (top research regional centres, top universities etc.) Population qualified at levels 5-6 ISCED local Foreign language skills national Affinity to life Book loans per resident local long learning Participation in life-long-learning in % regional Participation in language courses national Social and ethic Share of foreigners local plurality Share of national born aboard local Flexibility Participation of getting a new job national Creativity Share of people working in creative industries national Cosmopolitanism/ Voters turnout at European elections local open-mindedness Immigration-friendly environment (attitude national towards immigration) Knowledge about the EU national Participation in Voters turnout at city elections local public life Participation in voluntary work national Asea Uninet Scientific and Plenary Meeting 2016 | 345 Factor Indicator Level Participation in City representatives per resident local decision making Political activity of inhabitants national Importance of politics foe inhabitants national Share of female city representatives local Public and social Expenditure of the municipal per resident in local PPS services Share of children in day care local Satisfaction with quality of schools national Transparent Satisfaction with transparency of bureaucracy national governance Satisfaction with fight against corruption national Local accessibility Public transport network per inhabitant local Satisfaction with access to public transport national Satisfaction with quality of public transport national (Inter-)national accessibility International accessibility regional Availability of ICT Computers in households national infrastructure Broadband internet access in households national Sustainable Green mobility individual traffic) innovative and safe Traffic safety local transport systems Use of economical cars national Attractivity of Sunshine hours local natural conditions Green space share local Polution Summer smog (Ozon) local Particulate matter local share (non-motorized local 346 | Asea Uninet Scientific and Plenary Meeting 2016 Factor Indicator Level Fatal chronic lower respiratory diseases per regional inhabitant Environmental Individual efforts on protecting nature national protection Opinion on nature protection national Sustainable Efficient use of water (use per GDP) local resource managemet Efficient use of electricity (use per GDP) local Cultural facility Cinema attendance per inhabitant local Museums visit per inhabitant local Theatre attendance per inhabitant local Life expectancy local Hospital beds per inhabitant local Doctor per inhabitant local Satisfaction with quality of health system national Crime rate local Death rate by assault regional Satisfaction with personal safety national Share of housing fulfilling minimal standards local Average living area per inhabitant local Satisfaction with personal building situation national Students per inhabitant local Satisfaction with access to education system national Satisfaction with quality of education system national Health conditions Individual safety Housing Quality Education Facilities Touristic Importance as tourist location (overnights, regional sights) Asea Uninet Scientific and Plenary Meeting 2016 | 347 Factor Indicator Level attractivity Overnights per years per resident local Social cohesion Perception on personal risk of poverty national Poverty rate national The diversity of the city conditions with complex issues, making the formulation of the indicators difficult to be applied to other regions. Thus, it needs to be adjusted through a series of in-depth study, to formulate the indicators according to the condition in its respective area. 3 FORMULATING LOCAL MEASUREMENT OF SMART CITY INDONESIA The complexity of city problems is a major challenge for the government in managing the city intelligently in order to improve the quality of life for its citizens. The application of the concept of smart city becomes the need of every town, including in Indonesia. Indonesia Smart City Index is one of the performance assessment of urban development formulated by a leading national newspaper (KOMPAS) in collaboration with Institute of Technology Bandung (ITB). The judgement of smart cities achievement is in its successful and innovative way to improve the quality of life of its inhabitants. Assessment of Indonesia Smart Cities Index considers three aspects: economic, social and environmental. In addition, in the management of the city against these three aspects must also considere the application of information technology and the role human resources in effecting the performance of the government. Smart city indicators on the achievement in economic aspects is if it is supported by the economy growth, and by maximizing the use of resources. Management of the social aspects were considered successful if the public can enjoy living safely, convenient and comfort in the city. Residents can access to health care, transportation and other public services easily and at feasible cost. Smart environmental management can be described as a city that can provide healthy living condition, energy management with the principle of saving and spatial conformity. City management of the three aspects should maximize the resources used or other perfomance of the city, including in Information and Communication Technology services, Governance and the role of Human Resources. The scale of assessments on each of the indicators were carried out by academics and professionals. Initial assessment was based on secondary data from the Central Statistics Agency (BPS) and data from the municipality on economic, social and environmental condition. Results are used as the basis for initial judgment to the next assessment that was done using public survey in every city, related to the satisfaction of public service by the bureaucracy and service facilities. The final assessment is done by combining secondary data and survey data to aarive to the final score smart cities in Indonesia. By considering the formulation of indicators based on six wheel concept and Indonesia Smart Cities Index, some weakness can beidentified (Cohen, 2012). The weaknesses are:  City-rankings tend to neglect complex interrelations in regional development 348 | Asea Uninet Scientific and Plenary Meeting 2016     4 The discussion is mainly focused on the bare rank Long-term development strategies may be threatened Existing stereotypes may be strengthened Badly ranked cities tend to ignore the results SURABAYA AS BENCHMARK IN FORMULATING MEASUREMENT OF SMART CITY INDEKS LOCAL UN Habitat in Model Project 2013/14 has elaborate smart city as (quoted): Good cities do not come about by accident. The prerequisites for a good city are broad community consensus, longstanding political determination and sound urban planning which, over the course of time, engender urban environments that can provide well- being and security to their inhabitants, guarantee the supply of water, energy and food, and promote a compact and diverse urban structure in which innovation, trade and economic prosperity are encouraged and which definitively protects that urban communal space in which individual rights and opportunities are most respected. UN Habitat Model Projects 2013/14 proposed the following criteria for Smart City in the XXI century. A leading new paper (Kompas), a prominent institute of higher learning (ITB) and large national LPG public company (PNG) has selected Surabaya as the smartest city in Indonesia. The selection criteria were SMART: living, environment, utility, economy, mobility and people. This means that Surabaya has effectively use IT to improve the living condition, better environmental quality, green utility and economy, to introducing rail based urban mass transport and the most difficult one was building smart people. For this not only is basic education and health is free, but IT has been widely used such as paperless exam to access to the performance of a student. One can register to visit a ISO certificated public health clinic on-line and by the time the doctor has finished the consultation, on the way beck the patient can get his or her prepared medicine without waiting as it was sent through IT by the physician to the dispensary. To understand how far Surabaya has achieved in its endeavor to meet the smart city criteria, it can also use the Sustainable Development Goals as means. Surabaya has the lowest poor people among the one million-city category in Indonesia, practically no hungry person in the city. Health and education is free for its citizens, Gender equality has been introduced in all walk of live, to include the head of the Fire Brigade that ensure when fire did happened, fire engines to include ambulance, security personals are in place in less than FIVE minutes. By now more than 90% of the population is served with piped water system and in three years time all inhabitants of Surabaya get access to municipal water system. Sanitation is still based on local treatment plan and need to be improved with district sewerage system in the fuiure. Gradually lighting moved to using LED based lamps to include street lighting. Solar energy has been introduced and used by more people but still a long way to go. Green building awareness is evaluated annually. To serve the average annual economic growth of 7% annually Surabaya need plenty of new work force. Taxi companies are always in short number of competent drives. The city needs at least 10.00 street cleaners to ensure that before 7 am, the streets are clean. The same number of persons are needed to tend public parks and gardens. The application of Intelligent Traffic System (ITS) where traffic light duration depends on the length of the car queue monitored by CCTV. Or utilizing composting waste to generate electricity, etc. Those are the simple example of innovation and infrastructure. A citywide movement to alleviate subsistent economy in the kampungs to market economy proved effective in reducing social and economic inequality. Surabaya Asea Uninet Scientific and Plenary Meeting 2016 | 349 managed to go far and earlier in achieving the MDGs and already significant way in achieving the SDGs targets, long before the two decades time frame. One of the city visions of Surabaya is an ecological city that encompassed wide element of the environment for its sustainability, from on-land environmental element of forest, parks to lake and ponds to creating participatory work undertaken by citizens of all walks of life. To create a responsible consumption is in deed an uphill challenge although for a long time city government never organized any event in hotels or other commercial place. Surabaya has a long coastline to about 40 kilometers that was planned carefully and monitored its functionality very seriously. Mangrove area is designated for conservation to about 2300 hectares. Street fighting among its citizens as well as anarchic demonstration has long been in the history. Surabaya worked closely with town and cities in Indonesia and beyond. For some times City government of Surabaya working with local experts developed the Smart City Concept close to the Wheel model by B. Cohen. The six elements of Smart City that consisted of Smart Economy, Smart Environment, Smart Government, Smart Living, Smart mobility and Smart People need to be investigated the impact to people living in low income settlements of Surabaya. Working with the Ministry for The Environment and Forestry, Laboratory for Housing and Human Settlements have developed a simpler smart city to sustainable city model that consist of the generation and formation of FIVE capitals, Economic, Social, Environmental, Infrastructure and Governance. The Five Capital model in substance term is similar to the Six Wheel model used by the city government. The Five capital model is easier to implement and also easy to measure the result. The model has been tested at district level (Kecamatan) and to some extends to kampung level. Economic capital in the kampung is mainly focused on home based enterprise locally known as kampung unggulan or prominent kampung programme where local economy in the kampungs managed to be mover from subsistent level to market level successfully. Social capital is easier as education to high school level and health care is free years ago. The stress of the social capital is in generation the high quality of smart people through many ways, such as the provision of free wifi, broadband learning centers, etc. On the environment aspect, the emphasis is the making of eco kampung in wider term from bio diversity aspects to urban farming activities. Infrastructure in the kampungs is not a big issue as most basic infrastructure has been improved by the earlier Kampung Improvement Programme (KIP). The stress now on infrastructure is its connectivity to the city system and introducing innovative various waste recycling system that is environmentally friendly. On the governance term, the previous Comprehensive KIP has developed the community organisation based on the traditional working together model or gotong royong. 5 RESEARCH PROPOSE IN THE FUTURE Although the city government of Surabaya has developed the Wheel Model of Smart City, it still need to rearrange as well as better definition of each elements of the wheel as well as the elaboration in various sub-elements. On the one hand Surabaya has plenty and rich experience in the development in innovative of urban development, but there lack clarity in the system as well as how each element of the wheel work together with other element of the wheel. This is in great need in order to achieve a maximum and effective result beneficial to the large community in the city from top to bottom. 350 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES High, P. (2015) The Top Five Smart Cities In The World, http://www.forbes.com/sites/peterhigh/2015/03/09/the-top-five-smart-cities-inthe-world Giffinger (2007) Smart Cities Ranking of European Medium-sized Cities, Centre of Regional Science, Vienna UT, October 2007 Cohen. B, (2012), “What exactly is a Smart City?,” Internet: http://www.fastcoexist.com/1680538/what-exactly-is-a-smart-city, [Dec 13, 2015]. Di Carlo (2013) Smart City: an assessment model, SCE- People Centered Smart Territories, Bologna, 16 October 2013 BSI (2014) The Role of Standards in Smart City, Department for Business and Innovation Skills, UK BSI (2014) Making Cities Smarter, Guide for City Leaders: Summary of PD 8100, Department for Business and Innovation Skills, UK OVERVIEW ON ALLEY OF KAMPUNG AS SHARED-PLACE BASED ON THE INHABITANT RELATIONSHIP REFERENCES IN KAMPUNG OF SURABAYA Andarita Rolalisasi andarita.rolalisasi@gmail.com PhD candidate, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Happy Ratna Santosa happysumartinah@gmail.com Lecturer, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Ispurwono Soemarno isp4251@yahoo.com Lecturer, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract The empiric phenomenon shows that there are the shared-places in alleys of kampung. The alley function has expanded as shared-place for kampung residents. It is very significant for their social living because it is a place to gather among the inhabitants. The research objective is to understand the relations between built environment and human behavior, which in previous researches were discussed separately. The previous researches mentioned that the built environment and the human behavior influence one to another. To understand both, the research subject on built environment is an alley of kampung as shared-place and on human behavior is a human relationship among the kampung inhabitant. The research method is qualitative approaches that describe the alley of kampung as shared-place based on the inhabitant relationship. The locus of study is kampung of Surabaya. Keywords: alley, kampung, shared-place, relationship, inhabitant, Surabaya 1 INTRODUCTION The development of big cities in Indonesia has an impact on the settlements. Most of the housing developer builds housing in the suburbs. The other way around, most informal settlements (kampung) located in the city center. Informal settlements built by its inhabitants and these settlements grew along with the development of the city. Currently most of the kampungs which located at the town center turned into a business center that equipped by hotels, shopping malls, offices and apartments (Setijanti, 2008: 60). Silas Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 351 352 | Asea Uninet Scientific and Plenary Meeting 2016 (1988:1) and Setiawan (2010:6) mentioned that kampung has an important role that about two thirds of the Indonesia cities inhabitant living in which are mostly low-income households. The kampung is a living organism that is dynamic, growing and developing as an integral part of the city. The part of kampung is not just a physical system, but also a system of social, economic, and cultural which are complex and dynamic. According to these dynamics, the kampung is an important object of study in urban development in Indonesia (Setiawan, 2010: 8). Physical aspects of kampung consist of houses and support facilities, including alley, social facilities, public facilities and other supporting facilities. Most of kampung lack settlement supporting facilities due to high population density. Kampung open space is located outside the door of the house. It often has additional function as a social space (Setiawan, 2010: 9). Funo (1985: 8) also explains the importance of the social space of kampung. If this space is reduced in quantity and quality, it will affect the social life of the kampung inhabitants. Once of important element of the kampung is a tight relations among the inhabitants. This is showed on the high participation on communal activities, each are knows well their neighbors, and the communication among the inhabitant is well established. This is called the social capital (Jeannotte, 2003: 4) of kampung. Funo (1985: 7) stated that the kampung inhabitant have their own social systems such as mutual aid which is still exist until today and strengthen further the social capital of their lives. The context social capital here is the bonding which refers to the strong relationship between members of community groups (Burt, 1992: 59, Putnam, 2000: 231). 2 THE PROBLEM Kampung is an organic (un-planned) settlement. The houses built by the inhabitants themself. Most of kampung do not have a shared-space where the inhabitant can holds the communal activities. They often used a certain alley of kampung as a shared-place. The previous researches mentioned that the built environment affected the human behavior of community group. The research hypothesis is the other way around. It is the human behavior of kampung inhabitant that affects the shared-place and it happens at the alley of kampung. The objective of this study is to investigate the alley of kampung as a sharedplace based on the inhabitant activities. 3 THE FIELD RESEARCH The field research is conducted in Surabaya, Indonesia the capital city of East Java province. It is the second largest city in Indonesia with approximately 3.6 million inhabitants. The field study is urban kampungs in the northern part of Surabaya. The field research area have been existed since beginning of the 20th century (Faber, 1936: 161). This research assumed that the inhabitant is born here or at least living in the kampung from their childhood. The length of stay at the kampung is a representation how their undertanding the kampung. The field research represented the active inhabited kampung where there exist intense social interaction among members of community and also there are uniqueness of the alley as a shared-place of the kampung. Asea Uninet Scientific and Plenary Meeting 2016 4 4.1 | 353 THE LITERATURE REVIEW The kampung as an urban un-planned settlement The kampung is a typical urban settlement for low-income people where located in all parts of the city. The kampung is located in the suburbs of the city center which is part of an expensive area such as in the business area. Sihombing (2004) mentioned that the kampung is an unstructured settlement, unorganized settlement and has an informal socio-economic system. Thus it is often perceived that kampung is an urban settlement that has limited infrastructure, unplanned and without economic networks. Silas (1988) and Funo (1985) did not agree with this opinion. They stated that kampung is not squatter nor slum. Kampung is a community development concept, especially the development process done by the inhabitant itself. Kampung is not just about the physical aspect of settlement, but it is a community development process by the inhabitant to meet their shelter need (Silas, 1988). Kampung generally has a good community organization based on the vernacular values and cultures in Indonesia. As a pointed out, Gotong Royong (mutual aid) activities and Arisan (money saving system) are preserved even in urban kampung (Funo, 1985). Kampung is a unique urban settlement that provided 70% of the urban housing need for most middle low-income community (Silas 1988, Funo 1985). Kampung has multiple aspects. The first aspect is about housing provision for low-income people in inner city. The second is physical aspect, that people built the unplanned housing by themselves. The next is economic aspect that informal economic activities support the economics endurance of the city. The last is social aspect, it’s about development process of community who live in the kampung. Here resident help each other in their social life. The city gain benefits from the existence and all of various activities described above. 4.2 The Shared-place of Settlement Kampung is no barrier settlements (Sihombing, 2004). The houses in the kampung usually stand without ring fence. Open space outside the door is very significant in kampung life. It is used for various activities, cooking, playing, bathing, talking, etc (Funo, 1985). These activities are taking place at the alley of kampung that called a shared-place. The sharedplace where located at the alley formed by the relation between the socio-cultural activities, relation among the inhabitant, and the built environment itself (Sihombing, 2004). The existence of this shared-place is very limited but still exists because the thick relations among community members. This shared-place can be a real space and/or an abstract space. The alley of kampung is a real space when the place closed for the communal activities. The boundaries of real space are a row of the houses units and both end of the alley. It became the abstract space if the people able to do activities when the alley is still used as a passageway (Sihombing, 2004). As mentioned before, the alley of kampung as the shared-place is important for the social life of the kampung inhabitants. If this space is reduced in quantity and quality it will affect their social life. Markus (2003) and Low and Lawrence (2003) studied the settlement in USA. Marcus (2003) found that the shared outdoor space of settlement owned by the community group and this space usually accessible only by the group. The communal space is needed for place to interact with neighbors. The existence of shared-place of settlement that manageable and maintainable by the community group will provide an opportunity for them to be able to control their own built environment. Low and Lawrence (2003) stated that the social space of settlement is the process of individual experience through their group and personal relations. 354 | Asea Uninet Scientific and Plenary Meeting 2016 5 FINDING AND DISCUSSION 5.1 The Fields Research Overview The fields research that represented the kampung alley as shared-place based on the inhabitant relationship are Kampung Seng, Sidodadi, and Cantian. Figure 1. The Alley of Kampung Seng They has different characteristic of alley. Kampung Seng represented the high density urban settlement. The kampung orientation located at end of an alley where the various inhabitant activities take placed. There are three public buildings that two public toilets and the kindergarten building. The kampung alley as a shared-place influenced by the building/house function, the activities setting, and the presence of the food street vendors (See Figure 1). Figure 2. The Alley of Kampung Sidodadi Figure 3. The Alley of Kampung Cantian Asea Uninet Scientific and Plenary Meeting 2016 | 355 Kampung Sidodadi represented the urban settlement that has two orientations due to the activities center take placed. The orientations of kampung are both in the ends of alley. In addition, the kampung orientation also leads to the river that crossing in this urban settlement. Some the private gathering carried out on the river that covered by wooden boards (See Figure 2). At first glance, the kampung Cantian seem similar to kampung Sidodadi. But this kampung has only one orientation that located at one of the ends of alley (See Figure 3). Most of the buildings at the fields research are housing. Some buildings are housing where the economic activities exist. It’s called home based enterprises. They are catering, toys making, and boarding room. 5.2 The Alley of Kampung as a Shared-place From the field observation, it was found that there are two types of the shared-place where take placed at the kampung alley. They are a tangible place and an intangible place. The alley became a tangible shared-place when it is real, the existence of place can be seen and felt significantly. On the contrary, the kampung alley is an intangible shared-place it the place is un-real but its presence is deniable. An alley has at least three potential tangible shared-places. They are the terrace without fence, the junction of kampung alley, and the place where a fix-feature exists (see Figure 4 as follows). The terrace without fence is more attracted the inhabitant to get along together than the terrace house with fence. When there is junction inside the kampung area, than the junction potential as the shared-place. The feature on the research context is about something that plays important role at the formed process of alley as the shared place. The fix-feature is located fixed or did not change its location, such as the terrace of house, a fixseated, and stall. These fix-features ‘invite’ people to gather around them. The Terrace without Fence The Junction of Kampung Alley The Place Where There is a Fix-Feature Exist Figure 4. The Alley as a Tangible-shared Place The Alley as a Playground The Alley as a Domestic Activities Place 356 | Asea Uninet Scientific and Plenary Meeting 2016 The Economic Activities The Most Widely Part of Alley as a Communal Activities Place Figure 5. The Alley as an Intangible-shared Place The alley of kampung became the intangible shared-place due to the inhabitant activities that take placed at the alley. These activities are domestic, economic and communal (see Figure 5 above). The domestic activities carried out in the alley (in front of their house) are to parking motor bike, storage, cooking, drying, family gathering or celebration, and hosting. They are talking and chatting while doing their domestic chores at the alley. They will close the alley temporary as passageway when they held the family gathering. These activities allowed carried out in the alley because of the good relationship between the inhabitants, so their neighbors are not feel bothered. The communal activities are including national day and religious events, chatting and playing. The national day celebrations and religious events usually held at the widest part of alley. The children lack of playground, so all of part of the alley is the children playground. The economic activities did by the inhabitant itself and the street vendors. 6 CONCLUSION The fields research have different characteristic for more understanding about the alley of kampung as a shared-place based on the inhabitant relationship. The kampung alley has more function than just as a passageway. It is a shared-place that formed by the human activities relation in these space. The shared-place of kampung is the space of settlement which takes placed outside of housing, as a community social place, an inclusive shared placed, and formed by the activities together of community member. This space called the shared-place that means the place allowed be used by the community member group. It is represented the social interaction, a power symbol of a community group, and to meet basic human needs. The social relationship of community would be inconvenient while they has limited the shared-place of kampung. ACKNOWLEDGEMENT The research can be done with the help of several parties. First, greatly thank to the respondent of Surabaya kampung inhabitant. The kampung are kampung Seng, Sidodadi, and Cantian. The last, thank convey to my promotors, Mrs. Happy Santosa and Mr. Ispurwono Soemarno. Asea Uninet Scientific and Plenary Meeting 2016 | 357 REFERENCES Burt, R.S. (1992), Structural Holes: The Social Structure of Competition, Harvard University Press, Cambridge. Faber, GH-Von (1936), Nieuw Soerabaia, De Geschiedenis van Indie’s Voornaamste Koopstad in de Eerste Kwarteeuw sedert hare Instelling 1906 – 1931, Surabaya Funo, S (1985), Dominant Issues of Three Typical Kampungs in Surabaya and Consideration on Kampung Housing System, Studies of Transitional Process of Kampungs and Evaluation of KIP, Symposium Proceeding Peran Perbaikan Kampung Dalam Pembangunan Kota di Indonesia, Surabaya. Jeannotte, MS (2003), Just Showing Up: Social and Cultural Capital in Everyday Life, Strategic Research and Analysis, Canada. Low, SM, and Lawrence-Zuniga, D (2003), the Anthropology of Space and Place, Blackwell Publishing, Berlin Marcus, CC, (2003), Shared Outdoor Space and Community Life, Places Journal, 15(2), pp 32-40 Putnam, R (2000), Bowling Alone: The Collapse and Revival of American Community, Simon and Schuster, New York. Sihombing, A (2004), Conflicts in Public Open Spaces, The Ambiguous Images of Kampungs and Kota: Conflict or Difference?, Prosiding International Seminar of Managing Conflict in Public Spaces Through Urban Design, Program Magister Perancangan Kota, Universitas Gajah Mada, Yogyakarta Setiawan, B (2010), Kampung Kota dan Kota Kampung: Tantangan Perencanaan Kota di Indonesia, Professor Inauguration Speech, Universitas Gajah Mada, Jogjakarta. Setijanti, P (2008), A Reflection on the Structure of the Modern Kampung, Jurnal Architecture and Environment, Vol. 7 No.1 April 2008, pp 47-68. Silas, J (1988), The Kampungs of Surabaya, Surabaya Municipality, Surabaya. I-POP: MIMICKING K-POP AS THE ‘NEW’ GLOBAL S.M.Gietty Tambunan gietty.tambunan@gmail.com University of Indonesia Abstract The dynamic flow of Korean Wave, specifically K-Pop, has transformed the way South Korea is perceived in Indonesia. These music products have crossed the threshold of a variety of Indonesian mediascapes, especially social media, within the discourse of cultural globalization creating new spaces in imagining the ‘modern’ and the ‘global. This paper will exhaust the prism of this transcultural flow of popular cultural product, predominantly the product of idol girl and boy bands, and how it has become the base of the increasing number of the Indonesian version of girl and boy bands. Recreating an Indonesian version of K-Pop becomes an effort in seeking for alternative forms of the ‘global’ and the ‘modern’. This will then lead to the act of mimicry, as in the so called phenomena of “I-Pop” (a K-Pop mimic) with the blooming popularity of girl and boy bands in Indonesia appropriating, but most of the time imitating the Korean counterparts. These imitating products, like SM*SH, Cherrybelle, S4 and SOS, reflect an ambiguity on how consumers are consuming K-Pop. When some consumers completety despise this mimicing act, a large number of consumers are hysterically worshiping them as a substitute for the unreachable K-Pop artists. The new and alternative ‘global’ or ‘modern’ the consumer rearticulate from this cultural practices have become more complicated with this act of mimicry. The main research method is textual analysis with an aim of understanding the complexity of how meanings are produced through these mimicking music products in the context of cultural globalization in Asia. Keywords: K-Pop, I-Pop, Mimicry, Global and Modern 1 INTRODUCTION The dynamic flow of East Asian popular culture has transformed the way East Asia is perceived in Indonesia. In early 1990s, South Korean, Japanese and Taiwanese modernday television dramas entered the Indonesian mediascapesi, which was simultaneously followed by J-rock and K-pop as they invaded the Indonesian music scene. East Asian music products have been situated within the discourse of cultural globalization in Asia. Furthermore, the flow of these music products, particularly K-pop, has constructed an arena of imagining the ‘new’ and ‘alternative’ global, in comparison with music products from America. K-pop has travelled through contemporary forms of media circulation, such as social media, Facebook and Twitter, and video sharing technology of YouTube, which are contextually significant in Indonesia due to the growing dispersion of social media. This article will exhaust the prism of this transnational flow of music products from South Korea to Indonesia by highlighting the process of “cultural fusion and intertextual Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 358 Asea Uninet Scientific and Plenary Meeting 2016 | 359 reworking”ii of K-pop, predominantly the product of idol boy/girl bands. K-pop has facilitated a development of new music products in Indonesia, namely the phenomena of I-pop (a K-pop mimic), with the blooming popularity of boy/girl bands in Indonesia appropriating, but most of the time mimicking, the South Korean idol groups. These mimicking products, like SM*SH, Cherrybelle, S4, SOS and many others, represent an ambiguous process of how K-pop is consumed and reworked in the Indonesian context. On one hand, these Indonesian boy/girl bands are regarded as products of plagiarism. However, they need to be critically interrogated as products of cultural fusion and intertextual reworking of K-pop as the ‘new’ global, which is an alternative from the American music products. The main argument of this is article is how this new and alternative global the consumers ascertain in K-pop are being obscured by the intensification of I–popiii as mimicking products. 2 CONTEXTUALIZING GLOBALIZATION IN ASIA KOREAN WAVE IN ASIA “... since the 1980s popular culture products have criss-crossed the national borders of the East Asian countries and constituted part of the culture of consumption that defines a very large part of the everyday life of the population throughout the region. This empirically highly visible cultural traffic allows for the discursive construction of an ‘East Asian Popular Culture’ as an object of analysis.” To begin with, it is necessary to discuss how Asia has become a transnational space in which the flows of cultural products are rapidly increasing. The multiple connectivity of Asian cultural products’ flow has been analyzed in a number of studies investigating the circulation across national, geographical and geopolitical boundaries. These networks of production, distribution and consumption reflect the regional dynamics that connect spaces within Asia. Koichi Iwabuchi (2002) argues that the transnational flow of cultural products in connection with the regional connection in Asia could no longer be examined from a ‘West and Rest’ perspective. The media imperialism model, in which the Rest is expected to be the receiver or even the imitator, could not explain the complexity of the intra-Asia cultural traffic. Iwabuchi invites scholars to move beyond that model so that new research would be able to reveal more on the interconnection between the locals within the region and the “cultural fusion and intertextual reworking” of the transnational cultural products. Furthermore, it should be acknowledged that East Asian products, including Kpop, have been hybridizing local elements and American cultural influences for many decades. East Asian popular culture is not an essentialized materialization of East Asian culture because "… they are neither "Asian" in any essentialist meaning nor second-rate copies of "American originals." They are inescapably "global" and "Asian" at the same time, lucidly representing the intertwined composition of global homogenization and heterogenization …"v East Asian cultural products are the embodiments of “global” and “Asian.” They could not be simply categorized as an anti-thesis of Western cultural products. On the other hand, these East Asian cultural products are hybridized products, which no longer exemplify as Asian. To look at these cultural products as initially hybridized would reveal a more multifaceted understanding on their correlation with the cultural globalization process in Asia as it proliferated since the last few decades, especially 360 | Asea Uninet Scientific and Plenary Meeting 2016 with the prevalent Korean Wave phenomenon. Before going into the analysis, the discussion will start by looking at the development of Korean Wave in the Asian region. The expansion of South Korean cultural products flows was the consequence of the government’s unequivocal policies in promoting popular culture as an export industry. As explained by Shim (2008): “According to the Ministry of Culture and Tourism (2005), the total amount of Korean television program exports dramatically increased from US$5.5 million in 1995 to US$71.4 million in 2004. The Ministry of Culture and Tourism expects that broadcast program exports in 2005 will surpass the US$100 million mark.”vi Korean Wave or ‘Hallyu’vii was instigated by the export of television dramas. However, in its development, it has now included music, films, electronic products, fashion, cosmetics, or even lifestyles. “By the late 2000s, however, the driving force of Korean Wave – at times dubbed the Korean Wave 2.0 – seemed to have shifted to the rapid ascent of K-pop.”viii Nowadays, Korean pop music, or K-pop, has become the focal point of Korean wave in Asia as an outcome of technological development. One example is how major entertainment companies promote their artists in YouTube, which is economically more profitable and resourceful. To start with, K-pop was first recognized in South Korea in late 1990s. In 1996, SM Entertainment formed a group of five male singers and named them H.O.T., which is now considered as one of the first K-pop idol bands. This band was first featured in Channel V in the same year. Their album sales had reached 10 millions in Korea from 1996 to 2001. The band became popular even after it disbanded in May 2001. SM Entertainmentix would later on be the leading entertainment company in South Korea producing K-pop commodities. Afterward, other idol singers and bands began to have concerts all over Asia, such as in Beijing, Tokyo, and Hong Kong and often record their albums in the local languages before marketing their albums in the region, marking the first expansion of Korean wave in the Asian region. One of the most identifiable characteristic of K-pop is the “idol-making system and global marketing strategies” (Shim, 2008) and also the “star manufacturing system” (Shin, 2009). These strategies integrate the production process, such as in the training of talents, and also the management system. “The recent success of K-pop acts in Japan exemplifies the typical idol-making strategies of Korean entertainment companies which is mainly driven by capitalist desires. They do this firstly by adopting globally popular cultural elements from Japan and the US, then repackaging and manufacturing culturally hybridised products.”x It is through this idol making system that entertainment companies, driven by capitalist desire, manufacture and repackage K-pop products before circulating them to other parts of the world. In the production process, these entertainment companies train future idols in a long training period, which last from five to seven years. They are not only trained in singing and dancing, but also on how to be multiskilled entertainers. Other skills in the training program involve learning foreign languages, such as English, Chinese and Japanese, to appeal to fans in different countries, emphasizing its global characteristics. Besides manufacturing global idols, in the marketing strategies, entertainment companies have made the most of social media as resourceful platforms in dispersing K-pop. As mentioned earlier, one the most often used platform is YouTube. All three major companies – SM Entertainment, YG Asea Uninet Scientific and Plenary Meeting 2016 | 361 Entertainment and JYP Entertainment – have maintained official YouTube channels in English to promote their artists’ new music videos and concert clips targeting specifically non-Korean consumers. This online social media-driven pop circulation is an expression on how K-pop utilizes “… user-generated content Web sites to peer-to-peer networks, these channels now play a central role in global cultural circulation.”xi As the most common marketing and distribution tools for the entertainment companies, social media and video sharing platforms are crucial elements constituting Korean Wave as a global commodity, which needs to be taken into account in this discussion. Besides these marketing and distribution tools, another characteristic of K-pop is the standardized practice of ‘localization strategy’ in their overseas concerts. As an example, SM Entertainment has held SMTOWN Live, a joint concert of their artists, in many Asian countries. Each year, the company organizes their artists to come together and perform in a four to six hours long concert that tours around the world, such as in Tokyo, Seoul, Jakarta, Singapore and Bangkok. Besides joint concerts, idol groups also held group concerts sponsored by local promoters in cooperation with the South Korean entertainment company. In relation to the analysis, one of the biggest K-pop concerts in Jakarta was held in March 2013 as a part of the 40th anniversary of Indonesia’s diplomatic ties with South Korea. In a Jakarta Globe article (4 January 2013), Ronna Nirmala and Deti Mega noted that: “A string of Korean pop bands will perform in Jakarta this March to celebrate the 40th anniversary of Indonesia's diplomatic ties with South Korea. Super Junior and 2pm are reportedly among the K-pop bands that will perform as part of the 2013 Music Bank World Tour scheduled for March 9.” This concert has attracted over than 40.000 fans in Jakarta. One of the performances in this concert was a duet from Eru (K-pop singer-songwriter) and Hyorin (lead vocal in SISTAR) who sung an Indonesian song, Kemesraan, as one of the localization strategies as mentioned earlier. This localization strategy is how entertainment companies fabricate their artists for them to be acknowledged globally. It is a more significant strategy for the Indonesian market because of the language barrier, and this will be further elaborated as we now move to the analysis of K-pop’s distribution, consumption and reproduction in Indonesia. 3 KOREAN WAVE IN INDONESIA: FROM TELEVISION DRAMAS TO K-POP Korean Wave in Indonesia was initiated by the broadcasting of Korean dramas in early 2000. There was a significant shift to Korean television dramas from former popular ones from Japan and Taiwan. In 2001, one of the private Indonesian television stations broadcast Endless Love (also known as Autumn in My Heart) from Monday to Thursday, in prime time. The attractiveness of Endless Love opened up a barometer for a wave of popular culture products from Korea. Not long after, other Korean television dramas, such as All About Eve, Hotelier, Winter Sonata, Full House, Lover in Paris, Jewel in the Palace, and Princess Hours, were broadcast. The latest Korean television dramas captivating Indonesian audience are Boys Over Flowers, Dream High, 49 Days, City Hunter, Secret Garden and The Moon that Embraces the Sun. It is important to note that Korean television 362 | Asea Uninet Scientific and Plenary Meeting 2016 dramas have a longer life span in terms of popularity among Indonesian audience since 2002 until now in comparison to those from Japan and Taiwan. The popularity of K-drama has opened up the gate for other forms of cultural products to enter the Indonesian market, including K-pop. Recent television dramas have actually reinforced K-pop’s popularity in Indonesia for the reason that they targeted younger viewers. As argued by Shim (2011), Korean Wave experienced its turning point in 2009 when Boys Over Flower made a big hit in many Asian countries, especially in Indonesia. The new generation of Korean television stars comes from K-pop. In the following years, the attractiveness of K-drama in Indonesia often overlaps with the recognition of K- pop as more idols star in popular dramas. One example is Dream High 1 (2011), which features Bae Suzy, the main vocalist of Miss A, Ok Taecyeon, a member of 2 PM, Lee Ji-eun or more known with her stage name IU, who debuted as a singer in 2008, and other K-pop idols. Dream High 1, which tells a story about students in Kirin High School as they trained to be K-pop idols, was first broadcast in Indonesia in July 2011 and then a rerun in 2012. One of the reasons for its high popularity was because of the castings. This overlapping development of K- drama and K-pop in Indonesia is a representation on how Korean Wave has infiltrated many realms of popular culturexii in order to expand its global flow. Furthermore, within the revitalization of K-pop in Indonesia, there has been a significant demographic change in its fandom. Nowadays, most Indonesian K-pop fans are in their teen years. However, there are also fans in their early 30s or even early 40s, which have been consumers of Korean television dramas since its first development in Indonesia in early 2000. For the younger generation, K-pop is considered as cool and modern, and more importantly as the ‘new global.’ “With youth fan groups as the backbone of the phenomenon, K-pop – predominantly the product of idol girl and boy band music – has also gained recognition in Indonesia; in 2010, over 120 fan-operated K-pop related events were held, including fan gatherings and Korean pop festivals and concerts.”xiii K-pop appears to offer something that the younger consumers could not obtain from local popular culture products or from other countries, such as American products. K-pop’s presence in Indonesia is stimulated not only by the economic motivation from the Korean entertainment industry but it is also shaped by consumers’ behaviours in looking for multiple entertainment experiences. Jung (2011) argues that in Indonesia, Kpop’s popularity last longer because of “… the intersection between capitalist desires of the Korean entertainment business sector, the globalized desires of the Indonesian media industry, and the local audiences’ desire for cool, modern pop cultures.”xiv On one side, the Korean entertainment industry seeks out market possibilities to sell and distribute their products. For the Indonesian media industry, there is a desire to be globalized and South Korean popular music products offer a new kind of global as an alternative from the ‘global West.’ However, the Indonesian consumers also play an important role in shaping the K-pop phenomenon as they actively make sense of this music product. The enthusiasm and fanatic following of K-pop idols in Indonesia does not only reflect the increasing popular existence of K-pop, but it is also a form of participatory consumption. Fandom does not signify a one-way process from the consumer to the products. There have always been interconnections between the production and marketing process with the consumption practice. One of these interconnections is in the strategies used by the entertainment companies to disperse their products. These strategies could be Asea Uninet Scientific and Plenary Meeting 2016 categorized as specific transnational products. characteristics of K-pop differing | 363 from other In its transnational flow to other countries in Asia, K-pop has developed “crossbordering characteristics,” as argued by Siriyuvasak and Shin (2007). The diffusion of Korean popular music to other parts of Asia is significantly affected by the rapidly changing music industry and technology. As explained earlier in this article, the institutionalization of a standardized practice such as the idol-making system by South Korean entertainment companies is one of the changes that have transformed the way Kpop cross the borders in Asia. As a culturally specific product, for example how it is mostly presented in Korean language, K-pop needs to have cross-bordering characteristics to guarantee that it will be able to enter other countries. “It is a familiar process in making cross-cultural products accessible and meaningful to the local audiences. Dubbing of movies or television program is a case in point. Music itself is a language with a special characteristic that deterritorializes cultural boundaries.”xv Even though music, as argued by Siriyuvasak and Shin, echoes as a universally accessible product, in order to maximize its market possibilities, it needs to be ‘translated’ to the targeted market’s language. By mixing the language, these cross-cultural products are more accessible for consumers in other countries. In the production process of the idols’ training program, they regularly need to learn English or a second Asian language. As a result, they would not only able to sing in other languages, but also to communicate with the fans during their concert tours by using the fans’ mother tongue. These cross-bordering characteristics, such as the mixing of languages, are not only strategies to popularize K-pop in the local markets, but also resonance the shift in music production. It highlights the comodifying aspect because it creates a multiple sense of authenticity, when a song could be sung in different languages. Mixing the languages is not only considered as an act of localization or hybridization. Changing the language of the songs is actually denationalizing k-pop. It should be examined as a part of the cross-bordering characteristics, which have shaped up the formulation of K-pop when it flows from South Korea to other parts of Asia. As argued earlier in this article, K-pop is an initially hybrid product. It is Korean yet Americanized at the same time. The strategies done to ensure its cross- bordering capability would then raise the question on what constitute K-pop as a transnational or even global product. In other words, what make these music products to be labelled as K-pop when the specificity of Korean-ness, such as the Korean lyrics, is being reduced? Furthermore, it has also affected the inter-textual reworking of K-pop in connection with other music scenes in the country of consumption. In Indonesia, K-pop has manifested itself not only in the scope of production and consumption, but also in the reproduction of another music format, which is called I- pop. What kinds of K-pop characteristics do these I-pop music products have, which make them a K-pop mimic? The discussion will now move on to conceptualize how, through the development of I-pop, the ‘new’ global in Kpop is being reproduced in the Indonesian context. 4 I-POP: A K-POP MIMIC In October 2010, the boy band SM*SH, which is an abbreviation of Seven Men as Seven Heroes, debuted its first single entitled “I Heart You” becoming the first wave of Ipop boy/girl bands phenomenon in Indonesia. Soon after, a number of boy/girl bands 364 | Asea Uninet Scientific and Plenary Meeting 2016 debuted in Indonesia sharing similar characteristics with their Korean counterpart. The term I-pop is a portmanteau of Indonesia and K-pop implying that these music products are carbon copies of K-pop. The reactions toward these boy/girl bands are mixed between acceptance and resistance. The resistance even claims that I- pop is a product of plagiarism. However, the question to be asked is not how plagiarism works in the formulation of I-pop. A more urging question is how the flow of K-pop products in Indonesia brought about these new music products, such as SM*SH and other boy/girl bands. What kind of new and alternative global the consumers ascertain in K-pop and how are they being obscured with this recent development of I-pop? I-pop has indeed amalgamated into the Indonesian music scene even though there is a strong resistance from Indonesian consumers. As reported by Arientha Primanita in a Jakarta Globe article (22 November 2012), the Tourism Minister, Mari Elka Pangestu, speaking at the Indonesia Creative Products Week (PPKI), pointed out that Indonesia’s creative industry would be able to craft I-pop as an innovative commodity. The minister also emphasized on how I-pop songs would model K-pop songs in an Indonesian flare. The idea that Indonesia is able to have a product that could compete with K-pop, a new global music product, is tantalizing, especially for the development of creative industry in Indonesia. However, as mentioned by the Tourism Minister, there is a demand for a more ‘authentic’ I-pop with a ‘localized’ flavour. This emphasis on authenticity and locality is obscure because K-pop itself is a non-authentic product, which has also been argued earlier in this article, as it is with other music formats in Indonesia. xvi Sen and Hill (2000) make a case that music in Indonesia is never free from external influence because it has always been a “syncretic” product. “Indigenisation of xvii foreign music started long before contemporary ‘world music’ or ‘globalization’ …” Since the beginning of music development in Indonesia, foreign music influences are significant elements in local music productions. Nonetheless, there has been an ambiguous relationship between local and non-local elements in Indonesian music. For example, in xviii the Old Order era, Sukarno’s rejection of rock music became a stimulus for a more nationalistic Indonesian pop music. It stimulated a search for indigenous musical forms to be transformed into contemporary youth music. At that time, bands revived old songs in contemporary style. “The famous keroncong standard, ‘Bengawan Solo,’ was rendered in a rock style with a twelve-bar interlude and Elvis-style singing.”xix Another example is Dangdut, being promoted as ‘the authentic music of the Indonesian people,’ had always been arbitrated by its recognized inheritance from Bollywood film music from India. In other words, most music genres in Indonesia are in essence “hybrid and transxx medium.” This historical background of Indonesian music growth outlines the hybrid nature of music in Indonesia, which negates the essentialist notion of authentic Indonesian music. Having said that, an analysis on recent development of I-pop must not only scrutinize the aspect of plagiarism because it would only pore over what is considered as authentic and local in I-pop. Seeing that I-pop is a reaction and reproduction of K-pop, what need to be examined are the elements that constitute I- pop, which could also be identified in K-pop. The aim is to look at how I-pop reworks the cross-bordering characteristics of K-pop and how in this process, we can see what cultural effects K-pop as the ‘new’ global alternative wreak on the Indonesian popular music scene. There are two main developments of I-pop to be highlighted in this discussion, which are the earliest wave in 2010-2011 (SM*SH and Cherrybelle) Asea Uninet Scientific and Plenary Meeting 2016 | 365 and the latest ones, which would be categorized as the made-in-Korea version of I-pop (S4 and SOS). The four boy/girl bands mentioned are examples from each stages of development. They are considered to be the most representative in terms of popularity and recognisability. The first two, SM*SH and Cherrybelle, are the earliest K-pop ‘look and sound-alike’ groups, which receives a lot of resistance from the Indonesian consumers. These two groups are produced by local media entertainment companies. Meanwhile, S4 and SOS are groups formed, trained and produced by a local entertainment company in cooperation with a South Korean music agency, emphasizing the made-in-Korea distinctiveness. The discussion will now focus on the characteristics of these two waves of I-pop as they resonate Kpop’s global and cross- bordering characteristics. Initially, the first wave of I-pop, represented by SM*SH and Cherrybelle, has received both a variety of acceptance and resistance from the Indonesian consumers because they are either an accessible substitute of K-pop or a product of plagiarism. For those who accept these boy/girl bands, they are satiated with the more reachable version of K-pop. The acceptance of these I-pop products is exemplified in the formation of fan-bases after the two groups debuted in 2010 and 2011. Both groups have their own fan-bases, which are SMASHBLAST for SM*SH fans (www.smash- blast.com) and TWIBI for Cherrybelle fans. These fan bases utilize a number of social media networking, such as Facebook and Twitter as a virtual space for followers and fans. Conversely, for most K-pop fans, SM*SH and Cherrybelle are alleged to have imitated and mimicked K-pop groups excessively. Besides being used for expression of admiration toward these boy/girl bands, social media is also used to express resistance. For example, K-pop fans in their personal blogs, discussion forums or comments section on the groups’ YouTube videos claimed that SM*SH first single, “I Heart You,” is a copy of a song by a South Korean hip-hop band, 1TYM.xxi Another accusation of plagiarism was directed toward the girl band, Cherrybelle, which consists of nine members and debuted in 2011. Their song, Best Friend Forever, is alleged to be a copy of one SNSD’s song (“Kissing You”), especially in the refrain. Fans and haters have expressed their opinions in social media and other forms of social networking, which reflect the digital aspects of both I-pop and K-pop. There are “Anti SM*SH” or “Anti Cherrybelle” pages on Facebook. Fans and haters have also made the most of YouTube in order to express their opinions. There are YouTube videos about the groups’ plagiarism. One could enter the groups’ names and the word “plagiat,” and there would be a large number of videos comparing SM*SH or Cherrybelle’s songs with the ‘original’ K-pop songs and music videos. Fundamentally, haters are accusing these two groups seeing that they copy songs, music videos, dance movements or even the packaging (fashion, hair style, make up, media promotion) of K-pop boy/girl bands. As argued earlier, social media and video sharing platforms have played an important role in the development of I-pop, either in its acceptance or resistance. After analysing the two groups, it could be concluded that there are two main elements of K-pop being reworked by SM*SH and Cherrybelle, which are ‘image’ and ‘music.’ Both have been repackaging K-pop’s image and music in order to look and sound like the South Korean idol bands but with a ‘speed-up’ idol making system. SM*SH, before their debut in April 2010, went through a five months training camp under their production company, Starsignal. The members 366 | Asea Uninet Scientific and Plenary Meeting 2016 were recruited through networking from one member to another, until they finally have seven members. All members have different backgrounds and most of them do not have prior music careers. Cherrybelle members were also trained in a couple of months (no information on how many months exactly) after an open audition. Each member claimed that they received an open invitation on BlackBerry Messenger about an open audition happening in Kelapa Gading area in Jakarta, Indonesian capital city. Out of the 400 girls who showed up, nine were chosen to form the group. The chosen members also do not have a lot of experience in the music industry. This speed-up formation of the group and the lack of music background counteract the K-pop idol making system, which prepares the idols in a long training time while augmenting their singing, dancing and other entertaining skills. In spite of this, the early generation of I-pop focused more on another aspect of the idol making system, which is the fabrication of images. A palpable characteristic of SM*SH and Cherrybelle, which enunciates a K- pop zest, is the standardized practice of idol fabrication. Soon after they release their debut singles, both groups could be seen in all kinds of media format. They became spokespersons for a number of products. SM*SH members starred in their own television drama (Cinta Cenat Cenut, 2011) and Cherrybelle had a television reality show (Chibi Chibi Burger, 2012). By using all of these media formats as promotion and marketing tools, there is a process of image fabrication. Group members are made into idols through how they look, which highlight the similarities with K-pop idols. The necessity to make them look like K-pop idols are shaped through the aforementioned multiple media formats. Furthermore, the image of a group is kept on accentuated as most of these media promotions focus on the group and not on individual members. Conversely, the latest generation of I-pop takes the standardized practice of idol making system to a different level by emphasizing on the ‘Korean-ness’ of these Ipop groups. The discussion will now focus on the joint production of Indonesian and South Korean entertainment companies in establishing two most recent I-pop groups: S4 and SOS. As mentioned earlier, these two groups could be categorized as made-in- Korea I-pop products. The boy band, S4, was formed from the winners of Galaxy Superstar, a reality show in one of the local television station in cooperation with a South Korean music agency. The reality ‘talent’ show was produced by the Indonesian YS Media Entertainment and the winners of the show were sent to Seoul to go through an 8 months training camp by Rainbow Bridge Artist Agency, one of K- pop training agencies in Seoul, South Korea. S4 became one of the first Indonesian boy band trained in South Korea, with an excessive training process like the one experienced by K-pop idol groups, even though within a shorter period of time. The members also experienced physical transformation. One of the members lost twenty kilos in the training camp. They dyed their hair and changed their fashion style, which make them look unerringly like K-pop idols even though they are Indonesians (as shown by the screenshots from their music video in their official YouTube page). Asea Uninet Scientific and Plenary Meeting 2016 | 367 (Screen shoots of S4’s 1st music video, taken from Superstar4Official YouTube page) Besides their appearances, S4 were trained to sing in Korean and learned basic Korean phrases. As reported by Budi Suwarna in a Kompas article (27 January 2013), the four members would use their Korean greeting style as they meet reporters or fans. They would bow down and say “Annyeong Haseyo!”xxii This intensification of Korean-ness in their greetings and how they learned to sing in Korean echo a different form of articulating Kpop elements in this newest I-pop product. Compared to earlier I-pop groups, S4 amalgamates the actuality that they are made in Korea. If the male winners became S4, the female winners from the same reality ‘talent’ show became members of a girl band named SOS, which also has the same made-in-Korea distinctiveness. The group members also went through a yearlong intensive training in Seoul with the same training agency as S4. They debuted their first single a few months after S4’s debut in 2013. The entertainment company, in cooperation with the South Korean agency, fabricated a similar idol making system with S4. SOS members are transformed to look and sound exactly like K-pop idols, as shown in the screenshot from their music video bellow: 368 | Asea Uninet Scientific and Plenary Meeting 2016 (Screen shoot of SOS’s 1st music video, taken from SOSisofficial YouTube page) The music video was directed by a South Korean director, their debuted single was written by Seo Yong-bae, a famous song writer in South Korea, and the dance movement is choreographed by the same choreographer of Hyunaxxiii Altogether, SOS, just like S4, is fabricated to be an I-pop product with a more distinctive Korean characteristics. 5 CONCLUSION From the discussion of the 1st wave of I-pop boy/girl bands and the latest ones, there are similar traits, which could be categorized as global and cross-bordering characteristics of K-pop identifiable in the development of I-pop. For the most part, the idol making system in which each boy/girl band is fabricated through multiple media activities resonates the K-pop idol making system, even though the Indonesian one is done within a shorter time period. It is not only about the music, but more importantly the process of making the members as idols. What make up the complete idol package are not only their songs, but also their dance ability, fashion style, and even their manner of greeting people, such as S4’s greeting manners. The idol making system, which is the key element in K-pop, has infiltrated the Indonesian music scene in producing the mimicking products, I-pop. However, there is also a significant distinction between the two waves of I- pop. S4 and SOS are products that actually accentuate their Korean-ness since they are joint productions of Indonesian and Korean entertainment companies. This latest development of I-pop focuses more on making the boy/girl bands to be more Korean compared to the earlier ones. Earlier groups are claimed to be products of plagiarism as their songs, dance movements and music video composition look and Asea Uninet Scientific and Plenary Meeting 2016 | 369 sound like K- pop. However, S4 and SOS mimic K-pop in a distinct ‘Korean’ way in the sense that the members trained in Seoul, transformed physically to look precisely like K-pop idols, sing some songs in Korean and use Korean language to greet their fans. In the development of I-pop, it could be concluded that there are two different yet comparable ways in mimicking K-pop highlighting different aspects of the cross- bordering characteristics. Earlier waves of I-pop have reproduced K-pop products by making carbon copies of the songs, dance movements and also the construction of idols. However, for its later predecessor, it is more significant to enhance the Korean- ness of their products. As entertainment companies fabricate different ways of mimicking K-pop, it also reflects the elements that constitute K-pop as a new global product. By utilizing these elements, I-pop is a result of a cultural fusion and intertextual reworking of K-pop that could not be simplified as solely products of plagiarism. I-pop has reworked the idol making system and standardized practices of the South Korean popular music scene as it mimics the ‘new’ global in K-pop. BIBLIOGRAPHY Appadurai, A. (1996). Modernity at Large: Cultural Dimensions of Globalization. Minneapolis, MN: University of Minnesota. Chua, B.H. (2004). Conceptualizing an East Asian Popular Culture. Inter- Asia Cultural Studies 5.2, 200-221. . (2010) Korean Pop Culture. Malaysian Journal of Media Studies Vol.12 No.1, 15-24. Baulch, M. (2010). Music for the Pria Dewasa: Changes and Continuities in Class and Pop Music Genres. Journal of Indonesian Social Sciences and Humanities Vol. 3, 99-130. Iwabuchi, K. (2002). Recentering Globalization: Popular Culture and Japanese Transnationalism. Durham: Duke UP. (2010). De-Westernization and the Governance of Global Cultural Connectivity: a Dialogic Approach to East Asian Media Cultures. Postcolonial Studies Vol. 13 No. 4, 403-419. Jung, S. (2011). K-pop, Indonesian Fandom, and Social Media. Transformative Works and Cultures 8, 1-28. Jung, S. & Y. Hirata. (2012). Conflicting Desires: K-pop Idol Girl Group Flows in Japan in the Era of Web 2.0. Electronic Journal of Contemporary Japanese Studies, Vol. 12 Issue 2 Article 8. Kim, Y. (2007). The Rising East Asian ‘Wave’: Korean Media Go Global. In D. K. Thussu (Ed.), Media on the Move: Global Flow and Contra-flow (pp. 135-152). London: Routledge. Lie, J. (2012). “What Is the K in K-pop? South Korean Popular Music, the Culture Industry, and National Identity.” Korea Observer Vol. 43, No.3, 339-362. Lim, T. (2008). Renting East Asian Popular Culture for Local Television: Regional Networks of Cultural Production. In C. Beng Huat and K. Iwabuchi (Eds), East Asian Pop Culture: Analysing the Korean Wave (pp. 33-51). Hong Kong: Hong Kong UP, 2008. Sen, K. & D. T. Hill. (2007). Media, Culture and Politics in Indonesia. Jakarta: Equinox Publishing. Shim, D. (2008). The Growth of Korean Cultural Industries and the Korean Wave.” In C. Beng Huat & K. Iwabuchi, East Asian Pop Culture: Analysing 370 | Asea Uninet Scientific and Plenary Meeting 2016 the Korean Wave (pp. 15-31). Hong Kong: Hong Kong University Press. . (2011). Waxing the Korean Wave. Paper presented at the ARI ASIA TRENDS SERIES, Asia Research Institute, Singapore, June. Shin, H. (2009). Have you Ever Seen the Rain? And Who’ll Stop the Rain?: the Globalizing Project of Korean Pop (K-pop). Inter-Asia Cultural Studies 10:4, 507-523. Siriyuvasak, U. & S. Hyunjoon. (2007). Asianizing K-pop: Production, Consumption and Identification Patterns among Thai Youth. Inter-Asia Cultural Studies 8.1, 109-136. i The mediascape is one of five dimensions of the social imaginary (ethnoscapes, mediascapes, technoscapes, financescapes and ideoscapes) as argued by Arjun Appadurai in Modernity at Large: Cultural Dimensions of Globalization (1996). Appadurai notes two main characteristics of mediascapes: “the distribution of the electronic capabilities to produce and disseminate information,” and “the images of the world created by these media.” ii Koichi Iwabuchi, who has worked on regional cultural flows in Asia focusing on Japanese popular culture, argues that the regional connection in Asia through these transnational flows of cultural products should be analyzed not from a “West and the Rest” perspective. The media imperialism model, in which the Rest is expected to be the receiver or even the imitator, could not explain the complexity of the transnational flow in Asia. He invites scholars to move beyond that paradigm so that new research could reveal more on the interconnection between the locals within the region or what Iwabuchi argues as the “cultural fusion and intertextual reworking” of these popular culture products from East Asian countries. iii I-pop is not to be mistaken with Indonesian Pop. Indonesian pop music today is heavily influenced by trends and recordings from many parts of the world, such as USA, UK, and also other Asian countries. In recent years, Indonesian style of pop music has also influenced and been influenced by the regional pop culture in Southeast Asia. For example, in late 2000, the Malaysian pop scene that began to imitate the Indonesian style of pop music and vice versa. Traditionally, Indonesian pop has always been associated with foreign music. However, over the period of time, it has gradually assumed the mantle of ‘local music.’ “Although pop Indonesia musicians continue to cite AngloAmerican acts as sources of inspiration, in the minds of many pop Indonesia consumers, the genre has nothing to do with the West. It is produced in Jakarta, for a national audience, and most often sung in Bahasa Indonesia.” Emma Baulch. “Music for the Pria Dewasa: Changes and Continuities in Class and Pop Music Genres.” Journal of Indonesian Social Sciences and Humanities Vol. 3 (2010): 114. iv Chua Beng Huat, "Conceptualizing an East Asian Popular Culture." Inter-Asia Cultural Studies 5.2 (2004): 202. v Koichi Iwabuchi. Recentering Globalization: Popular Culture and Japanese Transnationalism. (Durham: Duke UP, 2002), 16. vi Doobo Shim. “The Growth of Korean Cultural Industries and the Korean Asea Uninet Scientific and Plenary Meeting 2016 | 371 Wave.” in East Asian Pop Culture: Analysing the Korean Wave, edited by Chua Beng Huat and Koichi Iwabuchi. (Hong Kong: Hong Kong UP, 2008), 27. vii “The spread of Korean popular culture overseas is referred to as the ‘Korean Wave’ or ‘Hallyu’ - a term coined by Chinese news media in the middle of 1998 to describe Chinese youth’s sudden craze for Korean cultural products.” Youna Kim. “The Rising East Asian ‘Wave’: Korean Media Go Global,” In Media on the Move: Global Flow and Contra-flow, edited by Daya Kishan Thussu, (London: Routledge, 2007), 135. viii John Lie. “What Is the K in K-pop? South Korean Popular Music, the Culture Industry, and National Identity.” Korea Observer, Vol. 43, No.3 (2012): 352. ix “SM Entertainment and YG Entertainment were established in 1995 and 1996 respectively, followed by JYP Entertainment in 1997. These entertainment companies carefully design and produce idol groups based on the strategic ‘idol-making system’ …” Sung Jung and Yukie Hirata. "Conflicting Desires: K-pop Idol Girl Group Flows in Japan in the Era of Web 2.0” Electronic Journal of Contemporary Japanese Studies Vol. 12 Issue 2 Article 8 (2012), 6. x Jung and Hirata. "Conflicting Desires,” 6. xi Sung Jung. "K-pop, Indonesian Fandom, and Social Media." Transformative Works and Cultures 8 (2011): 2. xii In an effort to introduce Korean language and culture to Indonesians as well as to meet the demand from Indonesian fans of the Korean Wave, the Korean government has opened its first Korean Cultural Centre in Jakarta in 2011. The centre’s library has a collection of about 1,500 books on Korea both in Korean and English languages. It also has a range of DVDs on Korean dramas and “Hallyu” stars. (Website: http://id.korean-culture.org/) xiii xiv xv Jung, “K-Pop, Indonesian Fandom,” 6. Jung, “K-Pop, Indonesian Fandom,” 7. Siriyuvasak, Ubonrat, and Shin Hyunjoon. "Asianizing K-pop: Production, Consumption and Identification Patterns among Thai Youth." Inter-Asia Cultural Studies 8.1 (2007): 117. xvi “ . . . satellite and digital technologies, and the related financial integration of the world, have made it infinitely more difficult to keep foreign cultural products outside national media borders . . . This is not a simple quantitative change – that more films or books now enter the country. The change is multi- dimensional – more media products cross national borders, from more directions and enter a nation at many more ports and terminals (in the new double sense of those words).” Krishna Sen and David T. Hill. Media, Culture and Politics in Indonesia, Jakarta: Equinox Publishing, 2007, 13-14 372 | Asea Uninet Scientific and Plenary Meeting 2016 xvii Sen and Hill. Media. 165. xviii Sukarno was the first Indonesian president from 1945 – 1967. He was the leader of Indonesia’s struggle for independence from the Netherlands. His presidency period is known as the Old Order era. This name was used in contrast to the next presidency period, which was the New Order era under President Suharto who started his regime of power in 1966. Suharto used the term “New Order” to contrast his rule with that of his predecessor, Sukarno. The term "New Order” in more recent times has become synonymous with the Suharto years (1965–1998). xix xx Sen and Hill, Media, 166. Sen and Hill, Media, 176. xxi This hip hop band debuted in 1998 and the song claimed to be copied by the Indonesian boy band, SM*SH, was in their 2003 album ONCE N 4 ALL “1TYM consists of four members, Teddy, Danny, Baekyoung, and Jinhwan, whose writing, producing and choreography talents contributed to the group’s success. 1TYM are one of the pioneers of Korean hip-hop. Since their debut, the members of 1TYM have gone on to be recognized for their individual talents through the projects that each member has been involved in.” “http://www.ygfamily.com/artist/About.asp?LANGDIV=E&ATYPE=2&ARTIDX=7 xxii xxiii A formal greeting to say “hello” in Korean. Kim Hyuna, known as Hyuna, is a member of the Korean girl group 4Minute , the duo Trouble Maker under Cube Entertainment and also a solo singer. She was a member of Wonder Girls before she moved to Cube Entertainment in 2008. Author’s Bio: Shuri Mariasih Gietty Tambunan is a lecturer in the English Department, University of Indonesia. Her research areas are on transnational movements of cultural products, specifically in Asia within the field of Cultural Studies. Her PhD research focus in the Cultural Studies Department, Lingnan University, HongKong, was about the transnational flow of East Asian television dramas in Indonesia within the context of cultural globalization. She has also done a number of research on intra-regional cultural traffic, such as the flow of Bollywood or Hindi films in Indonesian film culture. Currently, she is conducting a research, under the University of Indonesia’s research grant, on identity and culinary practices. COULD TOLERANCE BE THE PROBLEM’S SOLUTION? Dewi Sikiani dewi.sikiani@gmail.com Eunike E. Hiandarto Hutri Dhara Sasmita Yohanes K. Herdiyanto David Hizkia Tobing Center for Health and Indigenous Psychology (CHIP), Udayana University, BaliIndonesia Abstract Non-local resident means an individual who went away from his country to new country or island (Poerwadarminta in Nasution, 1997). The conflict that arises between non-local and local resident frequently become the cause of problems. According to Luthans, and Hodgetts & Altman (in Wijono, 2011) conflict between individual as called interpersonal conflict is a conflict that has more chance to be seen in a relation between individual. A solution for conflict between non-local and local resident is tolerance. In this study, the method that researcher use for collecting datas was interview. The subject in this study are two female from Bima, non-Balinese and non-Javanese, Moslem, single, high school graduated, and settled in Denpasar. Paradigm that being used in this study was natural paradigm that comes from phenomenological’s approach. This study’s result are tolerance is one of the solution that can be used if a conflict happened for subjects. The purpose in this study are minimize the level of conflict between the resident of Bali and resident of Bima and produce higher level of peace in order to achieve the harmonious society. The causes of tolerance are misperception, language, and religion. The form of tolerance that being shown from subject consist of two forms such as positive –which is discussion– and negative –which is apathetic. There are two impacts from tolerance which are adaptation and mutual respect. Keywords: tolerance, local resident, non-local resident, culture, conflict 1 BACKGROUND Indonesia has plural society that can be seen from the diversity of ethnic group, race, religion, and group. Population consus in 2010 shows 1.340 different ethnic group in 34 provinces. One of the province in Indonesia, Bali, based on population consus in 2010 has 2.890.756 resident that consist of 3.247.283 Hindus, and 64.373 Moslems, Christians, Buddhist. The amount of migration in Bali in 2010 is 406.921 resident. This amount caused by many motives which are employement, education, or tourism. The unemployement rate in Bali based on population consus in 2014 is 1,90 % and the minimum wage based on Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 373 374 | Asea Uninet Scientific and Plenary Meeting 2016 province in Bali is Rp. 1.542.600,-. Bali has four Government University and 58 Nongovernment University that can provide the education for its resident. The tourism in Bali can be seen by the amount of visitor arrivals at Ngurah Rai Airport in 2014 was 3.73 million visitors. Type of people that live in Bali can be divided into two groups which are local resident and non-local resident. Non-local resident is an individual that went away from their own country and start to live in another island or country (Poerwadarminta in Nasution, 1997). Naim (in Aprianti, 2012) makes six main factors for a non-local resident which are they left their home and their city; they left because their own desire; long or short time period; they left for make a living; study or looking up for experience; they want to get back; and they define wandering as a social culture. This caused non-local resident in Bali define as non-local resident from other places with different value and culture that living in Bali for now. One of the non-local resident’s city is Bima, Nusa Tenggara Barat (NTB). Bima has 443.663 resident from population consus in 2011. Based on the six main factors, young age non-local resident from Bima came to Bali for study and they plan to go to Bima after they finished their study. Many non-local resident come to Bali and would increase the probability of conflict. Conflict between non-local resident and local resident could be arise and cause by another problems. KBBI defines conflict as a dispute between two parties. When the cultural conflict can be define as a rivalry between two group of society that has culture similiarties. Based on Putman and Pool (in Wijono, 2011) conflict can be define as the interaction between individual, group, or organization that makes the opposite meaning or aim, and there was an assumption to the other part was the potential disturb for their aim. Mullins (in Wijono, 2011) said conflict as the condition when there was inconsistency in purpose that caused by any disagreement behaviors, this could be happen in individual, group, even organization. According to Coleman (in Liliweri, 2005), conflict could be differ by the problem. Coleman made two different between accident that could be a result of conflict or area of life they affect. This area could be happened by (1) economy-industry biased in factorylocated resolution in city, (2) different and unsuitable income tax, (3) power and authority, (4) different value in culture and belief, and (5) attitude from some people or group to different people of group. Luthans, Hodgetts, and Altman (in Wijono, 2011) divided conflict into some groups which are (1) conflict in the internal individual; (2) conflict between two person; and (3) conflict in organization. Conflict between two person or interpersonal conflict is a conflict that has more chance to shown in a relation between individual. Many factors could cause interpersonal conflict which are misperception, misopinion, misunderstanding, miscommunication, goal difference, value difference, culture background difference, social-economic, and personality traits. Conflict that happened to non-local resident in Bali mostly caused by different cultural values as can sees from the conflict that reported by Social Berita. On September 18th 2015 there was a clash between young adult non-local resident that come from Bima with one of the major mass organization as called Ormas (Organisasi Massa) in Bali. This caused two wounded victims found. Wisnu Wardana, Head of West Denpasar Police, said that the beginning for this conflict could highly assumed as misunderstanding between each parties (Sulaiman, 2015). Conflict that happened might take a cost like term of the deaths, but to maintain the peace between non-local resident and local resident in Bali, a right solution is needed to solve the conflict. KBBI defines tolerance as an attitude of toleration; a limit measurement for increase or decrease that still allowed. This research use a form of toleration based on Asea Uninet Scientific and Plenary Meeting 2016 | 375 research by Yusuf (2002) which is divide tolerance into tolerance in religion and social. Therefore, tolerance defines as a form of response to conflict where the individual do a contribution to maintain the peace with the diverse society without sacrifice their own value. Based on the explanation before, researcher makes a formulation of problem about the concept of a right method to solve a conflict based on non-local resident in Bali. 2 METHOD This research use interview method for collecting the data from subjects that become a research samples. The interview held twice with each subject in a different times and place with two subjects. This in interview used guideline that consist of question about concept of conflict’s solution based on perspective newcomers from Bima. Datas and information from subject has been collect in audio and verbatim format. In this research, main data source came from words and behavior shown by subjects, and the additional data in this research came from written source like journal and books that provide to complete the information data and statistical population census. Paradigm that being used in this research is natural paradigm from phenomenological perpective. Based on Husserl (in Moleong, 2014), phenomenological means subjective experience or phenomenological experience, a study about awareness of a person’s main perspective. Phenomenology usually used to define the general opinion for subjective experience from many type and form of subjects (Moleong, 2014). Phenomenology can be define as a thinking view that focused on individual subjective experience and interpretation-interpretation in the world (Moleong, 2014). The subject for this research are two person with similiar characteristic which are female from Bima, non-Balinese and non-Javanese, Moslem, single, high schoolgraduated, and settled in Bali. Method that used for check the validity of this research is triangulation technic with method from Patton (in Moleong, 2014). Triangulation method in this research are two subjects with similiar characteristic to confirm the data validity. Method of analytical data in this research is shorten by using theoritical coding. Theoritical coding consist of open coding, axial coding, and selective coding from Straus and Corbin (in Sald, 2009). This analytical method gathered complete analytical data in Spradley’s model (in Moleong, 2014). The description for each step are 1) Open Coding In this process of open coding, the researcher make an early category from the information about phenomenon that being studied with separating each information into some category or segment. The researcher need to find subcategory or subsegment in each category or segment and searching data for making a dimention or shwoing an extreme possibility in continum of subsegment. 2) Axial Coding In axial coding, the researcher arrange the data with new method after open coding. This arrangement of data presented by using coding paradigm or logical diagram after some steps which is indentify the center of phenomenon, trying the causal condition, make a specification of 376 | Asea Uninet Scientific and Plenary Meeting 2016 strategies, identify the context and condition that separating it, and potray the consequences. 3) Selective Coding In this process, researcher identify the storyline and make a note based on integration to the categories from the axial coding. Qualitative method is not using a hypothesis, this method used to study about naturally objective condition based on the facts that found in the field (Raco, 2010). 3 RESULT AND DISCUSSION Diagram 1. Tolerance (Attached) In this study, the main theme is about tolerance. Tolerance is one of the solutions that used in this case of conflict based on the subjects. The causes of tolerance are misperception, language and religion. Misperception occurs because there was a difference of views between the subjects with her friends. Subjects were resident from Bima that being settled in Bali, so Balinese language is an obstacle on the subject and trigger the tolerance. The dominance of religion in Bali is Hindu. In this study, subject’s religion are Moslem. In Moslem, foods containing pork are something that considered forbidden and prohibited for consumption. Bali is an island that sells lots of foods containing pork that widely and openly because the majority of Balinese are Hindu, which allows to consume that pork. It became the obstacles of subjects during they lived in Bali and cause the response of tolerance from subjects. Tolerance also had the impacts for the subjects. There are two impacts of tolerance such as, mutual respect and adjustment. Subjects were adjust to the environment in Bali, because there are differences in language and perception between their own region. Mutual respect also performed from the subjects. With tolerance, subjects showed more appreciate the differences of religion and the environment perceived by the subjects during settle in Bali. Forms of tolerance shown by the subjects are positive and negative. Positive form of tolerance in this study is discussion. Before the tolerance shown, subjects did the discussion to rectify misperceptions that occur between the subjects and her friends. Besides the positive form of tolerance, there is a negative form of tolerance that is apathetic. Subjects showed apathy towards teasing from her friends who had negative perception of Bima, NTB. The apathy of subjects indicate tolerance response of the problem, that they experienced. The purpose in this study are minimize the level of conflict between the resident of Bali and resident of Bima and produce higher level of peace in order to achieve the harmonious society. In facing the conflicts or problems, subjects have many ways to solve the conflict and it is called a solution. Based in this study, subjects describe the solution of conflict is tolerance. Both subjects are resident from Bima, Moslem and currently settled in Bali. Many causes rising the various forms of tolerance that impacts the subject’s living. Definition of tolerance is generally described by both subjects as a form of problem solving by themselves, trying to adjust the circumstances of others and reduce the severity of the conflict in order to achieve a more harmonious relationship. Along with Ismail (2012) that the principle of tolerance’s life in an effort to prevent conflict and continuous efforts to build peace. The causes of tolerance that obtained in this study are misperception, language, and religion. Both of these subjects are resident from Bima who are currently settled in Bali Asea Uninet Scientific and Plenary Meeting 2016 | 377 for continue their studies at the college. The position from the subjects as non-local resident was a trigger of tolerance while facing the conflicts or problems. Reluctance to worsen the conflict is the main purpose of the tolerance’s appearance. Bima and Bali certainly has a wide range of differences that gave rise many various conflicts. The fundamental difference from Bima and Bali are language and religion. Based on the Central Bureau Statistics of Bali Province, the number of population by religion and district/town in Bali on Population Census of 2010 was Hindu as much as 3.247.383 resident, Moslem as much as 520.244 resident, Protestant as much as 64.454 resident, Catholic as much as 31.397 resident, and Buddhist as much as 21.156 resident. This shows that the majority of population adheres to Hindu in Bali. In Hindu, there is not a ban for eating pork, while in the Moslem religion is opposite. Based on Budaarsa (2012) that Bali is an island that sells lots of foods containing pork, which widely and openly. First, pork usually offers for religious ceremony only, but time over time, many visitor came to Bali and local resident tried to developing the business that containing pork. Foods that contain these pork is one of the trigger of conflict are perceived by the subjects. Language is also the trigger of conflict because the island has its own regional language, which is Balinese language. As the non-local resident in Bali, the subjects has limitations to understanding the Balinese language. In fact, subject’s environment usually use Balinese language for daily language while communication. Tolerance that appear on the first subject is caused by misperception with her friend. The first subject was in conflict with her close friend. The subject revealed that the problem arises because one of her friend had betrayed their friendship with built the relation with other friends who ever did the unpleasant things to subject’s friend. Subject’s friend considers that it was not a problem for her. For the conflict, the subject had discussion with her friend to resolve the conflict. The discussion held for adjust the views that was not similar. After the discussion, the subject attempted to adjust her view with her friend to continue their friendship. In a relationship of friendship, in case of conflict, the parties involved will tend to make sacrifices for the sake of friendship relations according to Taylor, Peplau & Sears (in the Audi, 2014). Subjects had to sacrifice for her friend to do a tolerance for the views that are not similar. The second subject also raises the form of tolerance because there was a conflict with her friends. Problems that occur because there are differences in language, religion and perception. The subjects came from the Bima who are currently settled in Bali, which signifies that she is a non-local resident from Bima. When second subject was communicating with her friends, there were some friends who use the Balinese language. Subject did not understand how to respond it. Friends who use Balinese language, then reminded another subject’s friend to use Indonesian language. Subjects did not tell directly to her friends who use Balinese language to replace Indonesian language for communicating, but the subject immediately tried to adjust to the environment in Bali. This is accordance with Liliweri (2002) that language is a very important cultural component to influence the acceptance, behavior, feelings, and a tendency to act response the world around. The next cause of tolerance based second subject is religion. Society in Bali is dominated by Hindu, they are allowed to consume foods that contain porks. In subject’s religion, Moslem, pork is forbidden and strictly prohibited for consumption. One verse in the Quran, Al-Ma'ida paragraph three states that: “Forbidden to you are carrion, blood, the flesh of swine, the animal slaughtered in any name other than Allah's, the animal which has either been strangled, killed by blows, has died of a fall, by goring or that devoured by a beast of prey - unless it be that which you yourselves might have slaughtered while it was still alive.” 378 | Asea Uninet Scientific and Plenary Meeting 2016 Based on the subject’s experience, her friends ever eating the foods that containing pork in front of the subject. At the first, subject felt weird with it but as time passes, subject tried to understand these conditions without debate with her friends. This is accordance with the opinion from Sufanti et al (2015) that the attitude of religious tolerance is one of the student’s attitude needs to be improved. Differences in perception that felt by the second subject with her friends in Bali. The failure interpretation message will bring social mistaken view, in the form of stereotypes and prejudice that are both better known as ethnocentrism. A subjective view that the most superior judge their own culture and culture is superior from the others. Culture itself is placed as an orientation center and standards for measuring other cultures. At the same time, ethnocentrism spawned cynicism, disdain and a priori (Patta, 2014). Based on that, subject’s friend shows an failure while interpreting the message about the city of Bima, it was raise the stereotypes and prejudice. Stereotypes and prejudice led the ethnocentrism, so her friends teasing about Bima to the subject. Subjects was not comfortable with the insinuation that she got. That actions occur because her friend tried to make a joke for the subject and was not a serious problem. The response form of subject from the insinuation is tolerance, because she thought that was not a serious things become commonplace. Data on the impacts of tolerance was also obtained by the researchers. The impact of tolerance is mutual respect. Subject feel that impact of the differences is emergence the mutual respect. Based the first subject, she tolerate that views are not similar, because there was negative perceptions from others. While on the second subject, she tolerate the views are not similar, because of the negative perceptions of Bima. Associated with foods are containing porks, the second subject has also shown respect for other religion differences that exist. In Moslem, pork are forbidden to consumed, but the subject could tolerate that views. This is shown by her attitude of tolerance, if there are subject’s friends who consume pork, she does not scold them and try to be silence as a form of mutual respect. According to Joseph (2002) that tolerance establish peace live together and cooperate in certain limits in a society which is too diverse, good race, tradition, creed or religion. So it can provide the mutual respect for peace in subject’s living. The next impact from the subject is adjustment to environment. Adjustment to environment caused by language differences. Balinese language initially was an unusual thing, but it becomes understandable to the subject for now. According to the Sapir-Whorf (in Liliweri, 2002) that language or event affecting one's way of thinking or way of viewing the world. Second subject has changed the way she thought with trying to find an alternative way to learn and develop the ability to understand Balinese language, by buying the dictionary of Balinese language. In addition to the data obtained definition and causes of tolerance, the researchers also obtain data about the forms of tolerance by subjects. There are two forms of tolerance are positive form and negative form. In the form of positive tolerance is discussion. The first subject held discussion when there was differences of perception with her friends. Discussions were held to adjust the differences of perception. According to Herdikus (1991) which states that at the end of the discussion, listeners or viewers have a view or a much clearer idea of the issues discussed. With the discussion, the subject can tolerate dissimilarity and have a clearer view related problems that occur in friendships. The negative form of tolerance raises from the subject is apathetic. Apathy raised by the second subject was a response from tolerance. According to Solmitz (in Artahsasta, 2015) apathy is indifference individuals where they do not have the interest or lack of attention to certain aspects such as, social life as well as physical and emotional aspects. Asea Uninet Scientific and Plenary Meeting 2016 | 379 The subjects did not respond the tease from her friends, it shows apathy. Subjects assume that was a form of jokes that she can understand, without having debated. 4 RESEARCH LIMITATION The concept of toleration based on psychologycal theories are difficult to find, this caused the concept that used in this research are taken from the previous studies. Throughout the interview method, the subjects was less showing the conflict that they have experienced before. Subjects tend to deny the conflict and pretend that the condition was always in peace. Other than that, the form of toleration’s behavior more shown by one of the subject. The limitation of time and energy also affect researchers from collecting more data for this research. 5 SUGGESTION For the future research, hopefully to find richer sources of literature especially from books even journal that having a relation with torelate behavior. This also need to balance with the data that collect from subjects. Hopefully, this will make a comparation between theory and data that collected from field will be more balanced to be analyzed. The duration of collecting data and data analyzing also need to be well prepared to make a relevant result of research. ATTACHMENT Diagram 1. Tolerance BIBLIOGRAPHY Al Qur’an Tajwid dan Terjemahan. (2006). Jakarta: Maghfirah Pustaka. Artahsasta, V. (2015). Hubungan Antara Pemahaman Ideologi Pancasila dan Apatisme Politik Mahasiswa Psikologi Bina Nusantara. (Skripsi). Fakultas Psikologi Universitas Bina Nusantara, Jakarta. Aprianti, I. (2012). Hubungan Antara Perceived Social Support dan Psychological WellBeing Pada Mahasiswa Perantau Tahun Pertama Di Universitas Indonesia. Skripsi. Fakultas Psikologi, Universitas Indonesia, Depok. 380 | Asea Uninet Scientific and Plenary Meeting 2016 Audi, N.L. (2014). Persahabatan dan Toleransi Pemalasan Sosial pada Mahasiswa Psikologi Universitas Sumatera Utara. Jurnal Pemikiran & Penelitian Psikologi, 2 (9) 52-56. Badan Pusat Statistika. Provinsi Bali (2010). http://bali.bps.go.id/tabel_detail.php?ed=606013&od=6&id=6. Diunduh 17 Desember 2015. Fitriana, N. (2013) Nilai-Nilai Pendidikan Islam Dalam Film Hafalan Sholat Delisa Karya Sony Gaokasak. (Skripsi). Fakultas Tarbiyah UIN Sunan Ampel, Surabaya. Herdikus, D. (1991). Retorika: Terampil Berpidato, Berdiskusi, Berargumentasi, Bernegosiasi. Yogyakarta: Penerbit Kanisius. Liliweri, A. (2002). Makna Budaya dalam Komunikasi Antarbudaya. Yogyakarta: PT LKiS Pelangi Aksara. Liliweri, A. (2005). Prasangka & Konflik: Komunikasi Lintas Budaya Masyarakat Multikultur. Yogyakarta: LKiS Pelangi Aksara. Nasution, K. (1997). Stres dan Perilaku Coping Pada Mahasiswa Perantau di Universitas Indonesia. Skripsi. Sarjana: Universitas Indonesia, Depok. Patta, A. (2014). PENGEMBANGAN MODEL PERENCANAAN KOMUNIKASI ANTAR ETNIK SEBAGAI SOLUSI ATAS MENGUATNYA KESADARAN ETNOSENTRISME. Jurnal Academica Fisip Untad, 1(6) 1411-3341. Rochwulanningsih, Y., & Mahendra, U. (2013). Tipologi Sosiokultural Petambak Garam di Indonesia. Bandung: Universitas Diponegoro Press. Sald, J. (2009). The coding manual for qualitative researchers. New Delhi: Sage Pub. Sudantra, I. K. (2013). Pengaturan Penduduk Pendatang Dalam Awig-Awig. Sufanti, dkk. (2015). Pengembangan Bahan Ajar Apresiasi Biografi Tokoh Bermuatan Pendidikan Toleransi Kehidupan Beragama. (Publikasi Ilmiah). Universitas Muhammadiyah Surakarta, Surakarta. Sulaiman, A. (2015). Bentrok Kelompok Pemuda Bima dan Ormas Bali Pecah, Apa Penyebabnya?. http://sosialberita.net/2015/09/19/bentrok-kelompok-pemudabima-dan-ormas-bali-pecah-apa-penyebabnya/7608. Diunduh 18 Desember 2015. Wijono, S. (2011). Psikologi Industri & Organisasi: Dalam Suatu Bidang Gerak Psikologi Sumber Daya Manusia. Jakarta: Kencana Prenada Media Group. Yusuf, A. A. (2002). Wawasan Islam. Bandung : Pustaka Setia. Raco, J. R. (2010). Metode Penelitian Kualitatif: Jenis, Karakteristik dan Keunggulannya. Jakarta: Grasindo PT Gramedia Widiasarana Indonesia. Moleong, L. (2014). Metodologi Penelitian Kualitatif Edisi Revisi. Bandung: PT. Remaja Rosdakarya. CONTINUITIES AND CHANGES NORTH SUMATRAN PERFORMING ARTS Muhammad Takari mtakari@yahoo.com Universitas Sumatera Utara Abstract This paper as a result of field research, aims to described general existention, continuities, and changes of North Sumatra performing arts, both from it’s forms in the native tradition or migrant tradition from nusantara and world. I use descriptive method, based on field work, and qualitative approach. I use continuities and changes and functionalism theory. The results in this research that performing arts in North Sumatran ethnic culture are the integral parts in their culture histoty, began with animism and dinamism era, then continued by Hindu and Buddha era, and the later coming Islam and Christian religion, and then continued in the era of Indonesian nation state and globalization. The examples of Islamic arts were zapin, zikir, barzanji, an so on. In another side, Christian performing arts genre were the church songs, brass band, choir technique, seriosa songs, etc. The North Sumatran performing arts have some function in it’s societies, which expressed in some ceremonies. For development these arts we must based on it’s functions as: ritual, entertainment, aesthetic, creative economic needs, and so on. Keywords: performing arts, North Sumatran, ethnic, changes, continuities, Islam, Christian, ritual, entertainment, aesthetic, creative economic. 1 INTRODUCTION North Sumatra is one of the 34 provinces in Indonesia, which stands out for its cultural diversity, motivated by history, geography, rapid economic growth, etc. Diversity of North Sumatra include religion, language, race and ethnicity, arts, and more. Various ethnic groups in North Sumatra, can be categorized into three groups. First, native ethnic: (a) Karo, (b) Pakpak-Dairi, (c) Simelungun, (d) Batak Toba, (e) Mandailing-Angkola, (f) Pesisir, (g) Nias, and ( h) Malay. Second, Nusantara ethnics: Aceh Raya, Simeulue, Alas, Gayo, Tamiang, Aneuk Jamee, Minangkabau, Banjar, Sundanese, Javanese, Bugis, Makasar, and others. Third, world ethnics: Hokkien, Hakka, Khek, Kwong Fu, Tamil, Hindustani, Pashtun, Arabic, and more. Overall very diverse ethnic groups also have a variety of religions and cultures, be it local religions such Parmalim, Pemena, also world religions as Islam, Protestantism, Catholicism, Hinduism, Buddhism, Confucianism, and others. This diversity, expressed in the performing arts (music, dance, and theater). The existence of North Sumatran ethnic performing arts is based on a literature review has been conducted by some researchers as Takari et al. (2008), which examines the Indonesian performing arts in general, includes North Sumatra. Similarly, ethnic art has been studied specifically every ethnicity by writers such as: Tarigan (2008) in Karo; Harefa (2012) Nias music; Purba (2012) Pesisir music, Gusmalayanti (2011) Malay zapin, and Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 381 382 | Asea Uninet Scientific and Plenary Meeting 2016 others. This paper was written more broadly, which includes continuities and changes all of North Sumatra performing arts. I use qualitative method, which is based on the research field. 2 FINDINGS AND DISCUSSION: NORTH SUMATRAN PERFORMING ARTS TRADITIONS 1. Karo ethnic has a clan system called merga Silima (five clans): (1) Ginting, (2) Sembiring, (3) Karo-karo, (4) Perangin-angin, and (5) Tarigan. Today, the religion of Karonese are Protestant, Catholic, Islam, Hindu, and Pemena (traditional religion). Religious values Ppemena be partly transformed until now. Pemena religious adherents believe in the creator of the universe called Dibata Kaci-kaci. Karonese called for the musicians as sierjabaten, which has the task means. Sierjabaten consists of players sarune (shawm), singanaki drum, singindungi drum, penganak little gong, and gung (big gong). Each player musical instrument in Karo, have each other's names: players sarune called panarune, singanaki and singindungi drum called penggual, penganak called simalu penganak, and gung called simalu gung. According to the Karo people, each dance (landek) movement is always associated with symbolism, which portray human nature and one's relationship with others in their’s social life. Broadly speaking Karo dance is divided into three types, namely: (1) religious dance, (2) traditional dance, and (3) young people dance. Among the religious dance are: guru, mulih-mulih, tungkat, peselukken, and tembut. 2. Pakpak-Dairi, this ethnic largely reside in the region Dairi and Pakpak Bharat. Located in between 98 to 99˚20 'east longitude and 20 to 30 degrees 15' north latitude. In the era of animism, the belief in the concept of the supernatural realm is divided into three parts, namely: Guru (God the Creator), Tunggul ni Kuta (God of Guardians Village), and Berraspati ni Tanoh (God Mastering the Land). Pakpak ethnic groups were divided into four suak (families): (1) Pakpak Boang; (2) Pakpak Kelasen; (3) Pakpak Kepas, and (4) Pakpak Simsim. Pakpak community naming ende-ende to all types of vocal music. To distinguish between types of singing, behind ende-ende word followed by the name of song. Example, ende-ende melumang, the lament of a child when remembering one or both parents who had died; ende-ende merkemenjen is singing take frankincense; ende ende memuro is singing while working keeping the rice and crops in the fields, and others. Pakpak community generally divides his musical instruments based forms of presentation and how to play it. Based on the form of presentation of musical instruments are subdivided into two groups: (1) gotci and (2) oning-oning. Based on how to play a musical instrument is comprised of three groups, namely: (1) sipalu, (2) sisempulen, and (3) sipiltiken. Gotci musical instrument is presented in the form seperangkatan (ensemble) consists of: gendang sisibah, gendang silima, gendang sidua-dua (drums), gerantung (plate gongs), mbotul (cymbals), gung (knobbeedd gong), and kalondang (xylophone). Instruments that belong to the group gotci is as follows, played together with gung sada rabaan, consists four gongs, panggora, poi, tapudep, and pongpong. Another instrument used is sarune (double reed shawm) and cilat-cilat (cymbals). Today the instrument is only used from time to time. Sidua-dua drum ensemble consists of a pair of two-sided barrel drums. Both drum comprises a drum inangna (mother drum) is the largest drum, and the anakna (male child drum) which is the smallest drum. Other devices of the drum ensemble sidua-dua of these are four gongs (gung sada rabaan), and a pair of cilat-cilat (cymbals). In the presentation, drum ensemble is generally used for rituals, like cast a bully in the forest before developmet Asea Uninet Scientific and Plenary Meeting 2016 | 383 to agriculture (mendegger uruk), and entertainment, such as the king's coronation, or to accompany the dance arts (moncak). 3. Simelungun, based on geographical location, district also Simelungun culture stretches between 02 degrees 36 'to 3 degrees 18' North latitude and 9 degrees 32 'to 9 degrees 35' east longitude. Overall width Simelungun area is 4,386.69 km². Historically, circa 500-1290 A.D. in the area Simelungun has established a kingdom, called Nagur led by a king named Damanik (Damanik 1974: 33). The people called Timur Raya tribe, because the area is located in the East Lake Toba. At first, the Simelungun embrace a religion called Sipajuh Begu-begu or Parbegu. Before the coming of Christianity and Islam, Simelungun can be grouped into animism. Simelungun Protestant community integrated to Christian Protestant Church Simelungun (GKPS). Simelungun has a song dedicated to children by parents or her sister called urdourdo or tihtah. Urdo-urdo is a kind of singing to lull children, while the children play tihtah is singing. Typically, according to the customs Simelungun, in infancy is the sister of the baby's father called amboru, come to keep the baby. Culturally amboru will take care of the baby, who is female, ungut-ungut chant usually sung while doing work weaving or weaving mats. Simelungun known term for instrumental music ensemble, gonrang. In the perform gonrang used two ensembles, namely gonrang bolon and gonrang dua. Gonrang bolon consists of seven pieces of the drum-shaped conical, which is placed on a shelf with a vertical arrangement of around 80º, with a size of about 60 to 120 cms. Seven gonrangs is usually played by two players. Plus musical instruments sarune bolon (double reed shawm), three suspended gong, and sitalasayak (cymbals). According to the legend that is trusted by society, this gonrangs are incarnation of the seven daughters of heaven are sent into the world to oversee arts and ceremonies desired by the gods. Its function normally for ritual ceremonies, marriages, churches, and others. 4. Batak Toba, as an ethnic unity, Toba Batak people inhabit an area of culture called Batak Toba. At present, the region Batak Toba ethnic culture is that most of the area including North Tapanuli, Toba Samosir, Humbang Hasundutan, and Samosir, which surrounds Lake Toba. Religion other than Christianity and Islam, and there are followers until now, embraced by little Batak Toba is Parmalim. Religion is often called Si Raja Batak religion, because religion is believed by the greater part of the Batak Toba, embraced by King Si Singamangaraja XII (Sangti 1977: 79). Batak Toba ethnic vocal music is generally identified as ende, which are taxonomically divided by function and purpose of the song. The types ende it is as follows. (1) Ende mandideng, is a song that serves to lull the child. (2) Ende sipaingot namely vocal music that contains the contents of the text message to her daughter to be married. (3) Ende tumba, the special vocal music sung as a dance entertainment (Tumba). Sung once danced teenagers, skipping and holding hands in a circle. (4) Ende sibaran, is a vocal music as a spontaneous outburst of prolonged suffering, which befall a person. In the musical tradition of Batak Toba, there are two types of music called gondang sabangunan and gondang hasapi. Both of these types of music used in any activity within the context of social life that is religion, customs, and entertainment. Gondang sabangunan consists of several types of traditional instruments Batak Toba, namely: five taganing, one gordang, the shawm sarune bolon, four gongs (oloan, ihutan, panggora, doal), and hesek. Gondang sabangunan typically used in ceremonies relating to customs (adat) and religion. On the other hand ensemble gondang hasapi (uning-uningan) consists of musical instruments: two hasapi (ende and doal), one garantung (xylophone), one sarune etek (shawm), sulim (side-blown flute), tulila (side-blown flute ), sordam (end-blown flute), tanggetang, gardap, and hesek. Gondang hasapi used in religious ceremonies, customs, 384 | Asea Uninet Scientific and Plenary Meeting 2016 and entertainment, especially in the theater Opera Batak, shped by Tilhang Gultom in 1930s. 5. Mandailing-Angkola, region Mandailing-Angkola ethnic culture consists of two regions, namely Mandailings Godang located at north and Mandailing Julu south. Angkola located in the northern part. Mandailing Godang include Siabu and Panyabungan, lowland filled with rice fields, while Mandailing Julu include Kotanopan, Muarasipongi, and Batangnatal, which is a mountainous region. The ancestors of ethnic Mandailing-Angkola including clumps Proto-Malays (Harahap 1986:12). For the people of Mandailing-Angkola in pre-Islamic era, the music is part of the activities of religious and traditional ceremonies, which are joy (siriaon) and sorrow (siluluton). Their traditional music ensemble known in three ensambles: (1) gondang dua, (2) gondang lima, and (3) gordang sambilan. Gondang is one type of music contained in the Angkola used in the execution of traditional adat nagodang (levels of ceremonies greatest). If people say playing gondang in the context of customs, which meant not only play instruments drums, but plays a musical ensemble consisting of two pieces gondang (gondang inang and gondang pangayakon), 2 pieces ogung, 1 suling flute, 1 piece doal, a pair of tali sasayat (cymbals), 7 pieces salempong (knobbed gongs), and onang-onang (singing), and tortor (dance). In the language of Mandailing-Angkola, singing is also called ende, consisting of: (1) onang-onang, singing expression of disappointment and relief longing for loved ones. (2) Turke-turke is lullaby song by parents for their children, aged 6 to 10 months. (3) Ungutungut, folksongs which tells the village atmosphere, which is sung by a man as an expression of grief would wander away. (4) Ile onang baya, the song of the release to a loved one. 6. Pesisir, an ethnic group that uses coastal culture. This society is based on the offspring derived from the ethnic Batak Toba, Mandailing-Angkola, and Minangkabau. According Nainggolan, chairman of the Foundation Institute for Indigenous Culture Coastal that the existence of this ethnic has formed its own culture incompatible with life in coastal areas. Greater part of their livelihood as fishermen. Coastal communities can be categorized as a separate ethnic group (Nainggolan 1997:11). They have art, among which are Sikambang Dance is a movement of self-defense. In this dance there is value foster community unity and mutual assistance. Then encountered dance peas. Peas word is a word that is contained in the lyrics in the dance. Kapulopinang Dance is one of dance in Central Tapanuli Coastal culture and Sibolga. Pulaupinang is one word that can be heard in the lyrics, in one round of Sikambang Dance. In this poem described how the beauty of Pulaupinang, as well as many functions of trees and betel nut. Kapulopinang Dance is often also referred to as Umbrella Dance as using the property umbrella. Two pairs of dancers, dancers a man holding an umbrella and a woman holding a shawl dancer. 7. Nias communities have confidence tribe called Sanomba Adu, means worship and carved figures made of wood or stone as a medium where the spirit dwells. They believe the gods: Luo Walangi as the creator god of the universe; Lature Sobawi Sihono god pig owners and rulers; Uwu Gere and powers of the patron god ere (Sanomba Adu leaders); Uwu Wakhe god of plants; Gozo Tuha Zangarofa god of water, and others. Then came Christianity to Nias. First missionarist came to Nias is Denninger 1865, precisely in Gunungsitoli (Takari et al., 2008). Christian mission then forwarded by Thomas who came in 1873. critical period in the development of Christianity is between the years 1915 to 1930, this period is referred to as total conversion period (fangesa dodo sebua). Asea Uninet Scientific and Plenary Meeting 2016 | 385 One type of Nias community arts is the art of music. As in the musical instruments Nias is as follows. (a) Gondra membranophone were beaten with staves rattan (famo gondra), used in the wedding party, accompanying dance or song. (b) Gong are kind of knobbed gong, consisting of two gongs garamba and faritia. Social function is to give news that happens on the battlefield, for example, someone died. (c) Tamburu, is a drum, the smaller size of gondra and the outside is not bound by rattan but outside nailed it. Tamburu beaten to greet or accompany the bridal procession, song, and dance. (d) Doli-doli is a wooden xylophone laore, keys are placed on the players' legs and hit with a wooden bat. (e) suling as a wind instrument made of bamboo lewuo mbanua. (f) Ndruri is including a musical instrument jew's harp, has a tongue called lela. Then dances in Nias which are: (a) Maena, namely dance commonly performed in the wedding ceremony, and also performed to welcome the guests of honor. Maena dance is usually performed in the open field, a number of people could participate because the movement is not hard to follow. Variation common movement which form a triangle leg (tolu sagi) and leg movements form a rectangle (ofa sagi) with both arms swing forward and backward. (b) Moyo Dance is a dance that mimicked an eagle in flight. Usually danced by women. This dance is the most important function for pickles, for example, the coronation of a person into nobility. (c) Faluaya and Maluaya Dance. Maluaya is a dance of unity as a sign of social solidarity in order to conquer the enemy. The action describes a group of soldiers at war. The property is a sword dance (balatu), pike (toho), and a shield (baluse). (d) Hombo Batu is an element of dance sports exercise stone skipping war as a symbol of megalithic culture. 8. Melayu, the society is becoming an integral portion of the Malay and Islamic World, and Indonesia. Malays usually defines the group as a muslim, Malay culture, custom, and various local requirements. Malay people in North Sumatra has a cultural region of Tamiang, Langkat, Deli Serdang, Batubara, Asahan, and Labuhanbatu. Malay community has a song related to the child. Among these are cradles children's songs, which is used to euthanize children. Dodoi Didodoi, the song is also to put the kids. In Asahan district contained the song Si La Lau Le songs used for lull the children. Then there is also the Timang song that is used to children lullaby. So there is a song titled Tamtambuku used for children's games. Malay dance based on cultural and functions, can be classified: (1) Expresses activities related to agriculture, ahoi (thresh rice dance), mulaka ngerbah (cutting down forests), mulaka nukal (plant rice seed to agricultural land). (2) Expressing the activities associated with fishing, for example dance tari jala (make nets), gubang (dances that express fisherman asking God to wind lowered so that they can yachting back), (3) dances that mimic or mimetic nature activities around, for example ula-ula lembing (imitating the movements of a snake).(4) The dance that related to Islam, for example, hadrah (praise to God and the Prophet Muhammad), zapin (performing art absorbed from Arabic by prioritizing the movement of the feet); (5) Dance relating to immunity example dabus. (6) The dance primary function of entertainment, and the adaptation of various cultural elements. For example ronggeng and serampang dua belas dance (7) Dance related sports, such as silat and lintau. (8) Dance relating to marriage or circumcision ceremony, inai dance (called plate or candle dance). (9) Dances in Malay theater, as in makyong, bangsawan, mendu. (10) Dance new creativity, for example dance: Ulah Rentak Angguk Terbina, Zapin Mak Inang, Zapin Menjelang Maghrib, Zapin Deli, Zapin Serdang, and others. 9. Nusantara Ethnic Immigrants and the world, in addition to ethnic native above, in North Sumatra there are also ethnic immigrants arts from the archipelago (Nusantara) and the world. They bring to the art of North Sumatra is experiencing its own. There are 386 | Asea Uninet Scientific and Plenary Meeting 2016 strictly carry on the tradition of ethnic origin. Generally it is the music and dance rituals. For example mantram in Tamil Hindu tradition, the ritual lamenting of Tripitaka in Chinese Buddhist community, ritual dances in Bali Hindu tradition in North Sumatra, and others. There are several genres of dance that originated from ethnic migrants, which is popular for the community. Barongsai and liongsai dance derived from Chinese culture. Functionally, these dances are used in a variety of sociocultural context in North Sumatra. For example this dance used in the Quran Tilawatil Musabaqah (Quran Festival) activities. Also for the anniversary of Indonesian independence, the inauguration of the new building, the Chinese Lunar New Year (Imlek, Cap Go Meh), and others. There are still maintaining the culture of ethnic origin, but with patterns of creative acculturation to native culture. For example genre kuda kepang of Java (Central and East), in addition to continuing the music of Java, also adopted the songs of ethnic native North Sumatra. Adopted Biring Manggis song from the Karo and Malay Selayang Pandang song. Immigrant ethnics in maintaining cultural identity and interaction with the ethnic native North Sumatra, shaping organizational culture. Acehnese society organizations formed Aceh Sepakat. North Sumatra Minangkabau ethnic formed organization North Sumatra Minangkabau Community Consultative Institute (BM3). There is also a cultural organization that the number of members is large enough that Pujakesuma (Javanese Birth at Sumatra). Chinese community organizations formed by cultural economy based on their origins from China. Sundanese people have a cultural organization PWS (Association of Niorth Sumatra Sundanese society). Similarly to other ethnics in North Sumatra. 3 CONTINUITIES AND CHANGES Continuity and change in the ethnic performing arts of North Sumatra, is based on historical factors. North Sumatra ethnic art, starts from the animism and dynamism since the ancestors of North Sumatra were already thousands of years B.C. Animism and dynamism of this period lasted until the first century AD. Art that comes from this period shows the functional aspects such as the worship of the spirits of the ancestors and supernatural beings. Can be seen through art activities at the ceremony erpangir ku lau (Karo), jinujung (Karo), gordang sambilan aimed at offering to ancestral spirits (Mandailaing), pasiarhon jujungon (Batak Toba), music gondra to Sanomba Adu (Nias), and other. Then enter the influence of Hindu-Buddhist here. This influence can be examined through blood ties and kinship names of the people of North Sumatra, such as Brahmana, Colia, Meliala in Karo. Likewise naming refers to the gods. For example, in Tano Batak designation musician (pargonsi) is Guru Nahumundul and Guru Namanguntar. Likewise for the mention of the wind in Karo culture, such as nari'iti, daksina, aguni, indicating the influence of the Hindu. Indian migrants who initially become indentured in North Sumatra bring religion (Hinduism and Islam) and Indian civilization. They bring the performing arts of India, both for functionality sacral and profane. Among these are pirartenei and mantram (sacred songs), to the accompaniment of Indian classical music. Backed by musical instruments like tabla, baya, mrdanggam, nay Indian flute, sruti box, harmonium, violin, sarenggi, and others. There are reative acculturation between Indian and Malay performing arts genre that generate chalti, live at the Palace Sultanate Deli and Serdang on decade 1920's. The genre is called chalti, which evolved into the Malay orchestra, and since 1977 to the genre of dangdut. Dangdut music now acculturated almost every culture of the archipelago and even the world. There are elements in the multicultural dangdut, such as dangdut Karo, dangdut Karo, dangdut Batak, dangdut koplo, dinamik dangdut, rock dangdut, dangdut Asea Uninet Scientific and Plenary Meeting 2016 | 387 pantura, dangdut Sunda, dangdut Bali, dangdut Makasar, and others. This proves that the Indian type music that acculturated to Malay music culture and the world is rapidly absorbed and functioned in the culture of the people of North Sumatra, the archipelago, and Southeast Asia. Islam emerged with a solid density since the 13th century. Starting in the kingdom of Haru in the region, as a type of Islamic kingdoms. This kingdom includes powerful kingdom in terms of troops and power. The kingdom of Haru in North Sumatra's East Coast, can be regarded as the starting point of the development of Islam in the archipelago. Then, accompanied by other Islamic kingdoms in the archipelago as Perlak, Samudra Pasai, and then Melaka, Johor, Riau-Lingga, Siak Sri Indrapura, and so on. Through these Islamic kingdoms of Islamic art into the lives of the people of North Sumatra (Takari et al., 2012). The results can still be viewed and functioned until now in the muslim community in North Sumatra. In terms of artifacts, Islam have contributed to the civilization of North Sumatra. Examples are building palaces Sultanate of Deli and Serdang, Kedatukan Batubara, and others. Also mosques as an icon of North Sumatra Islamic civilization was built and nurtured and lasting until now. Among the mosques that have values of the history of civilization is the Al-Mansun Deli, Labuhan Mosque, and others. Islam also donated various genres of performing arts, but still mixed with the aesthetic taste of the people of North Sumatra. The genre can be seen from Orkes Padang Pasir (Desert Orchestra) so popular that originally introduced by Ahmad Baqi, Mukhlis, and his friends. This orchestra is so vast show, to the neighboring countries Malay. Orchestra is the famous El-Suraya. Similarly, nasyid growing since the latter half of the 1960s, making nasyid performance center in the archipelago. Nasyid famous figures of the global ocean is Nurasiah Jamil North Sumatra. Tens recording his songs became an icon nasyid archipelago. There is also a nasyid figures and Islamic music of this region are expanding into neighboring Malay. For example Jalidar who develop Islamic music in Brunei Darussalam. He comes from Lubukpakam Serdang. Likewise Ahmad C.B. who devoted his musical knowledge and ability in the State Malaysia. In the dance known as zapin Islamic dance. This dance is so popular in the North Sumatra region. Zapin dance originally was from the country of , which functioned in various Islamic activities, especially for the marriage ceremony, called walimatul ursy (Takari, 2010). World Malay zapin are two types, namely zapin Arab and Malay zapin. Arabic zapin is zapin which is derived from either the Arab ensemble, songs, dance movement, and function. While the Malay zapin is processed Malay artists to this art. Malay zapin incorporate dance movements such as elbows siku keluang, pecah tahto, tahtum, pisau belanak, sembah akhir, anak ayam, and others. On the other hand, the songs also use Malay language and elements of poetry or other literary genre. Malay zapin known in a variety of songs for music and dance this zapin. Among these are: Lancang Kuning, Selabat Laila, Zapin Bunga Hutan, Zapin Persebatian, Zapin menjelang Maghrib (creation Rizaldi Siagian), Zapin Ya Salam, and others. In the coastal culture in the west coast of North Sumatra is also known talibun genre, karmina, and sikambang reflecting Islamic civilization. In coastal communities is also a variety of dance expressing Islamic art. In Mandailing-Angkola culture found zikir rapano, as one of the artistic expression of remembrance (praise God). This dhikr uses Arabic and Mandailing language, to the accompaniment of drum rebana (rapano). Moreover, the Muslims who come to this region also bring music that is based on the teachings of Islam. For example Javanese Muslim community in this area bring terbangan, berjanzen, kuntulan, rodat, and others. Islamic art using musical elements of Java that acculturated with Islamic music. Likewise, the dance movements. Minangkabau society also brings the arts of Islam as salawaik dulang (tray invocation), which uses a tool 388 | Asea Uninet Scientific and Plenary Meeting 2016 to accompany the main salawat (praise to the Prophet Muhammad). Likewise, the Indian community of Islam was brought arts such as boria basic in Islam are popular in Pulaupinang and influence in North Sumatra. Furthermore, European culture come to the North Sumatra region. Initially through Portuguese foothold in Melaka in 1511, although ultimately Melaka being part of the State Malaysia. But at that time culturally Melaka being part and parcel of the Malay culture in North Sumatra now. After the Netherlands also brought their art through the art of architecture, music, and dance. Maimun Palace in the Sultanate of Deli reflect that. Even the architecture of the palace and the main mosque also was the architect of the Netherlands. Similarly, bands in various Malay Sultanate Palace in East Sumatra can not be released from the influx of Dutch culture in the region. Sultanate Langkat are langkat Band. Similarly there Serdang Serdang Sultanate Band. In addition, the European influence in through Christianity. Toba Batak society and Simelungun who converted to Christianity, adopting various elements of European art into social life. This can be tracked through their habit of singing in four voices (soprano, alto, tenor, and bass) performed spontaneity alone for all the songs. Similarly, the emergence of woodwind or brass ensemble band Western cultural backgrounds adapted to the local culture. Inflatable musical genre is originally grown and developed in the area Tambunan of Tapanuli Utara that later developed in major cities in North Sumatra as in Pematangsiantar, Lubukpakam, Medan, and others. So also the music genre seriosa earn his place in the community of art lovers in North Sumatra. In addition, the influence of European art has a positive impact also for the development of art in North Sumatra. With a background knowledge of European art, then this region produces artists and composers of the national rankings, such as: Liberty Manik, Sidik Sitompul, Jaga Depari, Cornel Simanjuntak, Lily Suheiry, and others. Thereafter the development is an art era of globalization, which produces patterned acculturative arts. For example, music and dance new claim, which is derived from the traditional art of North Sumatra, but processed in accordance with the development of the current era. The artists and creators of art, work of art materials available, and then treated with a variety of world civilization along with the globalization process. There are also arts were developed based on contemporary art. This art based primarily on the ability to process the creators and perpetrators. This contemporary art typically rely on certain figures and in a limited environment. World arts that developed within a certain time also a reference material and creating art in applying certain period. For example in the 1980s appeared to break dance, then this is also a reference in applying art. Similarly, the other arts that became dominant in a particular era also remain a concern of the artists in the region of North Sumatra. Onwards, various art world is also the base material for artists in developing the art of North Sumatra. In this area every year after 2011 was held North Sumatran Jazz Festival are also being part inseparable from the existence of national and international jazz. 4 CONCLUSSIONS AND SUGGESTIONS By looking at the continuity, development, and direction of art like that, it is clear that the artists in North Sumatra realized that the arts they do and produce is rooted in elements of tradition, acculturation with a variety of cultural heritage, cultural, East, West, and the world. They are aware of changes and developments in accordance with the dynamics. Thus all these factors are taken into consideration in preserving, creating, and appreciate the arts as an integral portion of the social and cultural dynamics of North Sumatra. Going Asea Uninet Scientific and Plenary Meeting 2016 | 389 forward, would need to think about how memungsikan arts in North Sumatra in various contexts, so that all functional and gus strengthen cultural identity. REFERENCES Gusmalayanti, Eva (2011). Lagu-lagu ciptaan Zulalinur: kajian terhadap struktur teks dan melodi (bachelor thesis). Medan: Etnomusikologi. Harahap, H.M.D. (1986). Adat-istiadat Tapanuli Selatan. Jakarta: Grafindo-Utama Harefa, Brian Laso (2012). Analisis musik vokal pada pertunjukan maena dalam pesta adat falöwa (perkawinan) masyarakat Nias di Kota Medan (bacjhel;or thesis). Medan: Etnomusikologi. Damanik, Jahutar (1974). Jalannya hukum adat Simalungun. Medan: Aslan. Nainggolan, Radjoki (1997). Kebudayaan Pesisir Tapanuli Tengah Sibolga (paper Seminar Kebudayaan Suku Pesisir di Medan 11 Oktober). Purba, Ana (2012). Analisis musikal dan tekstual dampeang pada upacara adat perkawinan suku pesisir di Kota Sibolga (bachelor thesis). Medan: Etnomusikologi. Sangti, Batara (1977). Sejarah Batak. Balige: Karl Sianipar. Takari, Muhammad et al. (2008). Masyarakat dan Kesenian di Indonesia. Medan: Program Studi Etnomusikologi. Takari, Muhammad (2010). Zapin dalam peradaban Melayu (paper Seminar Zapin Medan). Takari, Muhammad et al. (2012). Sejarah Kesultanan Melayu Deli dan peradaban masyarakatnya. Medan: Universitas Sumatera Utara Press. Tarigan, Prikuten (2008). Musik Karo dalam perubahan. Medan: Program Studi Etnomusikologi/ 390 | Asea Uninet Scientific and Plenary Meeting 2016 GONDANG MULA-MULA/SOMBA-SOMBA (Brass Band Style, acculturated Toba Batak and Western Musical Culture) MM ♪ = 130 Tambunan Musik Group Asea Uninet Scientific and Plenary Meeting 2016 One Repertoire of Hadrah North Sumatran Islamic Music | 391 392 | Asea Uninet Scientific and Plenary Meeting 2016 Baris Dance in North Sumatran Balinese Ethnic Culture, Performed by Ketut Jelantik (2001) Hombo Batu Dance from Nias Asea Uninet Scientific and Plenary Meeting 2016 Tortor Naposo, Toba Batak Social Younger Generation Dance Zapin Perantau Dance in Contemporary Arts Style | 393 HEALTH, PHARMACY AND MEDICINE Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 394 DEVELOPMENT OF STANDARDIZED ETHANOL EXTRACT AND PRODUCTION OF HERBAL MEDICINE IN UNIVERSITAS AIRLANGGA Sukardiman sukardiman@ff.unair.ac.id maman_ht@yahoo.com Herra Studiawan Lusiana Arifianti Rakhmawati Departement of Pharmacognosy and Phytochemistry, Faculty of Pharmacy Universitas Airlangga, Surabaya, Indonesia Abstract Research objective : Development of standardized ethanol extract from selected simplisia from Indonesian traditional raw material and production of herbal medicine as anticancer, antihyperlipidemic activity. Methodologies: Production of standardized ethanol extract was conducted on ethanol 70% by scale up maceration extraction methods and was standardized on specific and non specific parameter with followed Faramakope Herbal Indonesia guideline. Additionaly, general methods to development production herbal medicine as anticancer, antihyperlipidemic , activity by the first step is standardized of simplisia and ethanol extract, the second steps were determined activity in vitro and vivo activity, toxicity test from standardized extract, the third steps were dosage form formulation and tested chemical and physical property. And the last steps were clinical trial on human volunteer and patient specific from its activity by collaboration with clinician in RSUD Dr Sutomo hospital in Surabaya. Preliminary findings : Universitas Airlangga via research group herbal medicine have been done to development scale up standardized ethanol extract from selected simplisia from Indonesian traditional raw material example : standardized ethanol extract from kumis kucing (Orthoshipon stamineus) , temu mangga (Curcuma mangga) , bawang putih (Allium sativum) and manggis (Garcinia mangostana). And also have been done to production herbal medicine as potential anticancer is combination sambiloto (Andrographis paniculata Ness) – kunyit (Curcuma domestica) standardized ethanol extract as breast cancer activity. The herbal as potential antihyperlipidemic were combination standardized ethanol extract from temulawak (Curcuma xanthorriza) and mengkudu (Morinda citrifolia) . Keywords: Standardized ethanol extract, herbal medicine, anticancer, anti hyperlipidemic activity . Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 395 396 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION Indonesian natural resources as a unlimited source of chemical substances and traditional medicines are national assets that must be continuously explored, examined, developed and optimized of their benefits. As a nation possessing high biodiversity and herbal medicine resources represent assets with abundant and superior values in the use and development of competitive commodities. Indonesian people consisted of about 400 ethnic groups. Each ethnic and subethnic has a wide knowledge of traditional medicines and medications, inherited from generation to generation. The evidences of the use of traditional medicines in Indonesia since centuries ago are represented in the relief of Prambanan and Borobudur temple, written in lontar leaf, and the inheritance in the King Palaces of Javanese and Madurese ethnics. Traditional medicines have been widely known as “jamu” (herbal medicines) either in sliced forms or servable powder. Rural communities since long time ago consumed temulawak (Curcuma xanthorrhiza) to maintain their physical fitness. Written information on herbal medicines is stored in Surakarta Palace Library entitled “Serat Kawruh” and “Serat Centhini”. Serat Kawruh presents a systematic information on herbal medicines, which contain 1,734 preparations made of natural elements and furnished by spells. The use and development of traditional medicines in such areas has been traditionally inherited through experience/empirical facts and later developed through scientific researches and preclinical and clinical test (Riswan and Harini, 2002). Strategy for product development of jamu as traditional medicines are based on “inheritance” and empirical approaches, meanwhile those generated from scientific approach through pre-clinical test, defined as standardized herbal.For those which have passed clinical test defined as phytopharmaca. The aims and study area of our group research in Department of Pharmacognosy and Phytochemistry of Faculty of Pharmacy, Universitas Airlangga is to development of standardized ethanolic extracts from selected herbs from Indonesian traditional raw material namely kumis kucing (Orthoshipon stamineus), temu mangga (Curcuma mangga), bawang putih (Allium sativum), manggis (Garcinia mangostana) and the production of standardized ethanolic extract of the combination of sambiloto (Andrographis paniculata Nees) and kunyit (Curcuma domestica) as anti breast cancer activity; antihyperlipidemic activity from temulawak (Curcuma xanthorriza) and mengkudu (Morinda citrifolia). 2 2.1 MATERIALS AND METHODS Materials Leaves from kumis kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) and pericarpium manggis (Garcinia mangostana), aerial part of sambiloto (Andrographis paniculata Nees), rhizoma from kunyit (Curcuma domestica) , rhizoma from temulawak (Curcuma xanthorrhiza Roxb) and fruit from mengkudu (Morinda citrifolia L) collected from Materia Medica, Batu, Malang , East Java, Indonesia , then it were dried using oven at temperature of 450C , after it were dried , it were powdered and it were ready to be used are research material. Asea Uninet Scientific and Plenary Meeting 2016 2.2 | 397 Extraction The powdered of raw materials were extracted with ethanol 70% by using maceration method. Then filtered, and maceration is continued until the clear solution was obtained. The resulting solution is concentrated by using rotary vacuum evaporation at temperature 500C. Standardized Ethanol Extract Extract Characterization: Organoleptic test: Organoleptic test consists of shape, color, smell and flavor of extract. TLC(Thin Layer Chromatography) Profile of Extract: The chromatography profile of ethanolic extract of leaves from kumis kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) and pericarpium manggis (Garcinia mangostana), were made using TLC F254 aluminium plate as stationary phase and many other composition mobile phase by using standard compound active such as sinensetin, α -mangostin and curcuminoid as the comparison. And also determined of quantified from sinensetin, α -mangostin and curcuminoid from kumis kucing, manggis and temu mangga respectively. 2.3 Determination Bacteria Total and Fungus Total Determination of Bacteria Total: With sterile pipette, 1 mL of extract with pipet steril10 dilution was implanted in NA medium, then it was incubated at 370C temperature for 24 hours. It was observed and calculated the colony amount growing and multiplied by dilution factor Determination of Fungus Total: The extract with 10-4 dilution was pipette by using sterile pipette and implanted in PDA medium, then it was incubated at 250C for 3 days. It was observed and calculated the colony amount growing and multiplied by dilution factor5 Test of Heavy Metal Contamination: The determination Pb limit at ion in the methanolic extract was conducted by usung wet destruction with nitric acid and hydrogen peroxide. Pb levels were determined by atomic absorption spectrophotometer Clinical Trial Combination of Extract Sambiloto-Kunyit at Breast Cancer in RSUD Dr Sutomo Hospital Surabaya 2.4 Design Research The research method used in this study were Randomized Controlled Trial-paralled Design (Double blind). First group received combination of ethanol extract- chemotherapy of cyclophosphamide, doxorubicin, and fluorouracil while the second group only received chemotherapy of cyclophosphamide, doxorubicin, and fluorouracil Patient eligibility and selection Patients were eligible breast cancer stage II / III that have not received any therapy, Eastern Cooperative Oncology Group (ECOG) performance status of 0-2, women (21 years and up to 65 years). Patient were not eligible if they were men, never received specific treatment (radiotherapy, chemotherapy, hormones, treatment with other modalities (such as surgery). surgery), pregnancy, all severe lung disease (anamnesis and photos with thorax), have abnormalities of liver disease (SGOT and SGPT values above 2.5 times the upper limit). All patients provided written informed consent. Patient withdrew this study participation 398 | Asea Uninet Scientific and Plenary Meeting 2016 if data are incomplete and therefore could not be observed further, patients did not proceed according to schedule or change of chemotherapy. Test antihypercholestorelmia from combination extract of temulawak and mengkudu ini vivo by high fat diet The rats were fed with hypercholesterolemia diet for 10 days to induce hyperlipidemic except normal control group rats which received normal diet. The composition of hypercholesterolemia diet was cholesterol (1%), coconut oil (49%),) and sucrose (50%) and PTU 0,02% . Growth rate was monitored during the treatment. The rats were divided into six groups comprising of six animals each (n=6). The standard drug atorvastatin and gemfibrozil, extracts were suspended in 0.3%w/v carboxymethyl cellulose (CMC) for oral administration. Group I. Normal control group (NC); rats received 0.3% CMC. Group II. Hyperlipidemic control group (HL); rats were administered with high fat diet for 28days. Group III. Test group A; rats were administered with high fat diet and treated with extract 137mg/kg/day p.o for 28days. Group IV. Test group B; rats were administered with high fat diet and treated with extract 411mg/kg/day p.o for 28days. Group V. Test group C; rats were administered with high fat diet and treated with extract 686mg/kg/day p.o for 28days. Group VI. Standard drug group D; rats were administered with high fat diet and treated with atorvastatin 0,9mg/kg/day p.o for 28days. Group VI. Standard drug group E; rats were administered with high fat diet and treated with gemfribrozil 27mg/kg/day p.o for 28days The blood samples were collected from rats for biochemical estimations by retro orbital sinus puncture at the end of 28th day of the experimental protocol, samples were immediately centrifuged and assayed Serum TC, triglycerides and HDL-C were estimated using commercially available kits. 3 FINDING OF RESEARCH Standardized Ethanol Extract from leaves from kumis kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) and pericarpium manggis (Garcinia mangostana) : Orthosiphon Powder are powder of air dried leaves `from Orthosiphon stamineus Benth. Asea Uninet Scientific and Plenary Meeting 2016 | 399 Figure 1. : Orthosiphonis Extract Powder Test Specification Result Assay (TLC-Densitometry) Sinensetin 0.128% Powder Toxicology Test Sample No. Parameter Result Unit Orthosipon Extract Powder 1 2 3 4 5 6 Arsen (As) Lead (Pb) Copper (Cu) Cadnium (Cd) Mercuri (Hg) Pesticide : Organo- Chlorin Group Pesticide : Organo- Phospate Pesticide : Carbamate Group < LoD 1,333.10-3 0,164 < LoD 5,822.10-2 0,006 < LoD 1,667.10-3 ppm ppm ppm ppm ppm - 7 8 Negative Negative Negative - Powder Microbiological Test Sample No. Parameter Orthosipon Extract Powder 1 Total Plate Count (TPC) 2 3 Total Plate Count of Yeast Total Plate Count of Mould Result Method 300 x 102 Cfu/g 90 x 103 Cfu/g Pour Plate < 10 Cfu/g 4 Salmonella sp. Negative 5 Staphylococcus aureus Negative 6 E. Coli Negative Pour Plate Pour Plate Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate 400 | Asea Uninet Scientific and Plenary Meeting 2016 7 Pseudomonas aeruginosa Negative (Isolation and Identification) Pour Plate (Isolation and Identification) Curcuma Powder are powder of air dried rhizoma from Curcuma mangga Figure 2. : Curcuma Extract Powder Test Specification Result Assay (TLC-Densitometry) Curcuminoid 0.132% Powder Toxicology Test Sample No. Parameter Result Unit Curcuma Extract Powder 1 2 3 4 5 6 Arsen (As) Lead (Pb) Copper (Cu) Cadnium (Cd) Mercuri (Hg) Pesticide : Organo- Chlorin Group Pesticide : Organo- Phospate Pesticide : Carbamate Group < LoD 1,333.10-3 0,169 < LoD 5,822.10-2 0,002 < LoD 1,667.10-3 ppm ppm ppm ppm ppm - 7 8 Negative Negative Negative - Powder Microbiological Test Sample No. Parameter Result Method Curcuma Extract Powder 1 Total Plate Count (TPC) Total Plate Count of Yeast Total Plate Count of Mould 56 x 104 Cfu/g Pour Plate Pour Plate 2 3 190 Cfu/g < 10 Cfu/g Pour Plate Asea Uninet Scientific and Plenary Meeting 2016 4 Salmonella sp. Negative 5 Staphylococcus aureus Negative 6 E. Coli Negative 7 Pseudomonas aeruginosa Negative Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Garlic Powder are powder of air dried bulbus from Allium sativum Figure 3. : Garlic Extract Powder Powder Toxicology Test Sample Garlic Extract Powder No. 1 2 3 4 5 6 7 8 Parameter Arsen (As) Lead (Pb) Copper (Cu) Cadnium (Cd) Mercuri (Hg) Pesticide : Organo- Chlorin Group Pesticide : Organo- Phospate Pesticide : Carbamate Group Result Unit -3 < LoD 1,333.10 0,145 < LoD 5,822.10-2 0,005 < LoD 1,667.10-3 ppm ppm ppm ppm ppm - Negative - Negative - Negative Powder Microbiological Test Sample Garlic Extract Powder No. 1 2 Parameter Total Plate Count (TPC) Total Plate Count of Yeast Result Method 3 11 x 10 Cfu/g 360 Cfu/g | 401 Pour Plate Pour Plate 402 | Asea Uninet Scientific and Plenary Meeting 2016 3 Total Plate Count of Mould < 10 Cfu/g 4 Salmonella sp. Negative 5 Staphylococcus aureus Negative 6 E. Coli Negative 7 Pseudomonas aeruginosa Negative Pour Plate Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Garcinia Powder are powder of air dried pericarpium from Garcinia mangostana Figure 4. : Garcina Extract Powder Test Specification Result Assay (TLC-Densitometry) Alfa-mangostene 1,13 % Powder Toxicology Test Sample No. Parameter Result Unit Garlic Extract Powder 1 2 3 4 5 6 Arsen (As) Lead (Pb) Copper (Cu) Cadnium (Cd) Mercuri (Hg) Pesticide : Organo- Chlorin Group Pesticide : Organo- Phospate Pesticide : Carbamate Group < LoD 1,333.10-3 0,182 < LoD 5,822.10-2 0,013 < LoD 1,667.10-3 ppm ppm ppm ppm ppm - 7 8 Negative Negative Negative - Asea Uninet Scientific and Plenary Meeting 2016 | 403 Powder Microbiological Test Sample No. Parameter Result Method Garlic Extract Powder 1 Total Plate Count (TPC) Total Plate Count of Yeast Total Plate Count of Mould 12 x 103 Cfu/g Pour Plate Pour Plate 4 Salmonella sp. Negative 5 Staphylococcus aureus Negative 6 E. Coli Negative 7 Pseudomonas aeruginosa Negative 2 3 360 Cfu/g < 10 Cfu/g Pour Plate Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Pour Plate (Isolation and Identification) Result Clinical Trial Combination of Extract Sambiloto-Kunyit at Breast Cancer in RSUD Dr Sutomo Hospital Surabaya Patients characteristic Between December 2010 and June 2011, a total 36 outpatients in Poli Onkologi Satu Atap Dr. Soetomo hospital were divided into two groups, control and treatment group in this study. Baseline patients characteristic are summarized in table 1. Eighteen patients received neoadjuvant Cyclophosphamide, Doxorubicin, Fluorouracil with herbal of mixed sambiloto and turmeric extract. Figure 5. Andrographis paniculata extract and turmeric mixture at λ 254 nm with eluent CHCl3: methanol = 1:1 using the instrument densitometer TLC Scanner 3 with a UV detector 404 | Asea Uninet Scientific and Plenary Meeting 2016 Table 1. Baseline Characteristic of the Subject Control Treatment Significant (p) Age in years 50.39±6.482 47.28±6.763 0.223 8.7±2.3620 9.9±3.7432 0.247 1 17 (2.94 ±0.236) 1 17 (2.94 ±0.236) 1.000 41.67±15.703 41.94±13.824 0.955 42.11±5.519 39.33±5.380 0.135 39.56±5.382 41.22±9.434 0.519 39.17±4.342 39.44±12.439 0.929 (Mean±SD) Diameter tumor before traement (Mean±SD) Stadium II III Mean±SD Remaining capsules Cycle I (Mean±SD) Cycle II (Mean±SD) Cycle III (Mean±SD) Cycle IV (Mean±SD) Fig 6. Average CEA ∆Control with ∆Treatment ± SEM Fig 7. Average CA 15-3 ∆Control with ∆Treatment ± SEM Asea Uninet Scientific and Plenary Meeting 2016 | 405 From figure 6 there were 4 patients who did not continue because they withdrew and for treatment group only 1 patient did not continue. CEA values in the control group only fell in two patients and one patient is stable, while the treatment group fell only in 1 patient, and 1 patient was stable. Tumor marker CEA in the treatment group should be lower than control group but still higher than control group. The average CA 15-3 in the control group and treatment group can be seen in figure 7. From week 3 until week 6 CA 15-3 treatment group was lower than control group but week 9 till week 12 CA 15-3 treatment group higher than control group. Statistical Analysis showed that after a 12 week treatment, CA 15-3 control group was lower that treatment group. Fig 8. Average Diameter ∆Control with ∆Treatment ± SEM Fifteen patients from eighteen patients were decreased in diameter tumor and 3 patients stable in control group while 16 patients decreased and 3 patients stable in treatment group (Figure 8). The study was conducted in patients with early tumor diameter greater than 5 cm except in 1 patient in treatment group with a diameter of 3.5 cm. In control group, platelets increase in 7 patients compared to before treatment. While in the treatment group platelets increased only in 5 patients and decreased in 13 patients (Figure 9.). 406 | Asea Uninet Scientific and Plenary Meeting 2016 Fig 10. Average Leukocyte ∆Control with ∆Treatment ± SEM Leukocytes in control group after 12 weeks giving chemotherapy decreased in 14 patients while in treatment group decreased in 17 patients and 1 patient was stable. Fig 11. Average Hemoglobin ∆Control with ∆Treatment ± SEM Hemoglobin in control group only decreased in four patients and there was none in treatment group. Result of test antihypercholestorelmia from combination extract of temulawak and mengkudu in vivo by high fat diet Figure 12. Morinda citrifolia Extract Figure 13.Curcuma xanthorriza Extract Asea Uninet Scientific and Plenary Meeting 2016 | 407 Figure 14. Rats body weight before induction, after induction, and after treatment Figure 15. Effect of combination extract of temulawak and mengkudu on concentrations of TC (Total Cholesterol) Figure 16. Effect of combination extract of temulawak and mengkudu on concentrations of TG (Triglyceride) 408 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 17. Effect of combination extract of temulawak and mengkudu on concentrations of LDL Figure 18. Effect of combination extract of temulawak and mengkudu on concentrations of HDL The oral administration of high fat diet for 28days to rats produced a significant (p<0.01) increase in serum TC, LDL, and triglycerides as compared to normal control rats. These significant rises were accompanied by significant (p<0.01) decline of serum HDL as compared to normal control rats. The treatment with combination extract of temulawak and mengkudu (411mg/kg and 686 mg/kgBB) and standard drug atorvastatin (0,9 mg/kg/day p.o.) to high fat rats resulted in significant (p<0.01) decline in serum TC, LDL and TG ( triglycerides) as compared to hyperlipidemic control rats (Fig. 1). Treatment with combination extract of temulawak and mengkudu did not modulate the increased serum HDL level. 4 DISCUSION Discusion Production of Standardized Ethanol Extract Production of standardized ethanol extract from leaves kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) and pericarpium manggis (Garcinia mangostana) were extracted with ethanol 70% by using maceration by scale up method by industrial extractor, with approximately 150 kg of simplisia respectively. Then filtered, and maceration is continued until the clear solution Asea Uninet Scientific and Plenary Meeting 2016 | 409 was obtained. The resulting solution is concentrated by using rotary vacuum evaporation at temperature 500C and than dried with microcell and corn-starch. Characterization test of extract referred to the Indonesian Herbal Pharmacopoeia (FHI) wich include the quantification of marker compound by tlc- densitometry method and test of toxicology and microbial test . The standardized ethanol extract from leaves kucing (Orthoshipon stamineus) used sinensetin as marker compound, and curcuminoid as marker compound for standardized ethanol extract rhizoma of temu mangga (Curcuma mangga) and standardized ethanol extract from pericarpium manggis (Garcinia mangostana) used alpha-mangostene as marker compound. The results showed that each had levels of marker compounds are 0,128% ; 0,132% and 1,13% respectively. Microbe contaminant and the metal contaminant test aims to observe whether all standardized ethanol extract have been production is standardized ethanol extract , it can be conducted that the products meets the applicable requirements as traditional raw material according to Indonesian Herbal Pharmacopoeia and Indonesia extract monograph. Discusion of Clinical Trial Combination of Extract Sambiloto-Kunyit at Breast Cancer This research was conducted to compare the reduction in CA 15-3; CEA; Diameter; and increasing leukocytes; platelets; hemoglobin in 36 patients with breast cancer stage II / III who received complement Sambiloto (Andrographis paniculata Nees.)-Turmeric (Curcuma domestica Val.) - chemotherapy of cyclophosphamide, doxorubicin, and fluorouracil greater than patients who only received chemotherapy of cyclophosphamide, doxorubicin, and fluorouracil. Parameter CA 15-3; CEA, and diameter used in the monitoring and evaluation of patients with breast cancer who had metastatic regional parameters while platelets, leukocytes, and hemoglobin aims to see whether Sambiloto (Andrographis paniculata Nees.)-Turmeric (Curcuma domestica Val.) can increase hematological blood since chemotherapy often cause a decrease in platelets, leukocytes, and hemoglobin patients. Examination of these parameters data can complement the results of previous studies on the efficacy of sambiloto and turmeric extract as a breast-cancer apoptosis. From the absolute value of CEA in both control patients and treatment patients, there were CEA values in week-6 that actually rose compared to the 3rd week. This was due to a reversible reaction that occured after administration of chemotherapy that led to increased tumor cell death that caused the release of massive CEA into the blood circulation or increasing CEA values reflecting the progression of the disease. But the decline in CEA indicates that metastatic breast cancer patients is a response from chemotherapy treatment (Esteva et al, 2008). Another research done by Sharma et al that the administration of curcumin doses of 36-180 mg daily for 4 months in 15 patients with advanced colon cancer who are resistant to chemotherapy CEA values fell only in 1 patient only (Sharma et al, 2004) whereas in this study, the value of CEA in the control group fell only in 2 patients, while 1 patient in the treatment group after 12 weeks of drug administration. Tumor marker CEA (Figure 6) in the treatment group should have decreased more than the control group but it seemed that during the 12-week drug treatment group CEA values remained higher even at week 9 and inweek 12 decreased. Although the value of CEA in 2 patients control group and 1 patients treatment group declined but this reduction was not significant. So from figure 6 it can be concluded that the administration of a mixture of extract of Sambiloto (Andrographis paniculata Nees.) and turmeric (Curcuma domestica Val.) did not cause a decrease. 410 | Asea Uninet Scientific and Plenary Meeting 2016 For the assessment of tumor marker CA 15-3 (Figure 7) appeared lower in week3 and week-6 in treatment group than the control group but decline reversed in week 9 and week 12 where decrease in the CA 15-3 was greater than the control group but the remaining treatment group showed no significant difference. CA 15-3 is a tumor marker most widely used test-mucin MUC1 gene overexpressed in many adenocarcinomas in various glycosylated forms. Circulating CA 15-3 in human body in high level identical to a malignant tumor, advanced stage, and a poor prognosis. Circulating levels of CEA and CA 15-3 in the body makes the CEA and CA 15-3 diagnostic tools fast, painless, reproducible, and quantitative parameters to keep track of patient therapy. In this study, the value of CA 15-3 decreased 7 patients in the control group whereas in the treatment group decreased 9 patients. The results of statistical analysis showed that after 12 weeks of drug administration there was no significant decrease between the control group and the treatment group. Curcumin is also given as a complement Doxetacel in 14 advanced breast cancer patients and metastases by 8 g for 7 consecutive days after chemotherapy. After the sixth cycle, Robert et al reported that CA 15-3 did not show significant differences but CEA in 5 patients decreased significantly after 3 cycles of chemotherapy (Robert et al, 2010). In figure 8 it can be seen that the decrease in the average diameter treatment group is greater than the average control group. diameter difference though when compared showed no significant decrease. In addition, the study was conducted in patients with stage II / III where the initial tumor diameter was greater than 5 cm except in 1 patient treatments (3.5 cm) but still in the stage of enforcement of the criteria according to the American Joint Committee for Cancer. We hope when a mixture of Sambiloto (Andrographis paniculata) and turmeric (Curcuma domestica) is given to patients with tumor diameter smaller than 5 cm is expected to deliver better outcomes for patients. Curcumin given topically on DMBA-induced hamster cheek showed reduction of tumor diameter to 39% and using a combination of curcumin in mice induced Bertozomib multiple myeloma tumor type U266 and showed a significant reduction (p <0.001) (Li et al, 2002; Sung et al, 2009). For the platelets in figure 9, it can be seen that the platelet treatment group was lower than the control group although the decrease was not statistic different except in week 9. The results of this study showed that only 7 patients had increased platelet in control group while in the treatment group there were only 5 patients out of 18 patients. Independent statistical analysis of the results showed that there was no significant increase in platelet count in both the control group and the treatment group after 12 weeks of drug administration. Theoretically both andrographolide and curcumin could significantly inhibit platelet formation. Andrographolide and 14-deoxy-11 ,12didehidroandrograpfolida in Sambiloto inhibit platelet aggregation induced by thrombin concentrations (1-100 μM) in rats (Thisoda et al, 2006). Similarly, in a study conducted on eight dogs which were given extracts of Andrographis paniculata plant roots showed that these plants inhibit TXA2 production, stimulates the synthesis of platelet cAMP and interfere with platelet aggregation, preventing the formation of thrombin (Zhao and Fang, 1991). Andrographolide besides providing anti-platelet effect was also confirmed by curcumin. Curcumin can inhibit platelet formation in Brain microvascular endothelial cells (BMECs) in vitro because of an inhibition effect on the expression of P-selectin, E-selectin, and GPIIb / GPIIIa ( Zhang et al, 2008). Platelet aggregation inhibition effect on curcumin was also revealed by Nemmar et al who conducted a study on mice exposed to diesel dust particles and were given curcumin before exposure. Apparently administration of curcumin before exposure can prevent TNF alpha and plasminogen activator inhibitor (PAI-1) in which PAI-1 is involved in the process of blood clotting (Nemmar et al, 2012). So the results of this study showed that the extract in the treatment group actually suppresses Asea Uninet Scientific and Plenary Meeting 2016 | 411 platelet production despite the calculation of statistical analysis that showed no significant difference but we still need to watch the extract mixed use. One of the studies relating to the use of curcumin to boost the immune system by Li and Liu is that curcumin increased phagocytosis of macrophages and lymphocytes in the spleen regulate cleavage of mice for suppressing the expression of NFkappaB p65 (Li and Liu, 2005). Providing curcumin in mice also increased the total number of white blood cells circulating antibody titers and phagocytic activity increased significantly p <0.001 (Antony et al, 1999). Curcumin also increases the cytotoxic effects of NK cells for suppressing the formation of NF- kappaB (Yadav et al, 2005). Giving Andrographis paniculata in HIV patients showed an increase in CD4 (+) lymphocytes was significant but there were no statistically significant changes in mean plasma HIV-1 RNA (Calabrese et al, 2000). But the effect of andrographolide and curcumin on increasing leukocytes did not appear in this study (Fig. 10) after 12 weeks of drug administration. From the first three weeks until the 12th week it appeared that leukocyte treatment group still went up and down or not stable yet. From the 15 control patients only 1 patient showed increase in leukocytes and none for patient treatment. Phase II clinical trial in 25 patients with advanced pancreatic cancer were given 7200 mg of curcumin for 2 months without receiving any treatment such as chemotherapy, radiotherapy, although they receive supportive care. Examination of tumor marker CA 19.9; CA 27.29; CA 125, and CEA and the result is two patients showed that the clinical biological activity (CA 19.9 level was not increased and the level of CA 125 was increased but decreased slowly after administration of curcumin in 1 year), one patient after 18 months showed stable disease, and one patient showed tumor regretion to 73% with an interleukin significant increase (IL-6, IL-10, and IL-1 receptor antagonist) (Dhillon et al, 2008). In line with the research Dhillon et al, curcumin and andrographolide dose may need to be increased and the duration of administration needs to be extended. In figure 11 we can see that hemoglobin in treatment group increased until week 9. But in week 12 hemoglobin treatment group decreased until minus but the value was still higher compared to control group. Eventough hemoglobin in treatment group was higher than control group there was no statistically significant difference. This study is in line with Unnikrishnan and Rao’s research which antioxidant properties owned by curcumin and three derivatives (desmetoksikurkumin, bisdemethoksikurkumin, and diasetilkurkumin). The results show that both the curcumin, desmetoksikurkumin, and bisdemethoksikurkumin have protective effects on hemoglobin but diasetil protective effects of curcumin are very small, methoxy substitution is thought to play no role in the biological activity (Unnikrishnan and Rao, 1995). Discucion test antihypercholestorelmia from combination extract of temulawak and mengkudu Recently, a number of clinical studies suggest that the increased risk of coronary heart disease is associated with a high serum concentration of TC, LDL-C and triglyceride. The abnormally high concentration of serum lipids is mainly due to the increase in the mobilization of free fatty acids from the peripheral depots (Ahmed at al., 2001). On the other hand, low serum concentration of HDL-C is also responsible for coronary heart disease (Parab, 2002). Preclinical observations demonstrate that hyperlipidemia promotes accumulation of oxidatively modified low density lipoproteins (OX- LDL) in the arterial wall, promoting endothelial dysfunction and development of atherosclerosis and congestive heart diseases (Aikawa, 2004 ; Takahashi and Zu, 2005). 412 | Asea Uninet Scientific and Plenary Meeting 2016 From the results above showed that administration of C. xanthorrhiza and M. citrifolia extract combination increased LPL expression (Sukardiman et al, 2015). Compounds that may be responsible for increasing LPL expression after administration of C. xanthorrhiza and M. citrifolia extract combination is scopoletin in M. citrifolia. A research conducted by Yang et , 2007 showed that scopoletin increased LPL activity in culture medium 3T3-L1 adipocytes with transcriptional control mechanism by increasing LPL mRNA level. Scopoletin also partially reversed tumor necrosis factor-α-induced supression of LPL activity. These results suggest the possible action of scopoletin in M. citrifolia as a facilitator of plasma trigliceryde cleareance. The other mechanism of C. xanthorrhiza and M. citrifolia extract combination decreased NPC1L1 expression. Compounds that may be responsible for decreasing of NPC1L1 expression after administration of C. xanthorrhiza and M. citrifolia extract combination is curcumin in C. xanthorrhiza (Sukardiman et al.,2015). A research conducted by Feng et al (2010) showed curcumin pretreated cells inhibited cholesterol uptake mediated by NPC1L1 in Caco-2 cells in vitro. Curcumin-induced inhibition of cholesterol uptake was associated with significant decrease in the levels of NPC1L1 protein and NPC1L1 mRNA, as analyzed bWestern blot and qPCR, respectively. Kumar et al (2011) investigate the effect of curcumin on NPC1L1 function, expression, and promoter activity in intestinal Caco-2 monolayers. Curcumin treatment of Caco-2 monolayers also significantly decreased NPC1L1 mRNA and protein expression. Similarly, the promoter activity of the NPC1L1 gene was inhibited significantly (55%) by 50 μM curcumin. These results suggest the possible action of curcumin in C. xanthorrhiza as a facilitator of plasma cholesterol cleareance. 5 CONCLUSION 1) 2) 3) 6 Based on the result of study , it can conducted that standardized ethanol extract from leaves kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) and pericarpium manggis (Garcinia mangostana) with scale up maceration method meets the quality requirement to use as traditional medicine raw amterial. 2. Clinical trial phase II/III in breast cancer patients complement extract capsules Sambiloto (Andrographis paniculata Nees.) and tumeric (Curcuma domestica Val.) there were no significant changes in the parameters of CEA, CA 15-3, diameter, leukocytes, platelets, and hemoglobin in the treatment group compared with the control group (between group). Only the diameter before and after treatment showed significant changes (P<0.05) in treatment group (within group) while increasing hemoglobin was also higher than after a 12 week treatment but no significant changes. 3. The study showed that administration of combination extract of temulawak (Curcuma xanthorhiza Roxb) and mengkudu (Morinda citrifolia L) at dose level 411mg/kg BW and 686mg/kg BW in rat is effective as hypolipidemic agent. SUGGESTION 1) Further research is needed to test the activity and toxicity tests of standardized extracts ethanol from leaves kucing (Orthoshipon stamineus) , rhizoma of temu mangga (Curcuma mangga) , bulbus from bawang putih (Allium sativum) Asea Uninet Scientific and Plenary Meeting 2016 2) 3) | 413 and pericarpium manggis (Garcinia mangostana) so that it can be developed into a standardized herbal dosage forms. Further research is needed to clinical trial phase II/III in breast cancer patients complement extract capsules Sambiloto (Andrographis paniculata Nees.) and tumeric (Curcuma domestica Val.) with the bigger sample of breast cancer patients more than 36. Further research is needed to collaboration with industrial pharmacy to produce and development combination extract of temulawak (Curcuma xanthorhiza Roxb) and mengkudu (Morinda citrifolia L) as hypolipidemic agent . REFERENCES I. Ahmed, M.S. Lakhani, M. Gillet, A. John, H. Raza, Diabetes Res. Clin. Pract., 2001, 51,155. Calabrese C, Berman SH, Babish JG, Ma X, Shinto L, Dorr M, Wells K, Wenner CA, Standish LJ., 2000. A phase I trial of andrographolide in HIV positive patients and normal volunteers. Phytother Res. Vol 5. No. 14. p: 333-8. Cullen, P., 2000. Evidence that triglyceride are an independent coronary heart disease risk factor. The American Journal of Cardiology. 86(9): 943-949 Depkes Republik Indonesia. (2000). Parameter Standar Umum Pembuatan Ekstrak Tumbuhan Obat. Jakarta. Depkes Republik Indonesia. (2008). Farmakope Herbal Indonesia : Edisi I, Jakarta,. Depkes Republik Indonesia.(1899). Materia Medika Indonesia : Jilid V. Jakarta, 1989. Esteva, F.J., Fritsce, H.A., Reuben, J.M., Cristofanilli., 2008. Serum Tumor Markers and Circulating Tumor Cells. Dalam: Hunt, K.K., Robb, G.L., Strom, E.A., Ueno, N.T. Breast Cancer 2nd. Springer Science + Business Media, LLC. Texas Feng, D., Ohlsson, L., Duan, R.D., 2010. Curcumin inhibits cholesterol uptake in Caco-2 cells by down regulation of NPC1L1 expression. Lipids in Health and Disease. 9:40-44 Herra Studiawan,Sukardiman, Lusiana Arifianti, Rakhmawati. (2013) : Pengembangan Bahan Baku Obat Tradisional dari Ektrak Bawang Putih, Ekstrak Kulit Maanggis dan Ekstrak Tapak Dara ; Program Fasilitasi Pengembangan Bahan Baku Obat dan Bahan Baku Obat Tradisional, Direktorat Binfarkes, Kemenkes RI. Kumar, P., Malhotra, P., Ma, K., Singla, A., Hedroug, O., Saksena, S., Dudeja, P., Gill, R., Alrefai, W., 2011. SREBP2 mediates the modulation of intestinal NPC1L1 expression by curcumin. American Journal of Physiology: Gastrointestinal and Liver Physiology. 301:148-155. Li, N., Chen, X., Liao, J., Yang, G., Wang, S., Josephson, Y., Han, C., Chen, J., Huang, M.T., Yang, C.S. 2002. Inhibition of 7,12dimethylbenz[a]anthracena (DMBA)-induced oral carcinogenesis in human by tea and curcumin. Carcinogenesis. Vol 23 No. 8 p.1307-1313 M. Aikawa, P. Libby, Cardiovasc. Pathol., 2004, 13, 125. 414 | Asea Uninet Scientific and Plenary Meeting 2016 Nemmar, A., Subramaniyan, D., Ali, B.H., 2012. Protective Effect of Curcumin on Pulmonary and Cardiovascular Effects Induced by Repeated Exposure to Diesel Exhaust Particles in Mice. Vol. 7 Issue 6 R.S. Parab, S.A. Mengi, Fitoterapia, 2002, 73, 451. Robert, M.B., Kwiatkowski, F., Leheurteur, M., Gachon, F., Planchat, L., Abrial, C., Reynier, M.A.M., Durando, X., Barthomeuf, C., Chollet, P., 2010. Phase I dose escalation trial of docetaxel plus curcumin in patients with advanced and metastatic breast cancer. Cancer Biol & Ther. Vol.1. No. 9. p: 8-14 Riswan,S and Harini Sangat,R. 2002. Jamu as Traditional Medicine in Java, Indonesia., South Pasific Study, Vol.23.No.1 Sharma, R.A., Euden, S.A., Platton, S.L., 2004. Phase I Clinical Trial of Oral Curcumin : Biomarkers os Systemic Activity and Compliance. Clin Cancer Res. Vol 10. p: 6847-6854 Saku, K., Gartside, P., Hynd, B., Kashyap, M., 1985. Mechanism of Action Gemfibrozil on Lipoprotein Metabolism. The Journal of Clinical Investigation. 75(5): 1702-1712. Sung,B., Kunnumakkara, A.B., Sethi, G., 2009. Curcumin Circumvents chemoresistance in vitro and potentiates the effect of thalidomide and bertozomib against human multiple myeloma in nude model. Mol Cancer Ther. Vol 8. p. 959-970 Sukardiman, Herra Studiawan, Abdul Rahman, Mulja Hadi S., Firsa Santosa. (2014) ; Ethyl Acetate fraction of Andrographis paniculata Ness Increase Cytotoxic Effect of 5 Flourouracil on Human Cancer Cell Lines, International Journal of Pharmacy and Pharmaceutical Sciences , Vol 6 Issue 5. Sukardiman, Suharjono, Nina Dewi Oktaviyanti. (2014). Immunohistochemical Study of Curcuma xanthorrhiza Roxb and Morinda citrifolia Ethanolic Extract Granule Combination in High Fat Diet Induced Hyperlipidemia Rats, International Journal of Pharmacy and Pharmaceutical Sciences, Vol 6, Issues 11. Sukardiman, Herra Studiawan, Lusiana Arifianti, Rakhmawati.(2013): Pengembangan Bahan Baku Obat Tradisional dari Ekstrak Bawang Putih, Ekstrak Kulit Maanggis dan Ekstrak Tapak Dara ; Program Fasilitasi Pengembangan Bahan Baku Obat dan Bahan Baku Obat Tradisional, Direktorat Binfarkes, Kemenkes RI. Thisoda, P., Rangkadilok, N., Pholphana, N., Worasuttayangkurn, L., Ruchirawat, S., Satayavivad, J., 2006. Inhibitory effect of Andrographis paniculata extract and its active diterpenoids on platelet aggregation. Eur J Pharmacol. Vol. 553 No.1 p. 39–45 Unnikrishnan, M.K., Rao, M.N., 1995. Inhibition of Nitrite induced oxidation of hemoglobin by curcuminoids. Pharmazie. Vol. 50 No. 7. p.490-492 Y. Takahashi, H. Zhu, T. Yoshimoto, Antioxidant and Redox Signaling, 2005, 7, 425. Yang, J.Y., Koo, J.H., Yoon, HY., Lee, J.H., Park, B.H., Kim, J.S., Chi, M.Y., Park, J.W., 2007. Effect of scopoletin on lipoprotein lipase activity in 3T3-L1 adipocytes. International Journal of Molecular Medicine. 20:527-531 Asea Uninet Scientific and Plenary Meeting 2016 | 415 Zhao, H.Y., Fang, W.Y. 1991. Antithrombotic effects of Andrographis paniculata nees in preventing myocardial infarction. Chin Med J. Vol. 104 No. 9 P. 770-775 IS THERE ANY IMPACT OF VDR GENE POLYMORPHISM APAI,FOKI AND BSMI IN BATAKS ETHNIC TO HAVE TUBERCULOSIS AND COULD VITAMIN D ALLEVIATE THIS INFECTION ? Yahwardiah Siregar yahwardiah@yahoo.com Department of Biochemistry, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia. Bintang YM Sinaga bymsinaga@yahoo.co.id Department of Pulmonology and Respiratory, Faculty of Medicine, Universitas Sumatera Utara - Adam Malik Hospital, Medan, Indonesia. Abstract Background: The active metabolite of vitamin D leads to activation of macrophage and restricts the growth of M. Tuberculosis intracelluler. The effect of vitamin D is achieved by binding to Vitamin D Receptor (VDR) ultimately produced cathelicidin and this may be influenced by polymorphisms in VDR gene. Objective: to explore the role of Vitamin D Receptor (VDR) gene ApaI-, FokI- and BsmI- polymorphisms in susceptibility to pulmonary tuberculosis (PTB) in Indonesian Batak ethnic population. Method: matched case-control study with 76 pulmonary tuberculosis patients and 76 healthy normal control. Genetic polymorphisms of VDR gene were analysed using PCR and RFLP. Statistic analysis was done using Epi Info program. Results: ApaI genotype for the PTB were AA 10.6%, Aa 43.4%, aa 46% and for the control were AA 10.6%, Aa 44.7%, aa 44.7%. The frequencies of FokI genotypes were FF 35.5% , Ff 55.3%, ff 9.2% for PTB patients and FF 39.5%, Ff 44.7.% and ff 15.8% for normal control. There are no significant differentiation between patients and controls for ApaI and FokI genotypes (p>0,05). The genotypes of ApaI and FokI polymorphism in cases and controls group were in Hardy-Weinberg Equilibrum (p>0,05). BsmI polymorphism had another result, i.e. BB 0%, Bb 68.4%, bb 31.6% for PTB patients and BB 2.6%, Bb 23.7% and bb 73.7% for the healthy group. There was a significant association between BsmI genotype and PTB; the bb genotype was associated with a decreased risk for PTB (OR 0.22, 95% CI: 0.110.45). Conclusion: ApaI and FokI polymorphisms of VDR gene do not appear to be responsible for host susceptibility to pulmonary Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 416 Asea Uninet Scientific and Plenary Meeting 2016 | 417 tuberculosis in Indonesian Batak ethnic population but BsmI polymorphism had association with host resistant to PTB. Keywords: Pulmonary tuberculosis, VDR polymorphism, Batak, Indonesia. 1 INTRODUCTION Tuberculosis (TB) is a contagious disease which is still the world's health problems to date. World Health Organization (WHO) reported that in 2013 was estimated to have 9 million people worldwide suffer from TB, which is 56% of cases in the region of South East Asia and West Pacific and 1,5 million deaths caused by TB. Among several transmission diseases, Pulmonary tuberculosis (PTB) is a high burden infectious disease in Indonesia. Environment and host genetic factors change the susceptibility to disease after mycobacteria infection.1,2 Many studies have convincingly indicated that genetic factor play a part in the disease enhancement. Vitamin D Receptor gene is one of the lately interested gene. The growth of Mycobacterium tuberculosis has been shown to be restrained following the administration of vitamin D. This effect is achieved through binding to vitamin D receptor (VDR) in macrophage therefore activate cathelicidin synthesis3, and consequently eliminate Mycobacterium tuberculosis in phagolysosome4. Those process might be affected by polymorphisms in the VDR gene. One of these polymorphism is FokI, transition C to T (ACG-ATG) at the first of the two potential translation initiation sites in exon 2, and can be distinguished by RFLP using endonuclease FokI. If translation start at the first ATG site (individuals with T allele, designated f), VDR protein synthesized full-length (427 amino acids). In contrast, if the translation start at the second ATG site (individuals with C allele, designated F), the VDR protein lack the three NH2-terminal amino acids5. Some studies showed that transcription of the F allele is 1.7 more than f allele6, F allele interact with transcription factor IIB more efficient and result in more potent VDR protein transcription7. The second polymorphism in this study is BsmI , which is located at intron between exon VIII and IX. The BsmI polymorphism control transcription level, transcription stability and post modification transcription of VDR gene8. The rest is ApaI polymorphism which is located at intron 8 illustate conversion from T to G. A indicate T allel and a means G allel 3 (Zmuda, 2000). ApaI variation could generate splicing errors henced affect to the protein synthesis. The potential roles of VDR FokI, ApaI and BsmI polymorphisms in the occurence of PTB have been investigated in many ethnic group. The different results maybe because of diversity in ethnic group. Meta analysis study by Gao (2010) found that in Asians, subjects with ff genotype were more susceptible to PTB and subjects with bb genotype have a decrease risk for PTB. However, none of the polymorphisms was significantly related to PTB among Africans or South Americans9. For the BsmI polymorphism in the European population, the variant homozygote and heterozygote genotypes were associated with a significantly decreased risk of tuberculosis when compared to the wild type homozygote10. ApaI polymorphism has no influence in the levels of VDR protein among 65 pulmonary tuberculosis (PTB) patients and 60 normal healthy subjects in Chennai, India11. Because the genetic effect may be different in various ethnic group, we undertook of this study to investigate in Indonesian Batak-ethnic population. 418 | Asea Uninet Scientific and Plenary Meeting 2016 2 2.1 METHODS Cases and Controls Pulmonary tuberculosis patients were recuited from several TB services in Medan city, Indonesia, from November 2012 to April 2013. The cases were newly diagnosed pulmonary tuberculosis patients, age 16-55 years old, Batak ethnic, have symptoms of pulmonary TB, positive sputum smear and chest radiography consistent with active disease. Cases who were HIV positive and known to present diabetes mellitus and other severe disease, imunnosupressive drug consumption were excluded from the study. A control group composed of sex, age and ethnically matched were healthy subjects with normal chest X ray and no history of previous tuberculosis. A control group were healthy workers like doctors, nurses and medical students. All participants were Batak ethnic for 3 generation. This study was approved by the Ethics Committee of the Faculty of Medicine, University of Sumatera Utara, Medan, Indonesia. 2.2 VDR genotyping All subjects were interviewed and informed consent were obtained. An anticoagulated peripheral blood specimen was collected and DNA was extracted (Promega, USA) and stored at minus 200C. Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) was used to identify ApaI, FokI and BsmI polymorphism of Vitamin D Receptor gene. The primer sequences used in this study were as follows: Forward primer: AGA GCA TGG ACA GGG AGC AAG; Reverse Primer: GCA ACT CCT CAT GGC TGA GGT CTC A for ApaI, Forward Primer: 5’-AGC TGG CCC TGG CAC TGA CTC TGC TCT-3’ and Reverse Primer: 5’-ATG GAA ACA CCT TGC TTC TTC TCC CTC-3’ for FokI. Forward Primer 5’CAA CCA AGA CTA CAA GTA CCG CGT CAG TGA-3’ and Reverse Primer: 5’AAC CAG CGG GAA GAG GTC AAG GG3’ for BsmI. PCR conditions were as follow denaturation at 940C for 5 min, followed by 35 cycles of PCR at 940C (30 sec), annealing at 610C for FokI and BsmI (30 sec), and 720C (1 min). ApaI proceed through 40 cycles of PCR at 940C (30 sec), annealing at 600C (30 sec) and extension at 720C (30 sec). Final extension was continued at 720C for 7 min. Following PCR, the amplified PCR products was digested with ApaI (NEB) restriction enzyme at 250C for 1 hour, FokI (Takara, Bio-Inc, Japan) restriction enzyme at 370C for 3 hours and BsmI (Thermo Scientific, Lithuania) restriction enzyme at 370C for 4 hours. Digested products were analyzed using electrophoresis in 2% agarose gel and ethidium bromide stained. The bands were visualyzed by Gel Documentation System. Depend on the digestion pattern of FokI polymorphism, individuals were scored as ff when homozygous for the presence of the FokI site (169 bp and 96 bp), FF when homozygous for the absence of the FokI site (265 bp), or Ff in case of heterozygosity (265 bp, 169 bp and 96 bp). Digestion of the amplified 745 bp ApaI PCR product gave two fragments, of 531 bp and 214 bp respectively if the product was excisable. Depending on the digestion pattern, individuals were scored as (aa) when homozygous for the presence of the ApaI site, (AA) when homozygous for the absence of the ApaI site, or (Aa) in case of heterozygosity. The digestion pattern of BsmI polymorphism were bb for the presence of BsmI site (175 and 650 bp), BB when homozygous for the absence of the BsmI site (825 bp), and Bb in case of heterozygote (825, 175 and 650 bp). Asea Uninet Scientific and Plenary Meeting 2016 2.3 | 419 Statistical Analysis The genotype frequencies of each SNPs compared by the Chi-square test. The strength of the association between VDR ApaI, FokI and BsmI polymorphisms and TB risk was evaluated by calculating odds ratio (OR) with 95% confidence interval (95% CI). The 2sided exact p value <0.05 was considered statistically significant. Conditional logistic regression was performed to calculate the odds ratio. Data were managed and analysed using Epi info. Hardy-Weinberg equilibrium test was done in case and control groups for ApaI, FokI and BsmI polymorphisms using the web tool HWE Testing calculator, available on line12; p<0.05 was considered as a significant disequilibrium. 3 FINDINGS The characteristics of PTB patients and normal control are summarized in Table 1. Sex, age and ethnic characteristics between PTB patients and controls were matched. The results of VDR genotyping for PTB patients and healthy controls are summarized in Table 2. Table 1. Characteristic of PTB cases and controls group Characteristic Sex Male Female Sex 16-25 26-35 36-45 46-55 Ethnicity (Batak) Cases Controls P value n (%) n (%) 53 (69.7) 23 (30.3) 53 (69.7) 23 (30.3) 1.000 22 (28.9) 32 (42.1) 14 (18.4) 8 (10.5) 76 (100) 22 (28.9) 32 (42.1) 14 (18.4) 8 (10.5) 76 (100) 1.000 1.000 The characteristics of PTB patients and normal control are summarized in table 1. There was no significant difference in sex, age and ethnic between PTB patients and controls (p=1.000). Table 2. Allele frequencies and genotype of VDR gene ApaI, FokI and BsmI polymorphism in PTB cases and controls. Polymorphism ApaI Genotype Total Cases Controls n (%) n (%) AA 8 (10,6) Aa 33 (43,4) aa 35 (46,0) 76 (100) Allele frequencies 8 (10,6) 34 (44,7) 34 (44,7) 76 (100) p 0.987 HWE in cases HWE in controls X2 (p) X2 (p) 0 (>0.05) 0.01(>0.05) 420 | Asea Uninet Scientific and Plenary Meeting 2016 A a 51 (33.6) 101 (66.4) 152 (100) 50 (32.9) 102 (67.1) 27 (35.5) 42 (55.3) 7 (9.2) 76 (100) 30 (39.5) 34 (44.7) 12 (15.8) 76 (100) 0.314 96 (63.2) 94 (61.8) 0.813 56 (36.8) 152 (100) 58 (38.2) 152 (100) 0 2 (2.6) Bb 52 (68.4) 18 (23.7) bb 24 (31.6) 56 (73.7) 76 (100) 76 (100) 52 (34.2) 22 (14.5) 100 (65.8) 152 (100) 130 (85.5) Total FokI Genotype FF Ff ff Total Allele frequencies F f Total BsmI Genotype BB Total Allele frequencies B b Total 1.000 152 (100) <0.001 2.67 (>0.05) 0.21(>0.05) 20.55(<0.05) 0.14(>0.05) <0.001 152 (100) HWE, Hardy- Weinberg Equilibrium; p<0.05 was considered as significant disequilibrium. The results of VDR genotyping for PTB patients and healthy controls are summarized in table 2. PTB patients and healthy controls had similar distribution for ApaI genotype and allele frequencies (p>0.05) and for FokI as well. On the BsmI genotype and allele frequencies, there was a significant differences between PTB patients and healthy controls (p<0.001). The genotypes of ApaI, FokI polymorphism in cases and controls group were in Hardy-Weinberg equilibrium (p>0.05) and BsmI polymorphism in controls group as well. The BsmI polymorphism in cases group was not in Hardy-Weinberg equilibrium (p<0.05). Relation between ApaI, FokI and BsmI polymorphisms and pulmonary tuberculosis are summarized in Table 3. Asea Uninet Scientific and Plenary Meeting 2016 | 421 Table 3. Analysis of VDR gene ApaI, FokI and BsmI polymorphisms in PTB cases and controls Polymorphism Cases Controls n (%) n (%) ApaI Genotype AA 8 (10.6) Aa 33 (43.4) 8 (10.6) 34 (44.7) aa 35 (46.0) 34 (44.7) Genotype FF 27 (35.5) Ff 42 (55.3) 30 (39.5) 34 (44.7) OR (95% CI) 1 0,98 (0,33 – 2,91) * 1,03 (0,34 – 3,06) * p 0.964 0.964 FokI ff 7 (9.2) BsmI Genotype BB 52 (68.4) + Bb bb 24 (31.6) 12 (15.8) 1 1.39 (0.69 – 2.77)* 0.64 (0.22 – 1.86)* 20 (26.3) 1 56 (73.7) 0.22 (0.11-0.45) * 0.352 0.418 <0.001 *Odds ratio was calculated using conditional logistic regression analysis. Relation between ApaI, FokI and BsmI polymorphisms and pulmonary tuberculosis are summarized in table 3. There was no significant association between ApaI polymorphism and PTB (OR 0.98, 95% CI:0.33-2.91) for Aa genotype and aa genotype (OR 1.03, 95% CI:0.34-3.06). Relation FokI polymorphisms and PTB (OR 1.37, 95% CI: 0.69-2.73) for Ff genotype and (OR 0.65, 95% CI: 0.22-1.89) for ff genotype, have no association as well . On the BsmI polymorphism, the bb genotype was associated with a decreased risk to PTB (OR 0.22, 95% CI: 0.11-0.45). 4 DISCUSSION Propensity to TB infection is the multipart interaction between host, bacteria (agent) and environment. One of the host factor that affect the susceptibility to PTB is host genetic. Evaluation to some research showed that population or various ethnic gives different results. No significant relationship between VDR ApaI and FokI polymorphism and TB in this study were also found in Asian population in Korea13, India14, China9, Iran15, Africa1417 and South American population18. A meta analysis among Asian population demonstrate that ff genotype was associated with susceptibility to TB9. Association between FokI polymorphism and TB has been found in Han population in China21 and males in India22. A meta-analysis in China on Han ethnic illustrate an association between ff genotype FokI polymorphism of VDR gene with PTB23. Other meta-analysis from 13 studies confirmed association between ff genotype FokI polymorphism with TB24 as well. No correlation between BsmI polymorphism of VDR gene and TB were found on studies from Africa17,28 and Asia i.e. India25, and Korea13. Another studies from Asia i.e. Iran26 and Turki27 and from Africa28 showed that bb genotype was protective factor to TB, while in another study, bb genotype correlated to the susceptibility to TB in Iran15,30. 422 | Asea Uninet Scientific and Plenary Meeting 2016 Among Asian population using meta-analysis from 15 studies demonstrate that b allele and bb genotype associated with decreased risk to TB30. For the BsmI polymorphism in the European population, the variant homozygote and heterozygote genotypes were associated with a significantly decreased risk of tuberculosis when compared to the wild type homozygote (bb+Bb vs BB)10. In this study, we found that bb genotype was associated with decreased risk to PTB. Different results of this research compared to others, came from some reasoning. One of them is ethnic factor. Indonesia has more than 300 ethnics and this study restricted to Batak ethnic Indonesian population only, to prevent genetic bias from ethnic influence. Ethnicity is found to be very important factor on genetic function in PTB. ApaI polymorphism for PTB patients in Chennai, India was 60.76% for A allele and 39.23% for a allele11 and this was similar for TB in Bandung, Indonesia that was frequency of A allele 59.5% and for a allele was 40.5%31 while frequency of A- and a- allele in Batak ethnic in Medan was differ, i. e 33.6% and 66.4% respectively. The distribution of FokI allele in the world diverge between populations or ethnics. Frequency of F allele in North Indian population was 71.5% and f allele was 28.5%32, comparable to Chennai, India the frequency of F allele was 76.6% and f allele was 23.3%11, whereas in this study (Batak ethnic in Medan, North Sumatera) the frequency of F allele was 61.8% and f allelle was 38.2% and this is vary from population in Bandung, Indonesia which is 22.6% for F allele and 77.4% for f allele31. Frequency of f allele is lower among African race (24%) if compared to the Caucasians (34%) and Asians (51%)33. For BsmI polymorphism, the frequency of B allele in PTB patients in Chennai, India was 58.46% and for b allele was 41.53%11 but in this study, the frequency of B allele and b allele were 34.2% and 65.8% respectively. This results also vary form TB patients in Bandung, Indonesia, i.e. frequency of B allele was 14.3% and frequency of b allele was 85.7%31. The frequency of B allele is 7% among Asians, 36% among Africans and 42% among Caucasians 33. Another studies found the BsmI bb genotype frequency was 2% among Asians, 5% among Africa Americans and 17% among Caucasians5. The difference in classification of case and control in each study could also altered the results. Some studies assume the case group as negative acid fast bacilli bacteria sputum or extra pulmonary TB, whereas for the control group, some studies took blood samples from blood banks where history of exposure to TB is not known. Correspondingly, not all studies have conducted HIV tests to determine the HIV status of the subjects 34. A variety of results could also be caused by gene-environment interaction, gene-gene interaction and gene-agent interaction. In the Indian population, the levels of VDR protein were not fluctuate in both PTB patients and Normal Healthy Subjects (NHS) on polymorphism FokI but a trend towards decreased levels of VDR protein was observed in NHS with BB genotype compared to bb genotype of BsmI polymorphism11. In this study, among those polymorphism ApaI, FokI and BsmI, only bb genotype was associated to decreased risk for PTB. A study on Indian Gujarat ethnic resides in London showed no association between FokI polymorphism with TB, but together with vitamin D deficiency, ff genotype is associated with susceptibility to TB35. Another study in Bandung, Indonesia proved that FF and Ff genotype 2.94 more frequently found on Child TB than the healthy one31. Gene-gene interaction has been shown in some studies. A single gene that is not associated with susceptibility to TB will show an association if combined with other genes36,37. Gene-agent interaction showed association of a certain host gene with a certain strain of Mycobacterium tuberculosis38,39. Those result might be affected by other factors. As a ligand of vitamin D, VDR could be activated if Vitamin D Receptor form heterodimer with Retinoid X Receptor (RXR) henced bind to Vitamin D Response Elements (VDRE) which is controlled by Asea Uninet Scientific and Plenary Meeting 2016 | 423 Vitamin D Response Elements – Binding Protein (VDRE-BP) on gene target promoter of cathelicidin4. Cathelicidin promotes elimination of Mtb in phagolysosome. It is known that before vitamin D enters the macrophage, inactive vitamin D in serum could be bound to vitamin D binding protein (DBP) or in free state. After inactive vitamin D bind to TollLike Receptor on macrophage, CYP27b1 enzyme on mitochondria forms active state of vitamin D. Consequently, along with heat shock protein 70 (hsc70) and bcl-2 associated athanogene (BAG-1), active vitamin D and its receptor enter the nucleus and forms heterodimer with Retinoid X Receptor (RXR)4,40. Therefore, all that occur in transcription of cathelicidin can influence the results of the study. 5 CONCLUSION The development of PTB is a complicate interaction between host, pathogen and environmental factors. From this study that perform in Indonesian Batak ethnic population revealed that ApaI and FokI polymorphism of VDR gene do not responsible for host susceptibility to PTB. On the BsmI polymorphism, bb genotype was associated with decreased risk to PTB. These outcome, may give further clarification why some people are more resistant against TB than the others. 6 SUGGESTION Based on the results of VDR gene Polymorphism in Batak ethnic population, we want to give vitamin D as a supplementation for TB patients and will evaluate this by assessing the sputum conversion and chest x ray photograph. We want to analyze the VDR Polymorphism ApaI, FokI and particularly BsmI on those patients as well because BsmI polymorphism control transcription level, transcription stability and post modification transcription of VDR gene8. The research plan is as ongoing project by Biomedical Master Program Medical Faculty, Universitas Sumatera Utara in collaboration with Pulmonology and Respiratory Department, Medical Faculty, Universitas Sumatera Utara- Haji Adam Malik Hospital, Medan. ACKNOWLEDGEMENTS This study was partly supported by Directorate General of Higher Education, Ministry of Education and Culture, Indonesia (Hibah Bersaing Scheme; No. 4267/UN5.1.R/KEU/2013). REFERENCES Bellamy R, Ruwende C, Corrag T, et al.(1998). Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N. Engl. J. Med. 338: 640-4. Buschman E, Skamene E, Schurr E.(2004) The role of the NRAMP1 gene in mycobacterial infection. In: Rom WN, Garay SM ,ed. Tuberculosis. Lippincott William & Wilkins, Philadelphia. p.193-201. Liu PT, Stenger S, Tang DH, et al. (2007). Cutting edge: Vitamin D-mediated human antimicrobial activity against Mycobacterium tuberculosis is dependent on the induction of cathelicidin. J. Immunol. 179: 2060-3. Chun RF, Adams JS, Hewison M. (2008). Back to the future: a new look at ‘old’ vitamin D. J. Endocrinol. 198: 261-9. 424 | Asea Uninet Scientific and Plenary Meeting 2016 Zmuda JM, Cauley JA, Ferrell RE. (2000). Molecular epidemiology of vitamin D receptor gene variants. Epidemiol. Rev. 22: 203-17. Arai H, Myamoto K., Taketani Y, et al. (1997). A vitamin D receptor gene polymorphism in the tranlation initiation codon: effect on protein and relation to bone mineral density in Japanese women. JBMR. 12: 915-21. Jurutka PW, Remus LS, Whitfield GK, et al. (2000). The polymorphic N terminus in human vitamin D receptor isoform influences transcriptional activity by modulating interaction with transcription factor IIB. Mol. Endocrinol. 14: 401-20. Kaleta B, Bogaczewicz J, Robak E, et al. (2013) Vitamin D Receptor gene BsmI polymorphism in Polish Patients with Systemic Lupus Erythematosus. ISRN Endocrinology. doi 10.1155/2013/427818. Gao L, Tao Y, Zhang L, et al. (2010). Vitamin D receptor genetic polymorphisms and tuberculosis: updated systematic review and meta-analysis. Int. J. Tuberc. Lung Dis. 14: 15-23. Chen C, Liu Q, Zhu L, et al. (2013). Vitamin D Receptor gene polymorphisms on the risk of tuberculosis, a meta-analysis of 29 case-control studies. PloS ONE. 8(12): e83843. doi:10.1371/journal.pone.0083843. volume 8 Issue 12. Selvaraj P, Anand P S, Harishankar M, Alagarasu K. (2009). Plasma 1, 25 Dihydroxy Vitamin D3 level and expression of vitamin D receptor and cathelicidin in pulmonary tuberculosis. J Clin.Immunol. 29: 470-478. Rodriguez S, Gaunt TR, Day lan NM. (2014). Hardy-Weinberg equilibrium testing of biological ascertainment for Mendelian randomization studies. Available at http://www.oege.org/software/hwe-mr-calc.html. Access on May 27, 2014. Kang TJ, Jin SH, Yeum C, et al. (2011). Vitamin D receptor gene TaqI, BsmI and FokI polymorphisms in Korean patients with tuberculosis. Immune Netw. 11: 253-7. Selvaraj P, Kurian SM, Chandra G, et al. (2004). Vitamin D receptor gene variants of BsmI, ApaI, TaqI, and FokI polymorphisms in spinal tuberculosis. Clin Genet. 65: 73-6. Banoei MM, Mirsaeidi MS, Houshmand M, et al. (2010). Vitamin D receptor homoxygote mutant tt and bb are associated with susceptibility to pulmonar tuberculosis in the Iranian population. Int. J. Infect. Dis. 14: e84-e85. Bornman L, Campbell SJ, Fielding K, et al. (2004). Vitamin D receptor polymorphisms and susceptibility to tuberculosis in West Africa: A case-control and family study. J. Infect. Dis. 190: 1631-41. Lombard Z, Dalton DL, Venter PA, et al. (2006). Association of HLA-DR, -DQ and vitamin D receptor alleles and haplotypes with tuberculosis in the Venda of South Africa. Hum. Immunol. 67: 643-54. Babb C, van der Merwe L, Beyers N, et al. (2007). Vitamin D receptor gene polymorphisms and sputum conversion time in pulmonanary tuberculosis patients. Tuberculosis (Edinb). 87: 295-302. Olesen R, Wejse C, Velez DR, et al. (2007). DC-SIGN (CD209), pentraxin 3 and vitamin D receptor gene variants associate with pulmonary tuberculosis risk in West Africans. Genes Immun. 8: 456-67. Wilbur AK, Kubatko LS, Hurtado AM, et al. (2007). Vitamin D receptor gene polymorphisms and susceptibility M. tuberculosis in Native Paraguayans. Tuberculosis. 87: 329-37. Liu W, Cao W, Zhang C, et al. (2004). VDR and NRAMP1 gene polymorphisms in susceptibility to pulmonary tuberculosis among the Chinese Han population: a case-control study. Int. J. Tuberc.Lung Dis. 8: 428-34. Asea Uninet Scientific and Plenary Meeting 2016 | 425 Selvaraj P, Chandra G, Kurian SM, et al. (2003). Association of vitamin D receptor gene variants of BsmI, ApaI and FokI polymorphisms with susceptibility or resistance to pulmonary tuberculosis. Curr Sci. 84: 1564-8. Shang CAO, Peng-fei LUO, Wei LI, et al. (2012). Meta analysis. Vitamin D receptor genetic polymorphisms and tuberculosis among Chinese Han ethnic group. Chin. Med. J. 125: 920-925. Qian S, Xiangyu M, Hui L, et al. (2011). Association between gene polymorphisms of vitamin D receptor and pulmonary tuberculosis susceptibility: a meta-analysis. Journal of medical colleges of PLA. 26: 67-75. Shing A, Gaughan JP, Kashyap VK. (2011). SLC11A1 and VDR gene variants and susceptibility to tuberculosis and disease progression in East India. Int. J. Tuberc. Lung Dis. 15: 1468-4. Marashian SM, Farnia P, Seyf S, et al. (2010). Evaluating the role of vitamin D receptor polymorphism on tuberculosis among Iranian patients: a case control study. Tuberk. Toraks. 58: 147-53. Ates O, Dolek B, Dalyan L, et al. (2011). The association between BsmI variant of vitamin D receptor gene and susceptibility to tuberculosis. Mol. Biol. Rep. 38: 2633-6. Fitness J, Floyd S, Wandorff DK, et al. (2004). Large scale candidate gene study of tuberculosis susceptibility in Karonga district of Northern Malawi. Am. J. Trop. Med. Hyg. 71: 341-9. Merza M, Farnia P, Anoosheh S, et al. (2009). The NRAMP1, VDR and TNF-α gene polymorphisms in Iranian tuberculosis patients: the study on host susceptibility. Braz. J. Infect. Dis. 13: 252-6. Wu Y, Yang X, Wang X, et al. (2010). Association of vitamin D receptor Bsm I gene polymorphism with risk of tuberculosis: A Meta-analysis of 15 studies. PloS ONE. 8 (6): e66944. doi: 10.1371/journal.pone.0066944. Setiabudiawan B, Kartasasmita C B, Garna H, Parwati I, Maskoen A M. (2010). MKB 42:4:187-193 Bid H K and Mittal R D. (2003). Study of vitamin D receptor (VDR) gene start codon polymorphism (FokI) in healthy individuals from North India. Indian Journal of Human Genetics. 9;2: 51-54. Uitterlinden AG, Fanf Y, van Meurs JBJ, et al. (2004). Genetics and biology of vitamin D receptor polymorphisms. Gene. 338; 143-56. Stein CM. (2011). Genetic epidemiology of tuberculosis susceptibility: impact of study design. PLoS Pathogens. 7(1):e1001189. doi:10.1371/jornal.ppat.1001189. Wilkinson RJ, Liewelyn M, Toossi Z, et al. (2000). Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in West London: a case-control study. Lancet. 355: 618-621. Velez DR, Hulme WF, Myers JL, et al. (2009). NOS2A, TLR4, and IFNGR1 interaction influence pulmonary tuberculosis susceptibility in African-Americans. Hum. Genet. 126: 643-53. doi:10.1007/s00439-009-0713-y. Ben-Selma W, Harizi H, Boukadida J. (2011). Association of TNF-α and IL-10 polymorphisms with tuberculosis in Tunisian populations. Microbes. Infect. 13: 837-43. Takahashi K, Hasegawa Y, Abe T, et al. (2008). SLC11A1 (formerly NRAMP1 polymorphisms associated with multidrug-resistant tuberculosis. Tuberculosis. 88: 52-7. Van Crevel R, Parwati I, Sahiratmadja E, et al. (2009). Infection with Mycobacterium tuberculosis Beijing genotype strains is associated with polymorphisms in 426 | Asea Uninet Scientific and Plenary Meeting 2016 SLC11A1/NRAMP1 in Indonesian patients with tuberculosis. J. Infect. Dis. 200: 1671-1674. Martineau A R, Wilkinson K A, Newton S M et al. (2007). IFN-γ and TNF independent vitamin D inducible human suppression of mycobacteria: The role of cathelicidinLL37. J Immunol. 178: 7190-7198. UNRECOGNIZED MANAGEMENT OF DISORDERS OF SEX DEVELOPMENT IN INDONESIA: PUBLIC HEALTH PERSPECTIVE Sultana MH Faradz sultanafaradz@gmail.com* A. Zulfa Juniarto zulfa_juniarto@fk.undip.ac.id Center for Biomedical Research, Faculty of Medicine, Diponegoro University, Semarang Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract Disorders of sex development (DSD) are congenital condition in with atypical development of chromosomal, gonadal, or anatomical sex, while in clinical practice this term means any abnormality of the external genitalia. Management of DSD is challenging especially if identified at later age, creating complexities of problems within the families. The aim of this study is to help patient in sexual assignment, sexual rearing, diagnostic and identify the genetic cause to minimize the recurrence risk in the future generation and support patient to have better quality of life. DSD patients were managed by the only a multidisciplinary gender team in Indonesia as collaboration between Dr. Kariadi province referral hospital and Faculty of Medicine Diponegoro University. Hormonal, chromosomal and DNA studies were done for most of the cases depending on indication. So far we have collected since 2004 more than 801 DSD and hypospadias cases, about 400 of 516 DSD cases already been managed and treated. Most of the genetically proven cases were Congenital Adrenal hyperplasia, Androgen Insensitivity syndrome and sex chromosomal DSD such as mosacism and chimerism that lead abnormal gonadal development. Many of them remain undiagnosed, further testing such as advanced DNA study is still ongoing. Investigation of 285 hypospadias cases will be reported in other separate study. The novel genes were found in some cases that contributed for the management of DSD. The complexities of problems hindered the process of family decision making, especially when gender change issue was considered. Education for medical professionals, patients, family members and community about DSD and its causes should be promoted to improve patient quality of life. Keywords: DSD, Gender team, chromosome and genes. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 427 428 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION The older terms of Disorder of Sex Development (DSD) were hermaphrodite, intersex or ambiguous genitalia. This group of conditions is being called disorders of sex development (DSDs) in order to avoid conflating anatomy with identity. Members of The Lawson Wilkins Pediatric Endocrine Society and the European Society for Pediatric Endocrinology accepted the term "disorders of sex development" (DSD) in their "Consensus statement on management of intersex disorders" (Hughes IA et al, 2006). The term is defined by congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. DSD is divided into three primary roots based on karyotype namely 46,XX; 46,XY and Sex Chromosome DSD. Secondary root is depicted based on hormone assessment and imaging and the tertiary root is obtained based on molecular and/or histopathology examination. In Indonesia, it is rare to have a complete diagnosis procedure where molecular evaluation is needed for DSD confirmation. Molecular analysis as part of health care service is limited on research center of the universities in the big cities. Early diagnosis and integrated treatment is important for DSD patient, in order to anticipate the proper treatment within medical, psychological and social aspect through the gender team. The gender team called as Sexual adjustment team is the only multidisciplinary team in Indonesia that manages patients with DSD. This collaborative team between Dr Kariadi province referral hospital and Faculty of Medicine Diponegoro University is consisted of experts in urology surgery, plastic surgery, gynecology, anesthesiology, Adult and Child endocrinology, genetics, andrology, psychiatry, psychology, pathology, legal , religion and social-medical staff. The process of establishing the correct diagnosis starts with serial hormonal and genetic testing then referring the patients and family to the multidisciplinary team for further analysis of possible treatments. Many primary care doctors unaware to such laboratory testing and it is unavailable in all regency hospitals (type B hospitals) in Indonesia. These specific testing is not affordable and not covered by the government health insurance because it is not known by the government stake holder who manages the government public insurance. Accordingly, the team often has to conduct fundraising in order to pay for the costs. Hughes IA et al (2007) identified quite a lot of gene mutation in 46, XY DSD. Significant number of gene mutation in 46, XY with the clinical presentation of undervirilisation or gonadal dysgenesis were found by our group such as DAX-1 duplication, SF1 mutation and other more common mutation such AR gene and Cyp 21 mutation (Juniarto AZ et al 2012, Juniarto AZ 2015 and Eggers S et al 2014). Studies from a number of different countries and cultural differences showed that while many patients managed sequentially, gender counseling as well as sexual counseling should be part of the multi-disciplinary service available to patients with DSD to avoid gender dysphoria. ( Warne GL 2005a , Warne GL et al 2005b). Urological problems and prevention to the development of malignancy in both males and females with DSD deserve more attention (Pleskacova J, Juniarto AZ et al, 2013). The Ministry of Health of the Indonesian government should pay more attention to the management of DSD cases; provide diagnostic facilities and treatments such as hormonal and glucocorticoid medication. The challenges for the future will include the further investigation of the gene mutation influenced to sex development that relevant with clinical implications. Collecting large data sets for simultaneous analysis of many gene mutations to provide new insights is needed such as genome wide associations (GWA) from which millions of genetic variants are read using SNP arrays. International collaboration with multidisciplinary expertise should be encouraged. Asea Uninet Scientific and Plenary Meeting 2016 2 | 429 METHODS Patients with various forms and degrees of DSD were collected during May 2004 to May 2015, while the isolated hypospadias (IH) patients were collected for further research. They were referred to the department of Human Genetics Center for Biomedical Research, Faculty of Medicine Diponegoro University, Semarang, Indonesia for chromosomal analysis by clinicians of the departments of urology, pediatrics, internal medicine, obstetrics and member of sexual adjustment team of the Dr Kariadi Hospital, Semarang. Reason for referral was the presence of ambiguous genitalia or any anatomical abnormality of external or internal genitalia including hypospadias with or without descended testes. Total numbers of 516 DSD patients with atypical external and/or internal genitalia were evaluated using clinical, hormonal, molecular genetics, and histological parameters. The medical ethics committee of Dr. Kariadi Hospital approved this study and informed consent was obtained from all participants, their parents or guardians prior to their participation in this study. 3 FINDINGS AND DISCUSSION The results of this stepwise approach were used to classified patients according to consensus as mentioned above. We have collected 516 DSD patients (see graph 1) The Isolated Hypospadias cases were also recorded separately; so far we have collected 285 patients (see graph 2). Graph 1 Number of DSD patients per year until May 2015 Number of DSD patients per year 600 514 400 200 63 Number… 35 35 30 57 43 46 46 51 57 36 15 0 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 Total Graph 2. Number of Hypospadias patients per year until May 2015 From public health point of view, the detail analysis of every laboratory test is not reported in this study. From the total 516 DSD cases we found 359 cases with 46, XY DSD, 114 cases with 46,XX, 37 cases with sex chromosome DSD, 6 cases with autosomal DSD (see graph 3). The well known genes were identified such as AR gene in Androgen Insensitivity Syndrome (AIS) and Cyp 21 mutation in Congenital Adrenal hyperplasia (CAH). Most of the patient in the group of 46,XY DSD where Androgen Action Disorder found to be the majority of the case (96 cases). The genetically proven 46, XY DSD cases were Androgen 430 | Asea Uninet Scientific and Plenary Meeting 2016 Insensivity Syndrome (25 AR gene mutation in 43 suspected AIS cases). As the majority cases of 46, XX DSD were Congenital Adrenal Hyperplasia (69 cases) who required immediate comprehensive treatment because its nature of the crisis often leads to life threatening situation. Unfortunately most of the medication for CAH is not available in Indonesia, donation based on research were obtained from overseas such Erasmus University the Netherlands. Both AIS and CAH are Mendelian inherited diseases that need careful explanation about the pattern of inheritance, the risk of having more children with the same condition and clinical management in the session of genetic counseling. In Indonesia, as well as in South Asian countries, genetic counselor as health care provider is not very common, therefore clinical physicians quite often dealing with patients and families by their own way (Zayts O, et al, 2013) The remaining cases were gonadal dysgenesis, Unknown Male Undermasculinized, Androgen Excess disorders, defect of Mullerian Development and other classical common sex chromosomal abnormalities. Disorder of sex development (DSD) is a broad term covering many different aspects that affect abnormal sexual anatomy, which is the result of various events occurring during sex differentiation. Because so many stages and genes are involved in known pathways that lead to gonadal formation and differentiation, it is not always possible to identify the causes of the disorders. There is potentially novel and alternative pathways may play a role (Piprek RP, 2010; Kousta E, 2010). Consequently, the scope of molecular genetic analysis has markedly expanded. Although clinical and psychological management have already been done, many undiagnosed DSD should be later analysed using advanced molecular techniques. Graph 3. Classification of DSD patients In Indonesia, diagnosis and management of patient with DSD has not received attention that they should deserve since infectious disease is still a priority as the major cause of death. A multidiscipline approach on DSD management firstly conducted in Indonesia is in our center. Lacks of expertise, laboratory equipments and financial burden as well as awareness of medical personnel and community were slow down its developments. Apparently, most of the patients were coming from low social economic class. Hence frequently the funds were coming out from the team members own pocket. Although National health insurance is now available since last year, most of the diagnostic testing as well as treatment are not covered. The age distribution differs from what is observed in developed countries (Warne GL et al, 2005). Patients referred after the age of one year and adults were dominant among Asea Uninet Scientific and Plenary Meeting 2016 | 431 our patients. In the beginning of the study when the Genetic Laboratory available in our center and Sexual Adjustment Team actively move on with better diagnosis, many patients come in late condition with physical and psychological complex dilemma. The trend is likely to occur due to improving awareness of the society, causing the parents to be more responsive in seeking treatment for their children with genital abnormalities. It is also assumed that extensive information on a regular basis about genital disorders from the health care community and mass media has contributed to the shifting trend, while the overall patient number was significantly increasing over time. In many of underprivileged Asian countries, a child born with ambiguous genitalia grow up while bearing the congenital anatomic sex features, which remain untreated in the form of surgical treatment until adolescents or adulthood (Warne GL et al, 2008a,b). In contrast to the present study, several studies conducted in Sudan and Saudi Arabia revealed a high number of consanguinity among the parents of patients with genital disorders ( Al-Jurayyan NA et al, 2010; Ellaithi M KA, 2011). Adult untreated patients either they already changed their gender or still undecided gender were suffered from stigmatization and gender dysphoria and need thorough psychological assessment (Ediati A, et al 2015). Culture is an important part of the context in which decisions are made on sex assignment. Attitudes concerning gender and sexuality, including the acceptance of intersexuality, may differ between various cultures (Warne GL et al, 2008). Cultural differences in dealing with DSD individuals not only influence the patient's own psychosexual development but also medical decisions regarding sex assignment and consecutive management. The known risk factors for germ cell cancer are cryptorchidism, infertility ( testicular dysgenesis syndrome) and disorder of sex development, in addition certain DSD subgroups such as gonadal dysgenesis are prone to develop germ cell cancer (Pleskacova J. et al, 2010). Therefore the risk of gonadal malignancy should be considered especially for patients with abdominal testis and sex chromosomal DSD. Patients who performed gonadectomy or gonadal biopsy, the serial histopathology examinations should be subsequently done to obtain a definite diagnosis of germ cell tumor. 4 CONCLUSIONS AND SUGGESTIONS In Indonesia, Disorder Sexual Development (DSD) management has been paid not much attention by the Ministry of Health (or government), once we provided a multidisciplinary service and publicized to the community, a lot of patients come for consultation. The genital abnormality seems taboo culturally for some ethnic group to disclosure to the family and medical personnel. The accountable general guideline of DSD management should be set and standardized nationally; hence it will provide adjustable implementation for the various conditions of patients and their families. Therefore, DSD management should be employed differently along with the diversity of cultural and demographic background in the societies. Understanding on this issue, including an extensive research of patients and identify the structure of each ethnic and cultural background is necessary for general medical community in Indonesia in the management of patients with DSD complex. This report is expected to contribute about DSD patients, suggestions, advice or recommendations on what is needed in the diagnosis and management of DSD which will ultimately improve the quality of medical care and quality of life of DSD patients in Indonesia. Recognition, support, caring and providing the medication from the government should be soon become reality 432 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES Al-Jurayyan NA. Ambiguous Genitalia, Two Decades of Experience: Clinical Management and Sex Assignment. ( 2010). J T U Med Sc;5(1):13 - 20 Ediati A, Faradz SM, Juniarto AZ, van der Ende J, Drop SL, Dessens AB. Emotional and behavioral problems in late-identified Indonesian patients with disorders of sex development (2015). J Psychosom ResJul,79(1):76-84. Ellaithi M KA, Saber. O, Hiort.O. Consanguinity and Disorders of Sexual Developments in the Sudan (2011). Sudan JMS. Volume 6(Number 4 ):267-70. Eggers S, Smith KR, Bahlo M, Looijenga LHJ, Drop SLS, Harley VR, Koopman P, Faradz SMH, Sinclair AH (2015). Whole exome sequencing combined with linkage analysis identifies a novel deletion in NR5A1 in a family with 46,XY disorders of sex development and 46,XX premature ovarian insufficiency. Eur J Hum Genet. 23(4):486-93. Hughes I A, Houk C, Ahmed S F, Lee P A and LWPES/ESPE (2006). Consensus Group disorders Consensus statement on management of intersex. Arch. Dis. Child,91;554-563 Hughes IA, Nihoul-Fékété C, Thomas B, Cohen-Kettenis PT(2007). Consequences of the ESPE/LWPES guidelines for diagnosis and treatment of disorders of sex development. Best Pract Res Clin Endocrinol Metab, 21(3):351-65. Juniarto AZ, van der Zwan YG, Santosa A, Hersmus R, de Jong FH, Olmer R, et al. (2012) Application of the new classification on patients with a disorder of sex development in indonesia. International journal of endocrinology. 2012:237084. Juniarto AZ, Setyawati BA, Miranti IP,Santosa A, Hersmus R, Stoop H,4 Cools M, Oosterhuis JW, Drop SLS, Faradz SMH, Looijenga LHJ. Gonadal malignancy in 13 consecutive collected patients with disorders of sex development (DSD) from Semarang (Indonesia), (2013). J Clin Pathol, 66: 198-204 Kousta E, Papathanasiou A, Skordis N. Sex determination and disorders of sex development according to the revised nomenclature and classification in 46,XX individuals (2010). Hormones (Athens). Jul-Sep;9(3):218-131. Piprek RP. Molecular and cellular machinery of gonadal differentiation in mammals (2010). Int J Dev Biol.;54(5):779-86. Pleskacova J, Hersmus R, Oosterhuis JW, Setyawati BA, Faradz SM, Cools M, Wolffenbuttel KP, Lebl J, Drop SL, Looijenga LH (2010). Tumor risk in disorders of sex development. Sex Dev. Sep,4(4-5):259-69 Warne G, Grover S, Hutson J, Sinclair A, Metcalfe S, Northam E, Freeman J, Murdoch Childrens Research Institute Sex Study Group (2005). A long-term outcome study of intersex conditions. J Pediatr Endocrinol Metab. ;18(6):555-67. Warne GL, Raza J. (2008 a). Disorders of sex development (DSDs), their presentation and management in different cultures. Rev Endocr Metab Disord. Sep;9(3):227-36. Warne GL. Long-term outcome of disorders of sex development. Sex Dev. (2008 b).2(45):268-77. Zayts O, Sarangi S, Thong MK, Chung BH, Lo IF, Kan AS, Lee JM, Padilla CD, Cutiongco-de la Paz EM, Faradz SM, Wasant P (2013). Genetic counseling/consultation in South-East Asia: a report from the workshop at the 10th Asia pacific conference on human genetics. J Genet Couns. Dec;22(6):917-24 ASSOCIATION OF SRD5A2 GENE POLYMORPHISM AND INDONESIAN ISOLATED HYPOSPADIAS PATIENTS Nura Eky Vikawati nura.eky@gmail.com Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University Ardy Santosa Surgery Department of Dr.Kariadi Hospital Semarang sant44@yahoo.com Ahmad Zulfa Juniarto Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University Sultana MH Faradz* Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University sultanafaradz@gmail.com Presented at : the ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract Research objectives : Hypospadias is a malformation in the tip of urethra of male babies and one of the public health problem which can result in difficulty of gender assessment. This is a multifactorial disease which genetic play role in the development (Kojima et al., 2010). Polymorphism of V89L in SRD5A2 gene is one of the risk factor associated with reduction of enzyme activity in steroid metabolism during fetus life (Samtani et al., 2011). The aim of this study is to identify V89L polymorphism in SRD5A2 gene among Indonesian isolated hypospadias (IH) patients. Methodologies : From 2004 to 2015, we collected 262 IH patients. Consecutive random sampling of patients during 2012 – 2015 was used. Thirty five IH patients and 35 normal males as control were included. PCR–RFLP to detect V89L polymorphisms were done in those samples. Preliminary findings : No positive association was found between V89L polymorphism and hypospadias (Prevalence ratio of mutant allele C vs wildtype (G) =1.0, 95% CI: 0.342 - 2.921, p=1.0). C allele frequency was slightly higher than G allele in all samples, 0.51 and 0.49, respectively. Among 35 hypospadias patients, the prominent phenotype were penile with mean age of admission were 5.4 years old. Potential contribution to the literature : This is the first preliminary study of V89L polymorphism of SRD5A2 gene in Indonesian IH patients. Our finding could not replicate other study that showed positive association due to small sample size and different ethnicity. Keywords : Risk factor, Hypospadia, Polymorphism, SRD5A2 Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 433 434 | Asea Uninet Scientific and Plenary Meeting 2016 1 INTRODUCTION Hypospadias is the most common malformation in the tip of urethra of male babies which can result in difficulty of gender assessment. It is characterized by the ostium urethra externum (OUE) located in anterior part of penis instead of in the tip of penis (Wang and Baskin, 2008). This is a malformation where can be diagnosed directly after baby was born by midwifes or doctors. Hypospadias is classified into 3 type based on the location of urethra: anterior (OUE located in glandular, subcoronal, and distal penis), middle (OUE located in mid shaft penis and proximal penis), and posterior (OUE located in penoscrotal, scrotal, and perineal) (Hadidi, 2006). The incidence of this malformation is vary around the world and tends to increase each year. The incidence in USA is 1:250 to 1:125 of male birth (Manson and Carr, 2003; Paulozzi et al., 1997; Brouwers et al., 2006; Brouwers et al., 2009). Meanwhile, in China the prevalence is 5.8 in 10.000 male birth and increasing (Jin et al., 2010) The etiology of this malformation is elusive and thought to be a multifactorial disease which genetic factor might play role in the development (Jin et al., 2010; Kojima et al., 2010). Other than genetic, endocrine and environmental factor were assumed to correlate with the incidence. Endocrine disrupting chemicals (EDC) was correlated with the development of hypospadias due to the disruption of sex hormone during external genital development in fetus life. The EDC might act as estrogenic or anti-androgenic compound (Carbone et al., 2007). Moreover, genetic susceptibility combined with external factors contributes to the increasing risk of hypospadias. One of the candidate gene that affects genetic susceptibility is SRD5A2 (5-alpha reductase type-2) gene. SRD5A2 encode a microsomal protein called steroid-5-alpha-reductase 2. This protein acts as converting enzyme for testosterone (T) to the more potent dihydrotestosterone (DHT) in steroid metabolism (Van der Zanden et al., 2010). Polymorphism in c.265G>C of exon 1 of SRD5A2 which lead to amino acid change from valine to leusin (V89L) is assumed to reduce 5-alpha reductase activity by approximately 30% and resulted in lower dihydrotestosterone concentration thus associated with the increasing risk of hypospadias (Samtani et al, 2011; Sata et al, 2010; Makridakis et al., 1997). Seeveral studies in Asia showed a positive association of this polymorphism and hypospadias (Samtani et.al., 2011; Wang et al., 2004; Thai hanh, 2009). A study in India indicated a strong association with hypospadias with OR 2.4, 95% CI 1.2-4.6, p<0.05 (Samtani et al., 2011). Other than hypospadias, V89L polymorphisms were associated with prostatic cancer. Eventhough the result is still conflicting. L allele in prostatic cancer associated with lower risk while in hypospadias it was associated with increasing risk (Li et al., 2010). A meta-analysis study of V89L polymorphism showed that L allele was higher in Asian (46.9%) than Whites (37.5%) or Blacks (33.5%) (Li et al., 2010). There is also a positive correlation of L allele of V89L polymorphism also showed in androgenetic alopesia cases (Roshdy et al., 2013). There were one study of SRD5A2 gene in 5-alpha reductase deficiency patient in Indonesia which led to the discovery of 2 new mutations in, pGly34fs and c.699-1G>T (Marzuki et al., 2011). This present study is the first study which identifies the V89L polymorphism in Indonesian isolated hypospadias (IH) patients and normal male control. The aim is to identify V89L polymorphism in Indonesian isolated hypospadias patient and know the role of the polymorphism in increasing risk of hypospadias from the genetic aspect. Asea Uninet Scientific and Plenary Meeting 2016 2 | 435 METHOD From 2004 to 2015, we collected 262 IH patients. Consecutive random sampling of patients during 2012 – 2015 was used. Thirty five IH patients and 35 normal males as control were included. The inclusion criteria of samples are Indonesian IH patients (ethnic background was ignored) whose parents sign informed consent and came between 2012 and 2015. Syndromic hypospadias was excluded in this study. There was no history of consanguineous marriage in any of the parents. Normal male group were volunteers from the academic society of Faculty of Medicine Diponegoro University who reported had no history of hypospadias or other genital anomaly with the range of age 22 to 53 years old. This study was done in Centre for Biomedical Research (CEBIOR) - Faculty of Medicine Diponegoro University, Semarang. All 35 IH patients were referred by urologist or pediatricians for chromosome analysis prior to repair surgery. All of them were from Semarang and surrounding area. Blood were collected into EDTA tube. DNA extraction was done using salting out method. PCR–RFLP to detect V89L polymorphisms were done in those samples. Additional information of characteristic patients was collected from medical records. PCR technique using forward primer 5’-gca gcg gcc acc ggc gag g-3’ and reverse primer 5’-agc agg gca gtg cgc tgc act-3’. Amplification of genomic DNA was carried out using 12.5 μl of PCR master mix (Thermo Scientific DreamTaq Green PCR Master Mix (2X)), 5 μM of forward and reverse primer, and 100 nanogram of extracted genomic DNA. The volume is completed to 25μl with deionized water. The thermal conditions required for the reaction were initial denaturation at 95oC for 3 minutes, followed by 35 cycles of 95oC for 30 seconds, 58oC for 30 seconds, 72oC for 1 minute then a final extension at 72oC for 10 minutes. The products were then digested with RsaI enzyme restriction (Thermo Fisher Scientific Inc. http://www.thermoscientific.com/fermentas) (Vokwana, 2008). The restriction digestion mixture was made up in a 10 µl volume. Included in the mixture was 5 unit of enzyme, 1X buffer, and deionized water to make up the rest of volume. The mixture then were added to 10 µl of PCR product and incubated at 37oC for an overnight period. Instead of using agarose gel electrophoresis, visualization of digestion product was done using PAGE (Polyacrilamide Gel Electrophoresis). GG or VV allele (wildtype) were showed by 169bp, 105 bp, and 64 bp fragments size. CC or LL allele (mutant) was showed by 169bp, 105bp, and 83 bp fragments size. Heterozygote GC or VL were showed by 169bp, 105bp, 83bp, and 64bp fragments size. Data of V89L polymorphism among isolated hypospadias patients and normal male control were then analyzed using SPSS for Windows ver 17 to get the prevalence ratio (PR). 3 3.1 FINDINGS AND DISCUSSION Findings From 35 isolated hypospadias, the mean age of admission was 65.5 months (5.4 years). The oldest age of admission was 14 years; the youngest age was 3 months. All samples either hypospadias or normal control had 46,XY karyotype. The frequent phenotype of hypospadias was penile (47%), followed by penoscrotal (32%), scrotal (6%), perineal (6%), coronal (3%), glandular (3%) and 2 OUE/ostium urethra externum in 1 patient located on penile and penoscrotal. The 330bp PCR producst of V89L polymorphism (see fig.1A) were then digested with RsaI restriction enzyme. Result of the digestion products of some samples were shown in figure 1B. 436 | Asea Uninet Scientific and Plenary Meeting 2016 330 bp 200bp 300 bp 169 bp 100bp 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 105 bp 83 bp 69 bp Figure 1B. Visualization of RFLP using 10% Figure 1A. Visualization of PCR product polyacrilamide gel electrophoresis with which runned on 0,8% agarose gel electrophoresis. Lane 1 : 100bp DNA ladder , silver staining. Lane 6 : 100bp DNA ladder. Lane 7 : blank. Lane 2 represented Wildtype Lane 2-3 : Blank, Lane 4-16 : PCR product allel (GG) that showed by fragment band with 330 bp size 169bp, 105bp and 64bp. Lane 1,3,4,5,8 represented heterozygote allel (CG) that showed by fragment band 169bp, 105bp, 83bp, and 64 bp. Lane 9 represented mutant allel (CC) that showed by fragment band 169bp, 105bp, and 83 bp. Table.1. Genotype distribution hypospadias group vs normal males control Group Total Hypospadia Norma Allel CC Count 11 9 20 % in 31.4% 25.7% 28.6% Group Count GG 9 9 18 % in 25.7% 25.7% 25.7% Group Count CG 15 17 32 % in 42.9% 48.6% 45.7% Group Count Total 35 35 70 % in 100.0% 100.0% 100.0% Group X2: 0.325; p value : 0.850 (chi square test see appendix) Table 1 showed genotype distribution between hypospadias vs normal males control. There were no positive association between V89L polymorphism of SRD5A2 gene and hypospadias (prevalence ratio/PR of CC+CG vs GG =1.0, 95% CI: 0.342 - 2.921, p value=1.0). Allele frequency of C and G in hypospadias sample Asea Uninet Scientific and Plenary Meeting 2016 | 437 and control group and frequency of C and G alleles of whole samples were represented in table 2. Table 2. Frequency of C and G allel Allel C G 4 Frequency Hypospadias Normal 0,26 0,25 0,24 0,25 Total Frequency 0,51 0,49 DISCUSSION Steroid 5-alpha reductase type 2 is a gene which located in chromosome 2 (2p23) and consist of 5 exons and 4 introns. It encodes steroid 5-alpha reductase type 2 proteins which has 254 amino acids that were frequently expressed in prostatic tissue. This protein has two domains which are testosterone binding domain and NADPH cofactor-binding domain in N-terminal region. Any mutation located either in exon 1 or 5 affect testosterone binding region while mutation that affect NADPH binding is more vary and commonly mapped between exon 3 and 4 (deCalais et al., 2011). V89L polymorphism is located in exon 1. However, the exact mechanism of how this polymorphism related with hypospadias is poorly understood. This is a SNP where the nucleotide G changes to C in c.265 and leads to amino acid change of valine to leusin (Makridakis et al., 1997). The previous study about this polymorphism showed that this was related with the change of 5-alpha reductase enzyme activity in vivo, where V89 allele substantially encode higher enzyme activity than L89 allele because valine homozygous (VV) had nearly 30% AAG serum level higher than LL homozygous. AAG stands for 5αandrostane-3α,17β-diol-17β-glucoronide, a dihydrotestosterone metabolite that used to measure 5-alpha reductase activity. (Makridakis et al.1997). However, mutation in SRD5A2 gene usually found in severe cases together with other malformation like micropenis, cryptorchidism and bifid scrotum, only few affected isolated cases were reported (Thai hanh, 2009). This study found that association of V89L polymorphism and isolated hypospadias was still inconclusive (PR of mutant allele vs wildtype allele were 1, 95% CI: 0.342 - 2.921, p value=1.0). Frequency of C allele in whole samples was slightly higher than G allele (0.51 and 0.49, respectively). C allele in hypospadias sample was also higher than in control (0.26 and 0.25, respectively). The study in Netherland with 620 hypospadias case samples and 596 controls showed an OR of CC genotype: 1.0 (ref), OR CG genotype: 1.0, 95% CI (0.8-1.3), OR GG genotype: 1.1, 95% CI (0.7-1.6) (Van der Zanden et al.,2010). Study in Netherland and this study could not replicate another study which showed positive association between C allele with the increasing risk of hypospadia (Samtani et al., 2011; Sata et al., 2010). A study in India of V89L polymorphism showed significant result between case and control. The OR VL/CG genotype was 3.01, 95% CI: 1.87– 4.8, p = 0.00; OR LL/CC genotype was 1.9, 95% CI: 1.05–3.4, p = 0.03; OR VL+ LL genotype was 2.57, 95% CI:1.79 –3.68, p = 0.000) (Samtani et al., 2011). A study in Japan showed that the risk of severe hypospadias were found in children with C allele in c.265G>C (p.89L), with OR GC genotype was 3.16, 95% CI: 1.05–9.50, OR CC genotype was 3.29, 95% CI: 0.95– 11.47 [tendency of p value: 0.057], OR (GC+CC) genotype was 3.19, 95% CI: 1.09–9.36 (Sata et al., 2010). Thai Hanh study in 2009 hypothesize that V89 allele in homozygous 438 | Asea Uninet Scientific and Plenary Meeting 2016 form reduced risk of hypospadias. It was shown by the OR of V89 homozygous was 0.24 (95% CI 0.14-0.41), pc-value : 7x10-6, while OR of L89 in homozygous and heterozygous form was about 2 (1.9 and 2.9, respectively). Thai’s study with 158 hypospadias cases from Swedish, Turkish, and Middle Eastern patients found that allele frequencies of V89 was 48% and 52% for leusin (L89), compared to controls 71% and 29% respectively (Thai hanh, 2009). It implies that Thai’s study also found a positive result that L89 allele were correlated with increasing risk of hypospadias as same as study of Samtani in India and Sata in Japan. The significant correlation also found in Chinese study. Wang’s study showed significant result of C allele frequency (p value = <0.05 with OR 1.78, 95% CI: 1.14–2.78) between hypospadias patients vs controls. Allele frequency of C in patients was 0.53 compared with controls (0.39) and G allele in patients and controls were 0.47 and 0.61, respectively. Their result suggested that C allele is a genetic risk factor for hypospadias occurance (Wang et al., 2004). On the other hand, SRD5A2 gene is also correlated with other disease, such as prostatic cancer and androgenetic alopesia (Li et al., 2003; Roshdy et al., 2013). A study of Li et al. in prostatic cancer of Japanese population showed that males with the VV or VL genotype compared with LL genotype were at significant increased risk of prostatic cancer (adjusted OR 1.69, 95% CI 1.07 to 2.65, p = 0.024) (Li et al., 2003). However, the Huge review of meta-analysis found that prostate cancer was not associated with V89L (Li et al., 2009). Other study by Megiddo et al concluded that only in men with LL or VL genotype were increased the serum levels of DHEAS and 3α-diol G positively associated with a higher risk of aggressive prostate cancer (Megiddo et al., 2008). This correlation is still conflicting, some found a decrease risk of prostatic cancer in LL men compared with VV men (Li Z et al., 2003; Salam et al., 2005) but other did not (Hsing et al., 2001; Lamharzi et al., 2003). Study of Roshdy et al with 90 samples (45 cases of androgenetic alopesia and 45 controls) showed that regarding the leucine allele, subject carrying L allele were about 3.7 (OR: 3.69 95% CI: 1.984- 6.870, p value : <0.05) of having higher risk of androgenetic alopesia than V allele (Roshdy et al., 2013). Indonesia population was considered of having a high genetic diversity as measured by number of polymorphic sites, number of haplotypes, the mean number of pairwise differences and Nei’s haplotype diversity from mitochondrial DNA of 2740 individuals from 70 communities on 12 Indonesian islands (Tumonggor et al., 2013). Besides the small sample size, differentiating of ethnic background were not able to complete in this present study due to our limitation in collecting a homogeneity sample. This present study showed different finding with the study from Japan or India (Sata et al., 2010; Samtani et al., 2011). This might be caused by our limitation of sample which not meets the ideal sample for polymorphism study. Different ethnic background might also contribute to this finding whether it reflects the real condition in Indonesian population or not. However, this was a preliminary study which identified V89L polymorphism in Indonesian isolated hypospadias patients. The frequent phenotype of hypospadias in this study were penile (47%) followed by penoscrotal (32%), scrotal (6%), perineal (6%), coronal (3%), glandular (3%) and 2 OUE/ostium urethra externum in 1 patient located on penile and penoscrotal. This finding were different with the study in India where the frequent phenotype were severe form (penoscrotal and scrotal) counted for 56.38% (Samtani et al., 2011). Study in Japan with 89 hypospadias cases, 63% had mild phenotype and the rest were severe form (33%) (Sata et al., 2010). Study in Netherland with 305 hypospadias cases showed that the most frequent phenotype were distal hypospadias (67%) followed by middle and proximal, 22% and 14%, respectively (Van der Zanden et al.,2010). Study of Wang et al in 90 Chinese patients showed that most pronoun phenotype was penoscrotal Asea Uninet Scientific and Plenary Meeting 2016 | 439 (36.7%) followed by penile, scrotal, perineal, and glandular. It seemed that severe form was dominant in Chinese patients (Wang et al.,2004). Penile hypospadias apparently were dominant in this present study. The possible reason was the tight of inclusion criteria in this study which was isolated hypospadias without other malformation accompanied. Severe form usually was accompanied by other malformation and was categorized as Disorder of Sex Development and had to be excluded from this study in order to attempt the homogeneity of samples. This different phenotype was influenced by genetic and environmental factor. Distal and middle hypospadias (mild phenotype) were believed to associate with genetic factor. While the proximal type (severe phenotype) were associated with obstetric history such as primiparity, twin pregnancy, and small gestational age (Van Rooij et al., 2013). Mean of admission age were 5.4 years old. Most of them were referred by urologist or pediatricians for chromosomal analysis for gender assessment prior to repair surgery. A study in Pakistan found that the average age for surgical procedure was 8.12 ± 5.04 (Khan et al., 2014). Around 1.87% of patients were operated in 1-2 years old, 34.6% in 3-5 years old and the rest were operated in ≥6 years old. The reasons why the patients came in advance age were because the low awareness of genital anomaly in community and due to financial problem (Manzoni et al., 2004). These condition was different with ideal period of repair surgery which was around 6-12 months or if not possible around 3-4 years old (Manzoni et al, 2004). 5 CONCLUSION AND SUGGESTIONS Our finding could not replicate other study that showed positive association due to small sample size and different ethnic. Future study with bigger sample size and better method is needed to know the role of the polymorphism in hypospadias. Genetic study that considered other aspect like endocrine result and environmental factor is also needed to seek the role of this polymorphism. And last but not least, genetic counseling is warranty for patient’s family because hypospadias is a multifactorial disease which susceptibility of genetic combined with environmental factor were play role for the development. Avoiding the hazardous chemical compound from environment might contribute to reduce the hypospadias incidence. ACKNOWLEDGEMENT The great acknowledgement is for Ministry of Health Republic Indonesia through RISBINIPTEKDOK 2015 grant (Contract no. 714A/UN-7/KS/2015). The author also would like to say thank to dr. Ardy Santosa, Sp.U as supervisor, Prof. Dr. Sultana M.H Faradz as supervisor and Director of Centre of Biomedical Research (CEBIOR), Dr. A.Zulfa Juniarto, Msi.Med, Sp.And, PhD as co.supervisor and Head of Master Degree Program in Biomedical Science, Dr. dr. Tri Indah W, Msi.Med, PA as reviewer, and all CEBIOR staff. REFERENCES Brouwers, M.M., Feitz, W.F.J., Roelofs ,L., Kiemeney, L., De Gier, R., Roeleveld, N. (2006). Risk factor for hypospadia. Eur J Pediatr, 166, 671-678. doi:10.1007/s00431-006-0304-z Brouwers, M.M., Van Der Zanden, L.F.M., De Gier, R.P.E., Barten, E.J., Zielhuis, G.A., Feitz, W.F.J., Roeleveld, N. (2009). Hypospadias : risk factor pattern and different 440 | Asea Uninet Scientific and Plenary Meeting 2016 phenotypes. BJU International, 105, 255-262. doi:10.1111/j.1464410X.2009.08772.x Carbone, P., Giordano, F., Nori, F., Mantovani, A., Taruscio, D., Laurias, L., Talamanca, I.F. (2007). The possible role of endocrine disrupting chemicals in the aetiology of cryptorchidism and hypospadias: a population-based case–control study in rural Sicily. International Journal of Andrology, 30, 3-13. doi:10.1111/j.13652605.2006.00703.x deCalais FL, Soardi FC, Petroli RJ, Gori Lusa AL, de Paiva e Silva RB, Maciel-Guerra AT, Junior, G.G., de Mello, M.P. (2011). Molecular Diagnosis of 5α-Reductase type II deficiency in Brazilian sibling with 46,XY Disorder of Sex Development. International Journal of Molecular Science, 12, 9471-9480. doi:10.3390/ijms12129471 Hadidi AT (n.d.) In Hypospadia Surgery - Art and Science. Retrieved from : http://www.hypospadias-surgery.com/engl_hypo_1.html Hsing, A.W., Reichardt, J.K., Stanczyk, F.Z. (2002). Hormones and prostate cancer: current perspectives and future directions [Abstract]. Prostate, 52(3), 213-35. Abstract retrieved from : http://www.ncbi.nlm.nih.gov/pubmed/12111697 Jin, L., Ye, R., Zheng, J., Hong, S,, Ren, A. (2010). Secular trends of hypospadiaas prevalence and factors associated with it in southest China during 1993-2005. Birth Defect Res A Clin Mol Teratol. 88(6):458-65. doi:10.1002/bdra.20673 Khan, M., Majeed, A., Hayat, W., Ullah, H., Naz, S., Shah, S.A.,Tahmeed, T., Yousaf, K., Tahir,, M. (2014). Hypospadia Repair : A single centre experience. Plastic Surgery International, Volume 2014, Article ID 453039, page: 1-7. http://dx.doi.org/10.1155/2014/453039 Kojima, Y., Kohri, K., Hayashi, Y. (2010). Genetic pathway of external genitalia formation and molecular etiology of hypospadias. Journal of Pediatric Urology, 6, 346-354. doi:10.1016/j.jpurol.2009.11.007 Lamharzi, N., Johnson, M.M., Goodman, G., Etzioni, R., Weiss, N.S., Dightman, D.A., Barnett, M., Ditommaso, D., Chen, C. (2003). Polymorphic markers in the 5areductase type II gene and the incidence of prostate cancer. Int J Cancer, 105, 480 – 483. doi:10.1002/ijc.11126 Li, J., Coated, R.J., Gwinn, M., Khoury, M.J. (2009). Steroid 5-α-reductase type 2 (SRD5A2) gene polymorphisms and risk of prostate cancer: A HuGe Review. American Journal of Epidemiology, 171, 1-13. doi:10.1093/aje/kwp318 Li, Z., Habuchi, T., Mitsumori, K., Kamoto, T., Kinoshitu, H., Segawa, T., Ogawa, O., Kato, T. (2003). Association of V89L SRD5A2 polymorphism with prostate cancer development in a Japanese population [Abstract]. The Journal of Urology, 169(6), 2378-2381. Abstract retrieved from : http://www.jurology.com/article/S0022-5347(05)63622-1/abstract Makridakis, N., Ross, R.K., Pike, M.C., Chang, L., Stanczyk, F.Z., Kolonel, L.N., Shi, C.Y., Yu, M.C., Henderson, B.E., Reichardt, J.K.V. (1997). A Prevalent Missense Substitution that modulates activity of Prostatic Steroid 5α-reductase. Cancer Research, 57, 1020-1022. Retrieved from: http://cancerres.aacrjournals.org/content/57/6/1020 Manson, J.M., Carr, M.C. (2003). Molecular Epidemiology of Hypospadias: Review of Genetic and Environmental Risk Factors. Birth Defects Research (Part A), 67, 825–836. doi:10.1002/bdra.10084 Marzuki, N.S., Suciati, L.P., Dewi, M., Tridjaja, B. (2010). Two novel mutation of SRD5A2 gene in Indonesian siblings with clinical 5-apha reductase deficiency Asea Uninet Scientific and Plenary Meeting 2016 | 441 [Abstract]. Journal of Pediactric Endocrinology and Metabolism, 23(12), 1329-33. Abstact retrieved from: http://www.ncbi.nlm.nih.gov/pubmed/21714467 Manzoni, G., Bracka, A., Palminteri, E., Marriocco, G. (2004). Hypospadia surgery: when, what, and by whom?. BJU international, 94(8), 1188-1195. doi:10.1111/j.1464410X.2004.05128.x Megiddo, I.B., Weiss, N.S., Barnett, M.J., Goodman, G.E., Chen, C. (2008). V89L Polymorphism of the 5α-Reductase Type II Gene (SRD5A2), Endogenous Sex Hormones, and Prostate Cancer Risk. Cancer Epidemiol Biomarkers Prev, 17(2), 286–91. doi:10.1158/1055-9965.EPI-07-0238 Paulozzi, L.J., Erickson, D., Jackson, R.J. (1997). Hypospadias trends in two US surveillance systems. Pediatrics, 100(5), 831-834. doi:10.1542/peds.100.5.831 Roshdy, O.H., Mohammad, N.S., Kamha, E.S., Omar, M. (2013). Genetic analysis of 5αreductase type II enzyme in relation to oxidative stress in cases of Androgenetic alopecia in a sample of Egyptian population. Our Dermatology Online, 4(4), 468474. doi:10.7241/ourd.20134.119 Salam, M.T., Ursin, G., Skinner, E.C., Dessissa, T., Reichardt, J.K. (2005). Associations between polymorphisms in the steroid 5-a reductase type II (SRD5A2) gene and benign prostatic hyperplasia and prostate cancer [Abstract]. Urol Oncol, 23, 246 – 253. Abstract retrieved from: http://www.ncbi.nlm.nih.gov/pubmed/16018939 Samtani, R., Bajpai, M., Vashisht, K., Ghosh, P.K., Saraswathy, K.N. (2011). Hypospadias risk and polymorphism in SRD5A2 and CYP17 genes: case control study among Indian children. The Journal of urology, 185, 2334-2339. doi:10.1016/j.juro.2011.02.043 Sata, F., Kurahashi, N., Ban, S., Moriya, K., Tanaka, K.D., Ishizuka, M., Nakao, H., Yahata, Y., Imai, H., Kakizaki, H., Nonomura, K., Kishi, R. (2010). Genetic polymorphisms of 17β-hydroxysteroid dehydrogenase 3 and the risk of hypospadias. J Sex Med, 7, 2729-2738. doi:10.1111/j.1743-6109.2009.01641.x Thai hanh, T.T. (2009). Hypospadia : Gene mapping and candidate Gene Studies. [Dissertation]. Retrieved from: https://openarchive.ki.se/xmlui/bitstream/handle/10616/38065/thesis.pdf Tumonggor, M.K., Karafet, T.M., Hallmark, B., Lansing, J.S., Sudoyo, H., Hammer, M.F., Cox, M.P. (2013). The Indonesian archipelago: an ancient genetic highway linking Asia and The Pacific. Journal of Human Genetics, 58, 165-173. doi:10.1038/jhg.2012.154 Vn der Zanden, L.F.M., van Rooij, I.A.L.M., Feitz, W.F.J., Vermeulen, S.H.H.M., Kiemeney, L.A.L.M., Knoers, N.V.A.M., Roeleveld, N., Franke, B. (2010). Genetics of hypospadias: are single-nucleotide polymorphisms in SRD5A2, ESR1, ESR2, ATF3 really associated with the malformation? J Clin Endocrinol Metab, 95, 2384–2390. doi: 10.1210/jc.2009-2101 Van Rooij, I.A.L.M, van der Zanden L.F.M, Brouwers M.M, Knoers N.V.A.M, Feitz W.F.J, Roelevend, N. (2013). Risk factors for different phenotypes of hypospadias: results from a Dutch case-control study. BJU International, 112, 121-128. doi:10.1111/j.1464-410X.2012.11745.x Vokwana, C.K.J. (2008). Mapping gene variation in Sub-Saharan African populations. [Dissertation]. Retrieved from: http://wiredspace.wits.ac.za/handle/10539/6892 Wang, M.H.,and Baskin, L.S. (2008). Endocrine Disruptors, Genital Development, and Hypospadia. Journal of Andrology, 29(5), 499-505. doi:10.2164/jandrol.108.004945 Wang, Y., Li, Q., Xu, J., Liu, Q., Wang, W., Lin, Y., Ma, F, Chen, T., Li, S., Shen, Y. (2004). Mutation analysis of five candidate genes in Chinese patients with 442 | Asea Uninet Scientific and Plenary Meeting 2016 hypospadias. European Journal doi:10.1038/sj.ejhg.5201232 of Human Genetics, APPENDIX SPSS analysis of V89L polymorphism of SRD5A2 gene Crosstabulation of allele vs group Group Hypospadias Allele CC Count % within Allele GG CG Total 9 20 55.0% 45.0% 100.0% 9 9 18 50.0% 50.0% 100.0% 15 17 32 46.9% 53.1% 100.0% 35 35 70 50.0% 50.0% 100.0% Count % within Allele Count % within Allele Total 11 Count % within Allele Normal Chi-Square Tests Asymp. Sig. (2Value df sided) Pearson Chi-Square .325a 2 .850 Likelihood Ratio .325 2 .850 Linear-by-Linear Association .316 1 .574 N of Valid Cases 70 a. 0 cells (,0%) have expected count less than 5. The minimum expected count is 9,00. 12, 706-712. Asea Uninet Scientific and Plenary Meeting 2016 | 443 SPSS analysis of Mutant allele vs Wildtype MUTvsWT group Crosstabulation Group Hypospadias MUTvsWT CC+CG Count % within Group GG Total Count % within Group Total 26 26 52 74.3% 74.3% 74.3% 9 9 18 25.7% 25.7% 25.7% 35 35 70 100.0% 100.0% 100.0% Count % within Group Normal Chi-Square Tests Value df Asymp. Sig. (2- Exact Sig. (2- Exact Sig. (1- sided) sided) sided) Pearson Chi-Square .000a 1 1.000 Continuity Correctionb .000 1 1.000 Likelihood Ratio .000 1 1.000 Fisher's Exact Test 1.000 Linear-by-Linear Association .000 N of Valid Cases 1 1.000 70 a. 0 cells (,0%) have expected count less than 5. The minimum expected count is 9,00. b. Computed only for a 2x2 table Risk Estimate 95% Confidence Interval Value Odds Ratio for MUTvsWT Lower Upper 1.000 .342 2.921 For cohort Group = Hipospadia 1.000 .585 1.709 For cohort Group = Normal 1.000 .585 1.709 (CC+CG / GG) N of Valid Cases 70 .607 PUBLIC HEALTH AWARENESS IN INTELLECTUAL DISABILITY FOCUS ON FRAGILE X SYNDROME: A COHORT STUDY IN INDONESIA Tri Indah Winarni* triindahw@gmail.com /tri.winarni@fk.undip.ac.id Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University Farmaditya EP Mundhofir farmaditya@yahoo.com Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University Sultana MH Faradz sultanafaradz@gmail.com Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran. Abstract Research Objectives: establishing the genetic cause of intellectual disabilities (ID) focus on fragile X syndrome (FXS) in order to tailor appropriate intervention to the patient and proper approach to the family member. Intellectual disability (ID) is a public health problem because the defect, treatment and rehabilitation require both medical and social assessment Methodologies: Screening has been performed since 1994 continuously in high risk population (special school with and without autism) using clinical, cytogenetic, and FMR1 gene PCR-based molecular approach. Preliminary Findings: The prevalence of FXS among screened ID population overtime is comparable. It was calculated to be 1.9% (5/262) in 1994 (Faradz, Buckley, Tang, Leigh, & Holden, 1999) and in 2011 was 1.7% (9/527).(F.E. Mundhofir et al., 2012). Among autism population it was determined to be 6.15% (4/65).(Winarni, Utari, Mundhofir, Hagerman, & Faradz, 2013a) Mundhofir et al (2012) was also found trisomy 21 as the major cause of ID in 14% (74/527) and other chromosome abnormalities. Cascade testing was subjected to the family members with positive result of FXS and many new cases were disclosed in our cohort study.(Winarni et al., 2012) With regards to the behavioral and emotional phenotype, FXS commonly mixed up with idiopathic autism although genetic aspect of FXS is clearly defined (type of mutation, mode of inheritance, the most common inherited ID) compared to autism which is still inconclusive. Interestingly, health care provider, government, and public awareness is inadequate with regard to identify FXS and to provide basic special need services in order to get better outcome. Potential contributions to the literature: Using a comprehensive approach to whole Indonesian data of FXS overtime and other cause of ID, our studies (will give a great contribution to the science, medical community, and stake holders. Keywords: intellectual disability; fragile X syndrome; public health awareness Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 444 Asea Uninet Scientific and Plenary Meeting 2016 1 | 445 INTRODUCTION Fragile X syndrome (FXS) is the most common cause of inherited mental retardation and a single gene disorder associated with autism spectrum disorders (ASD).(Garber, Visootsak, & Warren, 2008; Raymond, 2006; Reddy, 2005) The frequency of FXS due to full mutation allele is approximately 1 in 2500 in males and 1 in 4000 in females.(P. J. Hagerman, 2008; F.E. Mundhofir et al., 2012; Song, Barton, Sleightholme, Yao, & FrySmith, 2003) The FXS clinical phenotype is caused by imbalance of excitatory glutamatergic and inhibitory GABAergic neurotransmitters.(Paluszkiewicz, Martin, & Huntsman, 2011) It is mostly due to the expansion of CGG repeats more than 200 (full mutation) in the promotor region of the FMR1 gene that leads transcriptional silencing and results in lack of fragile X mental retardation protein (FMRP).(Coffee, Zhang, Warren, & Reines, 1999) Fragile X syndrome is the first pathogenic mutations that affect trinucleotide repeat expansions (TREs) diseases involving non-coding repeats sequences.(Cummings & Zoghbi, 2000; Verkerk et al., 1991) Until the late 1990s, fragile X site cytogenetic analysis were used to diagnose FXS. Subsequently, molecular techniques has been used to identify the FMR1 alleles since the sequence of FMR1 gene has been discovered in the beginning of 1990s.(Q. Wang et al., 1993) However, in developing countries where advanced laboratory equipment and services are very minimal and unaffordable, cytogenetic techniques are still an option to accomplish the FXS diagnosis,(Bhowmik et al., 2009) more overly, clinical symptoms of FXS especially in younger age is quite challenging to be differentiated with other nonsyndromic ID. The prevalence of FXS varies across ethnic group,(Crawford et al., 2002) it is important to provide fragile X allele frequencies for all race and across the world, so that general (low-risk) and high-risk population screening the incidence of FMR1 gene mutation is considered necessary. Population-based screening is the most favorable method to identify new FXS cases both clinically and laboratory assessment. General population screening to determine the diseases and carriers prevalence in both male and female have been reported worldwide.(Coffee et al., 2009; Dombrowski et al., 2002; Hantash et al., 2011; Rousseau, Rouillard, Morel, Khandjian, & Morgan, 1995; Toledano-Alhadef et al., 2001) Based on the American College of Medical Genetics (ACMGs) guideline, screening for FXS in high-risk population such as ID and autism population-based FXS screening have also been done to established FXS prevalence.(Estecio, Fett-Conte, Varella-Garcia, Fridman, & Silva, 2002; Faradz et al., 1999; Li, Chen, Lai, Hsu, & Wang, 1993; Reddy, 2005) Various molecular testing is developing to consider the laboratory method, simple, cost-effective with higher sensitivity and specificity of DNA-based assay method is required in population screening study.(Elias et al., 2011; Lyons, Kerr, & Mueller, 2015; Rajan-Babu, Law, Yoon, Lee, & Chong, 2015; Teo, Law, Lee, & Chong, 2012) Recently, some studies were also reported from other developing countries although mostly done basically by scientist in Saudi Arabia, Malysia, and Sri Lanka.(Chandrasekara, Wijesundera, Perera, Chong, & Rajan-Babu, 2015; Chaudhary et al., 2014; Elias et al., 2011) 2 METHODS Screenings were done in special school in Central Java and Yogyakarta provinces. Individual who were diagnosed with ASD using the criteria in the Diagnostic and Statistical Manual of Mental Disorders, 4th edition, Text Revision (DSM IV-TR) for ASD and ID by experienced pediatricians were recruited.(American Psychiatric Association, 2000) This research was approved by the Institutional Review Board of the Faculty of Medicine, 446 | Asea Uninet Scientific and Plenary Meeting 2016 Diponegoro University and the Kariadi Hospital Semarang, Indonesia, all participants signed an approved consent form to participate in this study. Heparinized peripheral blood vein was collected for cytogenetic analysis of the fragile site at Xq27.3 and chromosomal abnormalities as done previously.(Sutherland, 1979) Deoxyribonucleic acid (DNA) was extracted from ethylenediaminetetraacetic acid (EDTA) blood using modified salting out method.(Miller, Dykes, & Polesky, 1988) The fragile site was identified using solid staining followed by Giemsa staining for fragile X site confirmation. The FMR1 gene was analyzed using a PCR-based method to determine the CGG repeat length in the promotor region as described previously.(Fu et al., 1991) Males with no bands and females with only one band were assumed to have alleles consisting of high premutation or full mutation alleles, therefore, Southern blot analysis was utilized to confirm the diagnosis.(Fu et al., 1991) 3 FINDINGS AND DISCUSION ID is a public health problem, and should become important consideration due to some reasons: 1) High prevalence in a population, 2) Lifelong duration from early onset across the life span, 3) Expensive cost, include direct cost of long term care, rehabilitation, special education and indirect cost of increased morbidity and mortality since individual with ID is more vulnerable in health problem,(van Schrojenstein Lantman-de Valk et al., 1997) 4) Highly economic and society dependences, and 5) Prevention of ID for improving prognosis outcome is absolutely needed to be implemented even it is very challenging in low and middle income countries.(Durkin et al., 2006) The prevalence of ID across the world is around 1% and almost two times higher rates in low and middle income countries.(Maulik, Mascarenhas, Mathers, Dua, & Saxena, 2011) The first population study in 1997 among ID population in special school, the overall prevalence of was 5/262 (1.9%). In all, five children from three unrelated families were found to have FMR1 CGG-repeat expansions. All came from the population attending type C (ID) special schools.(Faradz et al., 1999) The second population study in 2007-2010 among ID population in special school, of the 527 individuals with ID, chromosomal abnormalities were found in 87 (16.5%). Trisomy 21 was the major chromosomal abnormality, identified in 74 patients (14%). In the remaining of 445 (162 females and 283 males) molecularly tested individuals (607 alleles, male has 1 allele, female has 2 alleles): 593 alleles are within the normal range (1544 CGG repeats), 3 alleles in the intermediate range (45-55 CGG repeats), 2 alleles in the premutation range (between 55 and 200 CGG repeats) and 9 alleles in the full mutation range (> 200 CGG repeats). The prevalence of FXS is 9/527 (1.7%). The prevalence in males and females is 1.5% (5/329) and 2% (4/198), respectively.(F. E. Mundhofir et al., 2012) The study in high risk (autism) population study, the fragile X site and FMR1 full mutation allele were identified in 3 out of 65 (4.6%) and 4 out of 65 (6.15 %) children aged 3 to 17 years (57 boys, 8 girls) respectively.(Winarni et al., 2013a) Impairment of social communication and interaction domains have been found to be dominant in four FXS children with ASD compared to those of repetitive, stereotypic and restricted patterns of behavior and interests domain. Asea Uninet Scientific and Plenary Meeting 2016 | 447 Table 1. Prevalence of FXS among ID and Autism population in Indonesia. Author Year Institution Population Σ Sample Prevalence Faradz SMH, et al 1999 ID 262 1.9% Mundhofir FEP, et al 2012 ID 527 1.7% Winarni TI, et al 2013 Faculty of Medicine Diponegoro University CEBIOR, Faculty of Medicine Diponegoro University CEBIOR, Faculty of Medicine Diponegoro University Autism 65 6.15% The level of cognitive impairment in FXS usually ranging from learning disabilities to severe ID is associated with the FMRP level.(Kaufmann, Abrams, Chen, & Reiss, 1999) In addition to the cognitive impairment, behavioral and emotional impairment have also been observed as a major problem in individuals with FXS.(Budimirovic, 2006; R. J. Hagerman, Amiri, & Cronister, 1991; Hessl, Glaser, Dyer-Friedman, & Reiss, 2006; Symons, Clark, Hatton, Skinner, & Bailey, 2003; Wisbeck et al., 2000) Early intervention is developing in many centers worldwide shows efficacy in decreasing the risk of severe cognitive impairment, and improving the behavioral, emotional, and psychosocial abilities in later life. There are numerous psychopharmacological agents that being used to improve behavioral and to manage emotional disorders in FXS whose may have impact on cognitive function(Roberts, Weisenfeld, Hatton, Heath, & Kaufmann, 2007) and improve behavioral and emotional abilities.(Randi Hagerman, Lauterborn, Au, & Berry-Kravis, 2012; R. J. Hagerman et al., 2012) Psychopharmacological agents may support the effectiveness of non-psychopharmacological intervention and both intervention result in the improvement of cognitive function. The similarity and overlapping clinical phenotype, especially in behavioral impairments, and neuroanatomical background between FXS and ASD encouraging the same approach in FXS targeted treatment.(R. Hagerman, Hoem, & Hagerman, 2010; L. W. Wang, Berry-Kravis, & Hagerman, 2010) The first FXS population-based study on 262 subjects at schools with special need in Indonesia showed a prevalence of 1.9%.(Faradz et al., 1999) New cohort of high-risk population screening of FXS has been conducted among ASD and ID using fragile X site method combine with molecular one.(F. E. P. Mundhofir et al., 2012; Winarni, Utari, Mundhofir, Hagerman, & Faradz, 2013b) The fragile X site expression has been able to detect 3 out of 4 FXS cases among autism population that eventually confirmed using PCRbased method followed by Southern blot method. The prevalence of FXS is 6.15% in ASD population.(Winarni et al., 2013a) similar result also reported from a number of studies that have been carried out in ASD population varying from 4-7%.(Li et al., 1993; Reddy, 2005) The prevalence of FXS is 1.7% (considered equal in males and females) in ID population. Surprising result had been reported in the prevalence of FXS in male and female is equal in Indonesia, suggested that the prevalence of FXS females had been underestimated.(F. E. P. Mundhofir et al., 2012) The FXS is an X-link disorders with reduced penetrance (79% in males, 35% in females), females usually less affected due to the Xinactivation.(Crawford, Acuna, & Sherman, 2001; Sherman et al., 1985) This study was a 448 | Asea Uninet Scientific and Plenary Meeting 2016 continuation of the first FXS population-based study with broader approach to identify FXS cases, cascade testing to identify carriers, and finally, to offer early intervention among FXS children. Population-based screening method in FXS has be developed related to Indonesian condition which is contained more than 17.000 islands indweled by 237.6 million populations with very minimal access to genetic facilities/centers. In Java island, the most densely populated area where 58 percent of Indonesian population live, only one FXS center conducts fragile X diagnosis both cytogenetic and molecular diagnosis that is Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University. With regards to the prevalence and the mode of inheritance, FXS screening highrisk population program should be performed routinely and initiate by the government in Indonesia. Seminar, workshops, dissemination information of fragile X syndrome should also be routinely done through leaflet distribution and online media to educate the clinicians, health care professionals, families, researchers and broader community to increase awareness. In a contrary, in develop countries such as Europe and Unites Stated, clinical and molecular guidelines have been established and revised continuously for fragile X and fragile X-associated disorders in order to identify FXS cases.(Biancalana, Glaeser, McQuaid, & Steinbach, 2015; Monaghan, Lyon, Spector, erican College of Medical, & Genomics, 2013) ACKNOWLEDGEMENT We thank all of the participants and their families for their contributions. This work was supported by Risbin IPTEKDOK grant from the Ministry of Health Republic Indonesia in 2008 – 2010, the National Institutes of Health (HD02274- FT). We thank Lusi Suwarsi, Wiwik Lestari, Dwi Kustiani, Rita Indriati, Dina Aprilani, Intus Apriasa, and Evi Nurwulan from CEBIOR Faculty of Medicine Diponegoro University for their help in laboratory processing. REFERENCES American Psychiatric Association. (2000). Diagnostic and Statistical Manual of Mental Disorders, 4th Edition-Text Revised. Washington DC: American Psychiatric Association. Bhowmik, D. A., Dutta, A., Chatterjee, A., Sinha, A. K., Chattopadhyay, A., & Mukhopadhyay, K. (2009). Screening for fragile X syndrome among neurobehavioral patients from Kolkata, Eastern India. J Clin Diagnostic Res, 3(1), 1266-1273. Biancalana, V., Glaeser, D., McQuaid, S., & Steinbach, P. (2015). EMQN best practice guidelines for the molecular genetic testing and reporting of fragile X syndrome and other fragile X-associated disorders. Eur J Hum Genet, 23(4), 417-425. doi: 10.1038/ejhg.2014.185 Budimirovic, D. B., Bukelis, I., Cox, C., Gray, R.M., Tierney, E., Kaufmann, W.E. (2006). Autism spectrum disorder in Fragile X syndrome: Differential contribution of adaptive socialization and social withdrawal. American Journal of Medical Genetics Part A, 140A(17), 1814-1826. Chandrasekara, C. H., Wijesundera, W. S., Perera, H. N., Chong, S. S., & Rajan-Babu, I. S. (2015). Cascade Screening for Fragile X Syndrome/CGG Repeat Expansions in Children Attending Special Education in Sri Lanka. PLoS One, 10(12), e0145537. doi: 10.1371/journal.pone.0145537 Asea Uninet Scientific and Plenary Meeting 2016 | 449 Chaudhary, A. G., Hussein, I. R., Abuzenadah, A., Gari, M., Bassiouni, R., Sogaty, S., Al Qahtani, M. (2014). Molecular diagnosis of fragile X syndrome using methylation sensitive techniques in a cohort of patients with intellectual disability. Pediatr Neurol, 50(4), 368-376. doi: 10.1016/j.pediatrneurol.2013.11.020 Coffee, B., Keith, K., Albizua, I., Malone, T., Mowrey, J., Sherman, S. L., & Warren, S. T. (2009). Incidence of fragile X syndrome by newborn screening for methylated FMR1 DNA. Am J Hum Genet, 85(4), 503-514. doi: 10.1016/j.ajhg.2009.09.007 Coffee, B., Zhang, F., Warren, S. T., & Reines, D. (1999). Acetylated histones are associated with FMR1 in normal but not fragile X-syndrome cells. Nature Genetics, 22, 98-101. Crawford, D. C., Acuna, J. M., & Sherman, S. L. (2001). FMR1 and the fragile X syndrome: human genome epidemiology review. Genet Med, 3(5), 359-371. Crawford, D. C., Meadows, K. L., Newman, J. L., Taft, L. F., Scott, E., Leslie, M., . . . Sherman, S. L. (2002). Prevalence of the fragile X syndrome in AfricanAmericans. Am J Med Genet, 110(3), 226-233. Cummings, C. J., & Zoghbi, H. Y. (2000). Trinucleotide repeats: mechanisms and pathophysiology. Annu Rev Genomics Hum Genet, 1, 281-328. doi: 10.1146/annurev.genom.1.1.281 Dombrowski, C., Levesque, M. L., Morel, M. L., Rouillard, P., Morgan, K., & Rousseau, F. (2002). Premutation and intermediate-size FMR1 alleles in 10 572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Hum Mol Genet, 11(4), 371-378. Durkin, M. S., Schneider, H., Pathania, V. S., Nelson, K. B., Solarsh, G. C., Bellows, N., . . . Hofman, K. J. (2006). Learning and Developmental Disabilities. In D. T. Jamison, J. G. Breman, A. R. Measham, G. Alleyne, M. Claeson, D. B. Evans, P. Jha, A. Mills, & P. Musgrove (Eds.), Disease Control Priorities in Developing Countries (2nd ed.). Washington (DC). Elias, M. H., Ankathil, R., Salmi, A. R., Sudhikaran, W., Limprasert, P., & Zilfalil, B. A. (2011). A new method for FMR1 gene methylation screening by multiplex methylation-specific real-time polymerase chain reaction. Genet Test Mol Biomarkers, 15(6), 387-393. doi: 10.1089/gtmb.2010.0191 Estecio, M., Fett-Conte, A. C., Varella-Garcia, M., Fridman, C., & Silva, A. E. (2002). Molecular and cytogenetic analyses on Brazilian youths with pervasive developmental disorders. J Autism Dev Disord, 32(1), 35-41. Faradz, S. M. H., Buckley, M., Tang, L.-P., Leigh, D., & Holden, J. J. A. (1999). Molecular screening for fragile X syndrome among Indonesian children with developmental disability. Am J Med Genet A, 83(4), 350-351. doi: 10.1002/(sici)10968628(19990402)83:4<350::aid-ajmg26>3.0.co;2-g Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Pieretti, M., Sutcliffe, J. S., Richards, S., . . . Caskey, C. T. (1991). Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell, 67(6), 1047-1058. doi: Doi: 10.1016/0092-8674(91)90283-5 Garber, K. B., Visootsak, J., & Warren, S. T. (2008). Fragile X syndrome. Eur J Hum Genet, 16(6), 666-672. doi: 10.1038/ejhg.2008.61 Hagerman, P. J. (2008). The fragile X prevalence paradox. J Med Genet, 45(8), 498-499. Hagerman, R., Hoem, G., & Hagerman, P. (2010). Fragile X and autism: Intertwined at the molecular level leading to targeted treatments. Mol Autism, 1(1), 12. doi: 20402392-1-12 [pii] 10.1186/2040-2392-1-12 450 | Asea Uninet Scientific and Plenary Meeting 2016 Hagerman, R., Lauterborn, J., Au, J., & Berry-Kravis, E. (2012). Fragile X Syndrome and Targeted Treatment Trials. In R. B. Denman (Ed.), Modeling Fragile X Syndrome (Vol. 54, pp. 297-335). Berlin Heidelberg: Springer-Verlag. Hagerman, R. J., Amiri, K., & Cronister, A. (1991). Fragile X checklist. Am J Med Genet, 38(2-3), 283-287. Hagerman, R. J., Rathmell, B., Wang, P., Cherubini, M., Carpenter, R. L., Bear, M. F., & Berry-Kravis, E. (2012). Treatment of Fragile X Syndrome with STX209 (arbaclofen): Open-Label Extension Experience. Paper presented at the International Society for Autism Research, Toronto, Canada. Hantash, F. M., Goos, D. M., Crossley, B., Anderson, B., Zhang, K., Sun, W., & Strom, C. M. (2011). FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States. Genet Med, 13(1), 39-45. doi: 10.1097/GIM.0b013e3181fa9fad Hessl, D., Glaser, B., Dyer-Friedman, J., & Reiss, A. L. (2006). Social behavior and cortisol reactivity in children with fragile X syndrome. J Child Psychol Psychiatry, 47(6), 602-610. Kaufmann, W. E., Abrams, M. T., Chen, W., & Reiss, A. L. (1999). Genotype, molecular phenotype, and cognitive phenotype: correlations in fragile X syndrome. Am J Med Genet, 83(4), 286-295. Li, S. Y., Chen, Y. C., Lai, T. J., Hsu, C. Y., & Wang, Y. C. (1993). Molecular and cytogenetic analyses of autism in Taiwan. Hum Genet, 92(5), 441-445. Lyons, J. I., Kerr, G. R., & Mueller, P. W. (2015). Fragile X Syndrome: Scientific Background and Screening Technologies. J Mol Diagn, 17(5), 463-471. doi: 10.1016/j.jmoldx.2015.04.006 Maulik, P. K., Mascarenhas, M. N., Mathers, C. D., Dua, T., & Saxena, S. (2011). Prevalence of intellectual disability: A meta-analysis of population-based studies. Res Dev Disabil, 32(2), 419-436. doi: http://dx.doi.org/10.1016/j.ridd.2010.12.018 Miller, S. A., Dykes, D. D., & Polesky, H. F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research, 16, 1215. Monaghan, K. G., Lyon, E., Spector, E. B., erican College of Medical, G., & Genomics. (2013). ACMG Standards and Guidelines for fragile X testing: a revision to the disease-specific supplements to the Standards and Guidelines for Clinical Genetics Laboratories of the American College of Medical Genetics and Genomics. Genet Med, 15(7), 575-586. doi: 10.1038/gim.2013.61 Mundhofir, F. E., Winarni, T. I., Nillesen, W., Bon, B. W. V., Schepens, M., RuiterkampVersteeg, M., . . . Faradz, S. M. (2012). Prevalence of fragile X syndrome in males and females in Indonesia. World J Med Genet, 2(3), 15-22. Mundhofir, F. E., Winarni, T. I., van Bon, B. W., Aminah, S., Nillesen, W. M., Merkx, G., . . . Yntema, H. G. (2012). A cytogenetic study in a large population of intellectually disabled Indonesians. Genet Test Mol Biomarkers, 16(5), 412-417. doi: 10.1089/gtmb.2011.0157 Mundhofir, F. E. P., Winarni, T. I., Nillesen, W., van Bon, B. W. M., Schepens, M., Ruiterkamp-Versteeg, M., . . . S.M.H., F. (2012). Prevalence of fragile X syndrome in males and females in Indonesia. World Journal of Medical Genetics, 2(3), 15. doi: 10.5496/wjmg.v2.i3.15 Asea Uninet Scientific and Plenary Meeting 2016 | 451 Paluszkiewicz, S. M., Martin, B. S., & Huntsman, M. M. (2011). Fragile X syndrome: the GABAergic system and circuit dysfunction. Dev Neurosci, 33(5), 349-364. doi: 10.1159/000329420 Rajan-Babu, I. S., Law, H. Y., Yoon, C. S., Lee, C. G., & Chong, S. S. (2015). Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube tripletprimed PCR and amplicon melt peak analysis. Expert Rev Mol Med, 17, e7. doi: 10.1017/erm.2015.5 Raymond, F. L. (2006). X linked mental retardation: a clinical guide. J Med Genet, 43(3), 193-200. doi: 10.1136/jmg.2005.033043 Reddy, K. S. (2005). Cytogenetic abnormalities and fragile-X syndrome in Autism Spectrum Disorder. BMC Med Genet, 6(1), 3. Roberts, J. E., Weisenfeld, L. A., Hatton, D. D., Heath, M., & Kaufmann, W. E. (2007). Social approach and autistic behavior in children with fragile X syndrome. J Autism Dev Disord, 37(9), 1748-1760. doi: 10.1007/s10803-006-0305-9 Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., & Morgan, K. (1995). Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome. Am J Hum Genet, 57(5), 1006-1018. Sherman, S. L., Jacobs, P. A., Morton, N. E., Froster-Iskenius, U., Howard-Peebles, P. N., Nielsen, K. B., . . . Watson, M. (1985). Further segregation analysis of the fragile X syndrome with special reference to transmitting males. Hum Genet, 69(4), 289299. Song, F. J., Barton, P., Sleightholme, V., Yao, G. L., & Fry-Smith, A. (2003). Screening for fragile X syndrome: a literature review and modelling study. Health Technol Assess, 7(16), 1-106. Sutherland, G. R. (1979). Heritable fragile sites on human chromosomes I. Factors affecting expression in lymphocyte culture. American Journal of Human Genetics, 31(2), 125-135. Symons, F. J., Clark, R. D., Hatton, D. D., Skinner, M., & Bailey, D. B., Jr. (2003). Selfinjurious behavior in young boys with fragile X syndrome. Am J Med Genet A, 118(2), 115-121. Teo, C. R., Law, H. Y., Lee, C. G., & Chong, S. S. (2012). Screening for CGG repeat expansion in the FMR1 gene by melting curve analysis of combined 5' and 3' direct triplet-primed PCRs. Clin Chem, 58(3), 568-579. doi: 10.1373/clinchem.2011.174615 Toledano-Alhadef, H., Basel-Vanagaite, L., Magal, N., Davidov, B., Ehrlich, S., Drasinover, V., . . . Shohat, M. (2001). Fragile-X Carrier Screening and the Prevalence of Premutation and Full-Mutation Carriers in Israel. Am J Hum Genet, 69, 351-360. van Schrojenstein Lantman-de Valk, H. M., van den Akker, M., Maaskant, M. A., Haveman, M. J., Urlings, H. F., Kessels, A. G., & Crebolder, H. F. (1997). Prevalence and incidence of health problems in people with intellectual disability. J Intellect Disabil Res, 41 ( Pt 1), 42-51. Verkerk, A. J., Pieretti, M., Sutcliffe, J. S., Fu, Y. H., Kuhl, D. P., Pizzuti, A., . . . Warren, S. T. (1991). Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell, 65(5), 905-914. Wang, L. W., Berry-Kravis, E., & Hagerman, R. J. (2010). Fragile X: leading the way for targeted treatments in autism. Neurotherapeutics, 7(3), 264-274. doi: S19337213(10)00047-4 [pii] 452 | Asea Uninet Scientific and Plenary Meeting 2016 10.1016/j.nurt.2010.05.005 Wang, Q., Green, E., Barnicoat, A., Garrett, D., Mullarkey, M., Bobrow, M., & Mathew, C. G. (1993). Cytogenetic versus DNA diagnosis in routine referrals for fragile X syndrome [see comments]. Lancet, 342(8878), 1025-1026. Winarni, T. I., Utari, A., Mundhofir, F. E., Hagerman, R. J., & Faradz, S. M. (2013a). Fragile X syndrome: clinical, cytogenetic and molecular screening among autism spectrum disorder children in Indonesia. Clin Genet, 84(6), 577-580. doi: 10.1111/cge.12095 Winarni, T. I., Utari, A., Mundhofir, F. E., Hagerman, R. J., & Faradz, S. M. (2013b). Fragile X Syndrome: Clinical, Cytogenetics and Molecular Screening among Autism Spectrum Disorder Children in Indonesia. Clin Genet. doi: 10.1111/cge.12095 Winarni, T. I., Utari, A., Mundhofir, F. E., Tong, T., Durbin-Johnson, B., Faradz, S. M., & Tassone, F. (2012). Identification of expanded alleles of the FMR1 gene among high-risk population in Indonesia by using blood spot screening. Genet Test Mol Biomarkers, 16(3), 162-166. doi: 10.1089/gtmb.2011.0089 Wisbeck, J. M., Huffman, L. C., Freund, L., Gunnar, M., Davis, E. P., & Reiss, A. L. (2000). Cortisol and social stressors in children with fragile X: A pilot study. J Dev Behav Pediatr, 21, 278-282. ANTIMICROBIAL ACTIVITY AND STRUCTURAL CHARACTERIZATION OF LIPOPEPTIDE PRODUCED BY BACILLUS AMYLOLIQUEFACIENS MD4-12 Pratiwi Pudjilestari Sudarmono Department of Microbiology, Faculty of Medicine Universitas Indonesia/Cipto Mangunkusumo General Hospital, Jakarta Ahmad Wibisana awibisana2000@gmail.com Biotech Center-Badan Pengkajian dan Penerapan Teknologi, Gedung 630 Kawasan Puspiptek Setu Tangerang Selatan; T. Mirawati Sudiro Department of Microbiology, Faculty of Medicine Universitas Indonesia/Cipto Mangunkusumo General Hospital, Jakarta Wahono Sumaryono Pusat Teknologi Farmasi dan Medika-Badan Pengkajian dan Penerapan Teknologi, Gedung Laptiab Kawasan Puspiptek Setu Tangerang Selatan; Faculty of Pharmacy Universitas Pancasila, Jalan Srengseng Sawah Jagakarsa Jakarta Selatan 12640; Abstract Antimicrobial peptides including lipopeptide showed great potential for biomedical application. Several lipopeptide exhibited both narrow and broad spectrum inhibition activities. In line with that, this research was conducted to investigate the antimicrobial activity of the lipopeptide produced by Bacillus amyloliquefaciens MD4-12 isolated from oil-contaminated soil, followed by structural characterization using mass spectrometry. The isolate was cultivated in McKeen medium and the lipopeptide was isolated by precipitation and extraction with methanol. The lipopeptide showed antibacterial activity detected by agar disc diffusion method against several gram-positive and negative bacteria, including resistant bacteria. Further lipopeptide purification was conducted by reverse phase high-performance liquid chromatography (HPLC) using isocratic elution method. The lipopeptide resolved into seven major fractions. The fifth, sixth and seventh HPLC fractions eluting at retention time 31.5, 36.3 and 41.6 min, respectively, showed antibacterial activity. Structural characterization of methanol-extracted lipopeptide by mass spectrometry showed that the lipopeptide consists of two groups of ion peaks, with the range of m/z 994 to 1072 and 1421–1576. Based on the literature study, they belong to surfactin and fengycin family, respectively. Analysis of surfactin family by LC-ESI-MS yielded nine ion peaks at m/z 994, 1008, 1022, 1036, 1045, 1050, 1059, 1065 and 1072. The peaks with m/z 994, 1008, 1022, 1036, 1050, and 1065 represent the [M+H] + ions of surfactin homolog while m/z 1045, 1059 and 1072 represent the [M+Na] + ions of surfactin. The fragmentation pattern of each [M+H]+ ion peaks revealed that the peptide moiety contains seven amino acids identified as Glu-Leu/Ile-Leu-Val-Asp-Leu- Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 453 454 | Asea Uninet Scientific and Plenary Meeting 2016 Leu/Ile while fatty acid moiety comprises a different length of chain from C12 – C17. Key words: lipopeptide, surfactin, antimicrobial, Bacillus amyloliquefaciens 1 INTRODUCTION Antimicrobial peptide, including lipopeptide, has been investigated intensively to overcome the resistance issue of pathogens. The high diversity of lipopeptide-producing microorganisms and the plethora of chemical structure make it reasonable to expect novel antibiotics from this molecule and use as a powerful arsenal to fight multi-drug resistant (MDR) problem. Several lipopeptide with different chemical structures and function have been studied and showed both narrow and broad spectrum inhibition activities against gram-positive and negative bacteria including resistance strains (Rodrigues, van der Mei, Banat, Teixeira, & Oliveira, 2006). For instance, daptomycin, a cyclic lipopeptide, can be used to treat a serious infection, caused by vancomycin and meticillin-resistant pathogen (Steenbergen, Alder, Thorne, & Tally, 2005). The lipopeptide structure consists of an amino-acid moiety linked to a fatty acid. Bacilli are known for their ability to produce several lipopeptide, such as surfactin (Arima, Kakinuma, & Tamura, 1968), iturin A (Sandrin, Peypoux, & Michel, 1990), fengycin (Wang, Liu, Wang, Yao, & Yu, 2004), bacillomycins (Peypoux, Besson, Michel, & Delcambe, 1981), mycosubtilin (Besson & Michel, 1989), plipastatin (Nishikiori, Naganawa, Muraoka, Aoyagi, & Umezawa, 1986), and lichenysins A/B/C/G (Grangemard, Bonmatin, Bernillon, Das, & Peypoux, 1999; Lin, Minton, Sharma, & Georgiou, 1994). The diversity of lipopeptide chemical structure and characteristics are influenced by producer strain and ecological differences of microbial producers (Price, Rooney, Swezey, Perry, & Cohan, 2007). There are three families of cyclic lipopeptides, produced by Bacillus, classified in surfactin, iturin and fengycin. Each family contains variants with the same peptide length but with different composition. Moreover, each variant can have several homologous with of different length and isomer of the fatty acid chain, leading to a remarkable structural diversity (Ongena & Jacques, 2008). Surfactin, a well-known lipopeptide with strong interfacial activity, has been reported have potent activity for antibacterial (Xu, Rong, Zhao, Song, & Chi, 2014), antifungal (Caldeira, Arteiroa, Coelhoa, & Roseiro, 2011; Violeta et al., 2011), antiadhesive (Das, Mukherjee, & Sen, 2009a; Rodrigues et al., 2006), antitumor (Kameda et al., 1974), and anti-proliferative (Kim et al., 2007). Surfactin structure consists of a hydrophilic part of cyclic heptapeptide and a hydrophobic part of a β-hydroxy fatty acid. The heptapeptide consists of seven amino acids (typically: L-Glu-L-Leu-D-Leu-L-Val-LAsp-D-Leu-L-Leu) (Arima et al., 1968; Kakimuma et al., 1969). Some homologous with different peptide sequence, such as [Val7] surfactin, [Ile7] surfactin (Baumgart, Kluge, Ullrich, Vater, & Ziessow, 1991), [Ala4] surfactin (Peypoux, Bonmatin, Labbe, & Grangemard, 1994), and [Asp1, Glu5] surfactin (X. Liu, Haddad, Yang, & Mu, 2007) have been reported. The β-hydroxy fatty acid may consist of n-, iso-, or anteiso-3-hydroxy fatty with 12–17 carbons (Kanatomo, Nagai, Ohki, & Yasuda, 1995; X. Liu et al., 2007; X. Liu, Yang, & Mu, 2008; Khyati V. Pathak & Keharia, 2014 ; Xiangyang, Namir, & Shizhong Yang and Bozhong, 2007) that allows surfactin to penetrate cellular membranes. In this study, Bacillus amyloliquefaciens MD4-12 was used to produce lipopeptide via a fermentation process and the antimicrobial activity was evaluated. Furthermore, characterization of isolated lipopeptide was also reported. Asea Uninet Scientific and Plenary Meeting 2016 2 2.1 | 455 MATERIALS AND METHODS Microorganisms Bacillus amyloliquefaciens MD4-12 isolated from oil-contaminated soil taken from Pertamina oil refinery area in Palembang Indonesia. The isolated microorganism was stored as lyophilized culture and kept at -80oC. From the lyophilized culture, subcultures were done on nutrient agar, consisted of meat extract 3.0 g/L, meat peptone 10.0 g/L and agar 15.0 g/L. The microorganisms used for bioassay consisted of Gram-positive bacteria: S. aureus ATCC 25923, MRSA, B. substilis ATCC 6633, B. cereus ATCC 14579, and Gram-negative bacteria: E. coli ATCC 25922, E. coli ATCC 32518, K. pneumonia ATCC 13833, S. tiphymurium ATCC 14028 and P. aeruginosa ATCC 27853. 2.2 Culture medium A McKeen medium was used for the production of surfactants and consisted of (per liter of distilled water): glucose 25 g, monosodium glutamate 2.5 g, yeast extract 3.0 g, MgSO4. 7H2O 1.0 g, K2HPO4 1.0 g, KCl 0.5 g, trace element 1.0 ml. Trace element composition (in 100 ml of distilled water) was: MnSO4.7H2O 0.64 g, CuSO4.5H2O 0.16 g, FeSO4.7H2O 0.015 g. Before sterilization, the broth pH was adjusted to 7.0 (Violeta et al., 2011). 2.3 Inoculum and culture conditions B. amyloliquefaciens MD4-12 was streaked on a nutrient agar slant and incubated at 37ºC. After 24 h, two loops of cells were inoculated in 25 mL of nutrient broth in a 250 mL Erlenmeyer flask and incubated in a rotatory shaker at 250 rpm and 37ºC until absorbance around 3, measured spectrophotometrically at 600 nm (Shimadzu) was reached. The culture from Erlenmeyer flask was then transferred to 100 mL of production medium in a 500 mL Erlenmeyer flask and incubated in the rotatory shaker at 200 rpm and 30ºC for 28 h. Samples were collected at time-defined intervals and submitted to analysis for determination of biomass production and lipopeptide concentration. All experiments were performed in triplicate. 2.4 Precipitation and extraction of lipopeptides The partial purification of lipopeptide was performed by precipitation and methanol extraction method (Das, Mukherjee, & Sen, 2008). Briefly, the lipopeptide was precipitated from cell-free broth of the culture of 28 h by adjusting the broth pH to 2.0 using 6N HCl and keeping it at 4ºC overnight. Precipitated material was collected by centrifugation, 10.000 for 15 min. This pellet was then re-suspended in water; pH was raised to 7.5, lyophilized and solvent-extracted with methanol. The methanol-soluble fraction was dried using centrifugal vacuum concentrator at 45oC. After the removal of methanol, minimum quantity of water was added to dissolve the lipopeptide, which was again lyophilized and weighed for quantification. Lipopeptide was stored at –20oC for further studies. 2.5 Lipopeptide purification Lipopeptide purification was performed using HPLC (Waters) with a C18 reverse phase (Symmetry, 4.6 x 250 mm, particle size 5 µm) column. The mobile phase consisted of acetonitrile (contained 0.1% trifluoroacetic acid) and Milli-Q water. An isocratic mode of 40:60% of acetonitrile – water was used for solvent elution at a flow rate of 0.8 mL/min for 50 min. Fractions were detected by UV detection at a wavelength of 210 nm. Fractions were collected from multiple runs and combined for the subsequent antimicrobial activity assays. 456 | Asea Uninet Scientific and Plenary Meeting 2016 2.6 Biomass measurements Biomass concentration was determined spectrophotometrically at wave length 600 nm during cultivation. 2.7 Antimicrobial activity The antimicrobial activity of the lipopeptide was evaluated using the agar disc diffusion method. Test bacteria were streaked on nutrient agar plate and incubate for 24 hours at 37oC. Two or three loop of colony were touched and inoculate into 5 ml Mueller-Hinton broth in a tube and incubate for 3-4 hours in water bath shaker at 37oC to obtained initial logarithmic growth. The culture suspension was standardized to a turbidity standard equivalent to 0.5 on the McFarland scale (108 CFU/mL). The resulting suspension was diluted 100x to yield a cellular concentration of 106 CFU/mL. The sterile cotton swab was dipped into culture suspension and streaked on calcium (25 µg/mL) supplemented MuellerHinton agar surface. Sterile Whatman filter paper (no. 1) discs of diameter 6 mm were kept aseptically on the surface of these pre-inoculated MHA plates. The disc then impregnated with 10 µl of the stock solutions of the lipopeptide samples in methanol. A disc soaked in methanol was kept as negative control. The plates were incubated at 37oC for 24 h and after growth, the microbial growth inhibition zones around the discs were measured using a caliper. All tests were performed in triplicate. 2.8 Structural characterization UPLC–ESI–MS spectra were acquired over the mass range of m/z 50–2,000 by passing the analyte through an Acquity UPLC with BEH-C18 column (Waters, 2.1x50 mm, 1.7 µm particle size) using acetonitrile /H2O/0.1 % (v/v) formic acid on a UPLC system, coupled with ion trap mass spectrometer in positive ion mode. Mass spectrometry XEVO-G2qTOF (Waters) was used for sample ionization. An isocratic (40:60% of acetonitrile –water in 50 min) pumped at a constant flow rate of 0.8 mL/min was used with a run time of 60 min. Tandem mass spectrometry was used for fragmentation of ion precursors to determine the amino acid sequence of the peptide moiety. The apparatus conditions were: ESI (electrospray ionization), positive mode; capillary temperature, 300oC; capillary voltage, 40 V and carrier gas flow 500 L/h. The lipopeptide and fractions were loaded to mass spectrometry directly without hydrolysis. Tandem-MS was done by collision-induced dissociation-mass spectrometry (CID-MS) using argon as collision gas and collision energy of 40 eV. 3 3.1 RESULTS Lipopeptide Production The cell growth and lipopeptide production of B. amyloliquefaciens MD4-12 were presented in Fig. 1. A direct relationship between microbial growth and lipopeptide production was observed. During 12 hours cultivation, the exponential growth was observed, as well as the lipopeptide production. The maximum concentrations of lipopeptide obtained by precipitation and methanol extraction were 0.51g/L. Asea Uninet Scientific and Plenary Meeting 2016 | 457 Lipopeptide OD 600 nm 1.6 1.2 0.8 0.4 0.0 0 4 8 12 16 20 24 28 32 36 40 44 48 52 Time (hour) OD 600 nm Lipopeptide (g/L) Fig.1 Growth kinetics (OD600 nm) and lipopeptide production versus time by B. amyloliquefaciens MD4-12. 3.2 Antimicrobial Activity The antimicrobial activities of the lipopeptide produced by B. amyloliquefaciens MD4-12 against test bacteria are shown in Table 1. The compounds showed the ability to inhibit Gram positive, such as S. aureus ATCC 25923, MRSA, B. substilis ATCC 6633, B. cereus ATCC 14579 as well as Gram-negative, such as E. coli ATCC 25922, E. coli ATCC 32518, K. pneumonia ATCC 13833, S. tiphymurium ATCC 14028 and P. aeruginosa ATCC 27853 bacteria used in this test. This result showed that the lipopeptide produced by Bacillus genus present a great potential for biotechnological and biopharmaceutical applications due their biological properties. 3.3 Lipopeptide characterization In order to confirm the lipopeptide structure, the lipopeptide was dissolved in methanol and submitted to a set of ESI-MS analyses in the positive ionization mode [M-H]+ . Two groups of ion peaks were observed with the range of m/z 994 to 1072 and 1421–1576. Based on literatures, these ion peaks were putatively assigned to surfactin and fengycin family, respectively 458 | Asea Uninet Scientific and Plenary Meeting 2016 Table 1. Antibacterial activity of biosurfactant produced by B. amyloliquefaciens MD412 Microorganism Inhibition diameter (mm) S. aureus ATCC 25923 MRSA B. substilis ATCC 6633 B. cereus ATCC 14579 E. coli ATCC 25922 E. coli ATCC 32518 ** K. pneumonia ATCC 13833 S. tiphymurium ATCC 14028 P. aeruginosa ATCC 27853 20 ± 0,53* 18 ± 0,76* 9.26 ± 0.65 13.53 ± 1.45 11.43 ± 0.63 11.35 ± 0.40 13.93 ± 0.44 11.03 ± 0.64 15.68 ± 0.68 Notes: *) The growth inhibition bacteria were observed with unclear border **) Beta-lactamase producer bacteria A B Figure 2. ESI-MS spectra of methanolic lipopeptide extract (A), surfactin family (B) (Grangemard et al., 1999; Kowall, Vater, Kluge, Stein, & Ziessow, 1998; Peypoux et al., 1991; Vater, Barbel, Wilde, & Frnake, 2002). Fengycin was known has antifungal activity, so was not used for further study in this experiments. The analysis of surfactin family by LC-ESI-MS yielded nine main ion peaks at m/z 994, 1008, 1022, Asea Uninet Scientific and Plenary Meeting 2016 | 459 (A) (B) (C) (D) (E) Figure 3. Positive ionization mass spectrometry of lipopeptide. Positive tandem MS spectra [M+H]+ of C12-surfactin (A), C13-surfactin (B), C14-surfactin (C), C15surfactin (D) and C16-surfactin (E). Fragmentation of ion precursor m/z 1065 denoted C17-surfactin was not shown 460 | Asea Uninet Scientific and Plenary Meeting 2016 1036, 1045, 1050, 1059, 1065 and 1072 (Fig. 2A). The peaks with m/z 994, 1008, 1022, 1036, 1050, and 1065 represent the [M+H]+ ions of surfactin homolog while m/z 1045, 1059 and 1072 represent the [M+Na]+ ions of surfactin (Fig. 2B). The use of electron spray for surfactin ionization by mass spectrometry was reported often to result sodium adduct that arise together with others precursor ions as minor peaks (K.V. Pathak, Keharia, Gupta, Thakur, & Balaram, 2012). The alkali metal ions bind to free carboxylic acid group in surfactin and form metal ion adducts. The most frequently observed was sodium and potassium adducts of surfactin since these metal ions are ubiquitously present in nature (Hue, Serani, & Laprevote, 2001; Vater et al., 2002). The difference in mass of 14 Da of the precursor ions showed that surfactin varied only in the fatty acid moiety that was composed of β-hydroxy fatty acids of varying lengths: C12 (m/z 994), C13 (m/z 1008), C14 (m/z 1022), C15 (m/z 1036), C16 (m/z 1050) and C17 (m/z 1065). The ions with m/z 994, 1008, 1022, 1036, 1050, and 1065 were further characterized by tandem mass spectrometry. Fragmentation of these precursor ions resulted b and y-types serial fragment ions (Fig. 3A-E). The marker ions of surfactin with m/z 441 and 685 were also observed as the product of the cleavage between Glu-Leu and FA-Leu, with the net charge retained in the residual hexapeptide (Leu-Leu-Val-Asp-Leu-Leu) and the product of an y6-b5 cleavage that yields the residual tetrapeptide Leu-Leu-Val-Asp, respectively (Hue et al., 2001). The fragment ions with 18 Da and 28 Da difference mass respective to parent ions were also observed. For example, fragmentation of precursor ion with m/z 1036 yielded ion peak with m/z 465 (18 Da mass differences to its parent ion with m/z 483; b2-H2O). This ion peak corresponds to loss of H2O from its parent ion. In addition, fragment ions with m/z 119 (a1) and 328 (a2) also observed as result from the loss of carbonyl mass (-C=O; 28 Da) from its parent ions (m/z 227 (y2) and 328 (b1), respectively) (Fig. 4D). Those ion peaks seems to be general feature during fragmentation of cyclic depsipeptides (Hue et al., 2001). Therefore, by de novo sequencing, based on each serial fragment ion revealed that the peptide moiety of surfactin produced by Bacillus amyloliquefaciens MD4-12 have the same amino acid sequence, consist of Glu-Leu/IleLeu-Val-Asp-Leu-Leu/Ile. 3.4 Lipopeptide purification In this study purification of lipopeptide revealed seven major peaks (Fig 4). Antimicrobial activity of each peak was examined against Pseudomonas aeruginosa ATCC 27853. The peaks 5, 6 and 7 with retention time 31.5, 36.3 and 41.6 min, respectively, showed antimicrobial activity. The active lipopeptide fractions (peaks 5, 6 and 7) were analyzed by LC-ESI-MS to determine surfactin homologous. The peak 5 gave ion peaks with m/z 1036, 1045, 1050, 1059 and 1072; peak 6 gave ion peaks with m/z 1036, 1050 and 1058 and peak 7 gave ion peaks with m/z 1008, 1036, 1045 and 1059. Ion peaks with m/z 1008, 1036 and 1050 represent the [M+H]+ ions of surfactin group while m/z 1045, 1059 and 1072 represent the [M+Na]+ ions, the sodium adduct of their precursor ions. Asea Uninet Scientific and Plenary Meeting 2016 | 461 Figure 4. HPLC chromatogram of compounds obtained from Bacillus amyloliquefaciens MD4-12 culture supernatant after precipitation by adjusting pH with 6 N HCl and extraction using methanol 4 DISCUSSION Production of lipopeptide by B. amyloliquefaciens MD4-12 showed a direct relationship between microbial growth and lipopeptide production. The similar results were also shown by other researchers (Das, Mukherjee, & Sen, 2009b; Makkar, Cameotra, & Banat, 2011). Generally, the use of simple substrates are easily utilized by the cell will provide maximum lipopeptide production. Carbon source is assimilated in tricarboxylic acid cycle (TCA) produce intermediates that will be part of amino acid and lipid moieties of lipopeptides. Lipopeptide antibiotic produced by microorganisms is one of the emerging strategies to overcome of the resistance issue of common microbial pathogens. The unique mechanism of action of lipopeptide antibiotic has been paid attention to researchers. They form pores in membranes of bacteria that may cause ion effluxes, including Na + and K+, which result in membrane disruption and cell death. By this mode of action the chance of resistance development in microbes could be reduced hence, offers a promising alternative to overcome of multidrug-resistant infectious diseases (Xu et al., 2014). The two important properties of lipopeptide related to mode of action are the number of lipopeptide tend to oligomerize and their ability to interact with membranes via their lipid tail (Straus & Hancock, 2006). The lipopeptide produced by Bacillus amyloliquefaciens MD4-12, showed growth inhibition activity against Gram positive and negative bacteria used in this research including multi-drug resistant bacteria, MRSA. Similar result also was shown in study by (Das et al., 2008). The lipopeptide was also active against E. coli ATCC 32518, the betalactamase producer bacteria. Secretion of beta-lactamase is one of the important mechanisms for bacteria to resist against antibiotics. Among lipopeptides produced by Bacillus, surfactin is the most potential for antimicrobial activity. Purification of surfactin by HPLC using an isocratic elution method has been conducted by researches (X. Liu et al., 2012; Mubarak, Hassan, Hamid, Khalil, & Isa, 2015). High purity of surfactin (98% purity) was obtained after separation and purification from fementation broth (Mubarak et al., 2015). However, surfactin product still contains mixture of its homologous. The similar results were also obtained in this study. HPLC surfactin fractions showed contain mixture of surfactin homologous according to LC-MS results. 462 | Asea Uninet Scientific and Plenary Meeting 2016 Surfactin is synthesized non-ribosomally in Bacillus that involves multi-enzymes called non-ribosomal peptide synthetases (Pirri, Giuliani, Nicoletto, Pizutto, & Rinaldi, 2009). Surfactin structure consists of a cyclic peptide linked to fatty acid moiety. The primary surfactin molecule contains the heptapeptide sequence Glu-Leu-Leu-Val-AspLeu-Leu and C13-C15 β-hydroxy-fatty acid chain. The lipopeptides belonging surfactin family has several variants which may differ in amino acid composition (Ala, Val, Leu or Ile amino acid variations at positions 2, 4, and 7) or differing in the length, branching, and saturation of their acyl chain (J. F. Liu, Mbadinga, Yang, Gu, & Mu, 2015; Khyati V. Pathak & Keharia, 2014 ; Peypoux et al., 1991; Peypoux et al., 1994). Variation of surfactin is highly dependent on strain, culture condition and growth medium composition (Das et al., 2009b; Singh, Rautela, & Cameotra, 2014). Structural diversity of surfactin can influence its physiochemical properties and biological activities significantly including interaction with microbial membrane (Das et al., 2009a; Vater et al., 2002). In this work, surfactin variants has been observed with difference length of lipid chain, consist of C12-C17 surfactin. As far as we know, this is the first time to report of the six surfactin variants produced by Bacillus amyloliquefaciens. 5 CONCLUSION In conclusion, Bacillus amyloliquefaciens MD4-12 isolated from oil-contaminated soil has ability to produce lipopeptide when cultivated using McKeen medium. Production of lipopeptide showed direct relationship between microbial growth and lipopeptide production. By ESI-MS, two families of lipopeptide could be identified putatively as surfactin and fengycin. Further analysis using tandem mass spectrometry, six variants of surfactin (C12-C17 surfactin) with the same amino acid sequence in peptide moiety could be revealed. Surfactin showed antibacterial activity against several gram-positive and negative bacteria including resistant strain. This study showed the potency of microbial lipopeptides for biomedical application. Further, it would be worth continuing screening and isolation of lipopeptide-producing microorganisms to obtain novel lipopeptides with more powerful against human pathogenic microorganisms. ACKNOWLEDGEMENT This work was supported by Scholarship Fund for Doctoral Program from Kementrian Riset dan Teknologi – Indonesia. REFERENCES Arima, K., Kakinuma, A., & Tamura, G. (1968). Surfactin, a crystalline peptidelipid surfactant produced by Bacillus subtilis: isolation, characterization and its inhibition of fibrin clot formation. Biochemical and Biophysical Research Communications 31, 488–494. Baumgart, F., Kluge, B., Ullrich, C., Vater, J., & Ziessow, D. (1991). Identification of amino acid substitutions in the lipopeptide surfactin using 2D NMR spectroscopy. Biochem. Biophy. Res. Commun. , 177, 998–1005. Besson, F., & Michel, G. (1989). Action of mycosubtilin, an antifungal antibiotic of Bacillus subtilis, on the cell membrane of Saccharomyces cerevisiae. Microbios. , 59(239), 113-121. Caldeira, A. T., Arteiroa, J. M. S., Coelhoa, A. V., & Roseiro, J. C. (2011). Combined use of LC–ESI-MS and antifungal tests for rapid identification of bioactive Asea Uninet Scientific and Plenary Meeting 2016 | 463 lipopeptides produced by Bacillus amyloliquefaciens CCMI 1051, Article in Press. Process Biochem., xxx–xxx. Das, P., Mukherjee, S., & Sen, R. (2008). Antimicrobial potential of a lipopeptide biosurfactant derived from a marine Bacillus circulans. Journal of Applied Microbiology, 104, 1675–1684. Das, P., Mukherjee, S., & Sen, R. (2009a). Antiadhesive action of a marine microbial surfactant. Colloids Surf. B. Biointerfaces, 71, 183–186. Das, P., Mukherjee, S., & Sen, R. (2009b). Substrate dependent production of extracellular biosurfactant by a marine bacterium. Bioresour Technol 100, 1015–1019. Grangemard, I., Bonmatin, J. M., Bernillon, J., Das, B. C., & Peypoux, F. (1999). Lichenysins G, a novel family of lipopeptide biosurfactants from Bacillus licheniformis IM 1307: production, isolation and structural evaluation by NMR and mass spectrometry. J. Antibiot. , 52, 363–373. Hue, N., Serani, L., & Laprevote, O. (2001). Structural investigation of cyclic peptidolipids from Bacillus subtilis by high energy tandem mass spectrometry. Rapid Communications in Mass Spectrometry, 15, 203-209. Kakimuma, A., Ouchida, A., Shima, T., Sugino, H., Isono, M., Tamura, G., et al. (1969). Confirmation of the structure of surfactin by mass spectrometry. Agric. Biol. Chem. , 33, 1669–1671. Kameda, Y., Ohira, S., Matsui, K., Kanatomo, S., Hase, T., & Atsusaka, T. (1974). Antitumor activity of Bacillus natto. V. Isolation and characterization of surfactin in the culture medium of Bacillus natto KMD2311. Chem. Pharm. Bull., 22, 938944. Kanatomo, S., Nagai, S., Ohki, K., & Yasuda, Y. (1995). Study on surfactin, a cyclic depsipeptide. I: Isolation and structure of eight surfactin analogs produced by Bacillus natto KMD-2311. Yakugaku Zasshi, 115, 756–764. Kim, S. Y., Kim, J. Y., Kim, S. H., Bae, H. J., Yi, H., Yoon, S. H., et al. (2007). Surfactin from Bacillus subtilis displays anti-proliferative effect via apoptosis induction, cell cycle arrest and survival signaling suppression. FEBS Lett. , 581(5), 865-871. Kowall, M., Vater, J., Kluge, T., Stein, P., & Ziessow, D. (1998). Separation and characterization of surfactin isoforms produced by Bacillus subtilis OKB 105. J Colloid Interface Sci. , 203, 1–8. Lin, S. C., Minton, M. A., Sharma, M. M., & Georgiou, G. (1994). Structural and immunological characterization of a biosurfactant produced by Bacillus licheniformis JF-2. Appl. Environ. Microbiol. , 60, 31–38. Liu, J. F., Mbadinga, S. M., Yang, S. Z., Gu, J. D., & Mu, B. Z. (2015). Chemical Structure, Property and Potential Applications of Biosurfactants Produced by Bacillus subtilis in Petroleum Recovery and Spill Mitigation. Int. J. Mol. Sci., 16, 48144837. Liu, X., Haddad, N. I., Yang, S., & Mu, B. (2007). Structural characterization of eight cyclic lipopeptides produced by Bacillus subtilis HSO 121. Protein Pept. Lett. , 14. Liu, X., Ren, B., Gao, H., Liu, M., Dai, H., Song, F., et al. (2012). Optimization for the Production of Surfactin with a New Synergistic Antifungal Activity. PLoS ONE 7(5), e34430. doi:34410.31371/journal.pone.0034430. Liu, X., Yang, S. Z., & Mu, B. Z. (2008). Isolation and characterization of a C-12lipopeptide produced by Bacillus subtilis HSO 121. J. Pept. Sci. , 14, 864–875. Makkar, R. S., Cameotra, S. S., & Banat, I. M. (2011). Advances in utilization of renewable substrates for biosurfactant production. AMB Express 1(5). 464 | Asea Uninet Scientific and Plenary Meeting 2016 Mubarak, M. Q. E., Hassan, A. R., Hamid, A. A., Khalil, S., & Isa, M. H. M. (2015). A Simple and Effective Isocratic HPLC Method for Fast Identification and Quantification of Surfactin. Sains Malaysiana, 44(1), 115–120 Nishikiori, T., Naganawa, H., Muraoka, Y., Aoyagi, T., & Umezawa, H. (1986). Plipasatins: new inhibitors of phospholipase A2 produced by Bacillus cereus BMG302-fF67.III. Structural elucidation of plipastatins. J. Antibiot., 35. Ongena, M., & Jacques, P. (2008). Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol, 16, 115–125. Pathak, K. V., & Keharia, H. (2014 ). Identification of surfactins and iturins produced by potent fungal antagonist, Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) tree using mass spectrometry. 3 Biotech 4, 283–295. Pathak, K. V., Keharia, H., Gupta, K., Thakur, S. S., & Balaram, P. (2012). Lipopeptides from banyan endophyte, Bacillus subtilis K1: mass spectrometric characterization of a library of fengycins. J Am Soc Mass Spectrom., 10, 1716–1728. Peypoux, F., Besson, F., Michel, G., & Delcambe, L. (1981). Structure of bacillomycin D, a new antibiotic of the iturin group Eur. J. Biochem., 118(2), 323-327. Peypoux, F., Bonmatin, J. M., Labbe, H., Das, B., Ptak, M., & Michel, G. (1991). Isolation and characterization of a new variant of surfactin, the [Val7]surfactin. Eur J Biochem. , 202, 101-106. Peypoux, F., Bonmatin, J. M., Labbe, H., & Grangemard, I. (1994). [Ala4] Surfactin, a novel isoforms from Bacillus subtilis studied by mass and N, R spectroscopies. Eur J Biochem. , 224, 89–96. Pirri, G., Giuliani, A., Nicoletto, S., Pizutto, L., & Rinaldi, A. (2009). Lipopeptides as antiinfectives: a practical perspective. Cent Eur J Biol., 4(3), 258–273. Price, N. P., Rooney, A. P., Swezey, J. L., Perry, E., & Cohan, F. M. (2007). Mass spectrometric analysis of lipopeptides from Bacillus strains isolated from diverse geographical locations. FEMS Microbiol. Lett., 271(1), 83–89. Rodrigues, L., van der Mei, H. C., Banat, I. M., Teixeira, J. A., & Oliveira, R. (2006). Inhibition of microbial adhesion to silicone rubber treated with biosurfactant from Streptococcus thermophilus A. FEMS Immunol. Med. Microbiol., 46, 107–112. Sandrin, G., Peypoux, F., & Michel, G. (1990). Coproduction of surfactin and iturin A, lipopeptides with surfactant and antifungal properties, by Bacillus subtilis. Biotechnology and Applied Biochemistry 12, 370–373. Singh, A. K., Rautela, R., & Cameotra, S. S. (2014). Substrate dependent in vitro antifungal activity of Bacillus sp strain AR2. Microbial Cell Factories 13, 67. Steenbergen, J., Alder, J., Thorne, G., & Tally, F. (2005). Daptomycin: a lipopeptide antibiotic for the treatment of serious Gram-positive infections J. Antimicrob Chemother 55(3), 283-288. Straus, S., & Hancock, R. (2006). Mode of action of the new antibiotic for Gram-positive pathogens daptomycin: comparison with cationic antimicrobial peptides and lipopeptide. . Biochim Biophys Acta. , 1758(9), 1215-1223. Vater, J., Barbel, K., Wilde, C., & Frnake, P. (2002). Matrix-assisted laser desorption ionization time of flight mass spectrometry of lipopeptide biosurfactants in whole cells and culture filterates of Bacillus subtilis C-1 isolated from petroleum sludge. Appl Environ Microbiol., 68, 6210–6219. Violeta, O., Oana, S., Matilda, C., Maria, C. D., Catalina, V., Gheorghe, C., et al. (2011). Production of biosurfactant and antifungal compounds by new strains of Bacillus spp. isolated from different sources. Romanian Biotechnologycal Letters, 16 (1), 84-91. Asea Uninet Scientific and Plenary Meeting 2016 | 465 Wang, J., Liu, J., Wang, X., Yao, J., & Yu, Z. (2004). Application of electrospray ionization mass spectrometry in rapid typing of fengycin homologous produced by Bacillus subtilis. Letters in Applied Microbiology, 39, 98–102. Xiangyang, L., Namir, I. A. H., & Shizhong Yang and Bozhong, M. (2007). Structural Characterization of Eight Cyclic Lipopeptides Produced By Bacillus subtilis HSO121. Protein & Peptide Letters, 14(8), 766-773. Xu, H. M., Rong, Y. J., Zhao, M. X., Song, B., & Chi, Z. M. (2014). Antibacterial activity of the lipopetides produced by Bacillus amyloliquefaciens M1 against multidrugresistant Vibrio spp. isolated from diseased marine animals. Appl. Microbiol. Biotechnol. , 98, 127–136. DIFFERENTIATION POTENTIAL OF AMNION MEMBRANE AND DENTAL PULP DERIVED MESENCHYMAL STEM CELL TO GENERATE NEURON INDUCED WITH EGF, FGF, PDGF AND FORSKOLIN 1,2Fedik Abdul Rantam, 1,4Ferdiansyah, 1,3Purwati, 1Candra Bumi., 1Helen Susilowati., 1Eryk Hendrianto, 1,4Dwi Novembri Utomo, 1,4Heri Suroto, 1,5Rosy Setiawati, 6Nike Hendrijantini, 7Rimayanti fedik.ar@gmail.com 1 Stem Cell Center, Institute Of Tropical Disease (ITD) Airlangga University Surabaya, Indonesia 2 Lab of Virology and Immunology, Microbiology Dep., School of Vet. Medicine, Airlangga University, 3Internal Medicine Dep. RSUD Dr. Soetomo / School of Medicine Airlangga University, 4 Orthopedic and Traumatologi Dep. RSUD Dr. Soetomo Hospital/School of Medicine Airlangga University. Surabaya, Indonesia 5 Radiology Dep. RSUD Dr. Soetomo Teaching Hospital/School of Medicine Airlangga University, Surabaya, Indonesia 6 Department of Prosthodontic, Faculty of Dental Medicine, Airlangga University, Surabaya, Indonesia. 7Department of Reproduction. Faculty of Veterinary Medicine, Airlangga University, Surabaya, Indonesia Abstract Human multipotent stem cells, including human pluripotent stem cells, hold promise as novel therapeutic tools for neuron treatment because of their selfrenewal capacity and ability to differentiate into neuron cells. Small and large molecules play important roles in each stage of neuron differentiation from amnion membrane and dental pulp. In these studies have been explored of human amnion membrane (hAMSCs) - and dental pulp derived mesenchymal stem cells (hDPMSCs) differentiation potential to generate neuron like cell. The method of these studies have been promoted by using several small growth factors as well as epidermal growth factor (EGF), fibroblast growth factor (FGF), PDGF, Forskolin, then has been characterized phenotype, proliferation assay, differentiation, through immunocytochemistry, flowcytometry by using CD105, CD90, Oct4, Sox2, GFAP, β-Tubuline Nestine, The results have shown significantly advanced efforts of membrane amnion and dental pulp derive mesenchymal stem cell can generated into neuron. The both resources mesenchymal stem cells contributed possibility from the initial stages of definitive ectoderm formation to the differentiated stages of maturation of neuron cells. Keywords: hAMSCs, hDPSCs, proliferation, differentiation, neuron like cell. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 466 Asea Uninet Scientific and Plenary Meeting 2016 1 | 467 INTRODUCTION Neuron disease like Parkinsons, Alzheimer’s are the most common neuron disorder with increasing incidence worldwide, predicted to increase every year. Currently, conventional therapies are not widely successful because neuron degeneration leads to several associated ailments and system disorders. In future, stem cell therapy is expected to be more powerful than existing treatments for this pervasive and debilitating disease. Naturally, much attention has been directed to the generation of neuron without tumor formation or immune rejection from human adult stem cells in the last few years. A new generation of research has recently focused on multipotent, pluripotent stem cells and induce pluripotent stem cells (iPSCs) through inserting gene such as OCT3/4, SOX2, c-MYC, and KLF-4. The approach the human iPSCs can be derived from various non-pluripotent cells, such as adipose cells, amniotic fluid cells, hepatocytes, blood cells, fibroblasts, and bone marrow cells (Takahashi,et al., 2006), although embryonic stem cell more easy to develop into different type cell, but their problems are still in ethical issue (Lo and Parham, 2009). In recent years there has been increased interest in mesenchymal stem cells and their potential utility in both tissue engineering and repair (Rantam, et al., 2015). Animal studies have provided a useful tool for defining a number of diverse potential applications for MSCs. Kamandjaja et al (2015). Demonstrated that cultured mesenchymal cells could home and repair bone jaw in New Zealand with rabbit. The ability of cultureexpanded human mesenchymal cells to contribute to the functional repair of an injured pancreas has also been examined using a variety of animal models (Rantam, et al., 2015). MSCs can repair an 8 mm defect in a rat jaw when placed into a porous cylinder which was then implanted into the bone jaw. After 6 weeks, the defect containing the MSC-loaded implant completely healed, while the defects containing cylinders filled with control cell populations failed to heal successfully (Hardijantini, et al., 2015). These studies indicate that culture-expanded MSCs are able to both persist and contribute to de novo bone formation in vivo. Studies in sheep have addressed the possibility of using mesenchymal cells to enhance engraftment of transplanted hematopoietic cells (Kamadjaja, et al., 2015), and transplantations of defected neuro femoralis New Zealand rabbit with bone marrow derived MSCs enhanced function the both rabbit back extremitas (Christijogo, 2015). Transplantation of unprocessed whole bone marrow cells has been shown to restore microenvironmental function, suggesting that unprocessed bone marrow contains stromal precursors as well as hematopoietic precursors that contribute to hematopoietic regeneration following transplantation. It has been interpret this linear correlation to imply a relationship between vascularity and local MSCs population (Kubis et al., 2006; Meirelles et al., 2006). The apparent ability of MSCs to give rise to cells of multiple germ layers, however, must be examined cautiously, as undifferentiated mesenchymal cells have been shown to spontaneously express neural markers, In these research focus of the potential MSCs differentiation ability with different resources MSCs from human amnion membrane and human dental pulp. 2 2.1 MATERIALS AND METHODS Collection and Preparation of Human Membrane Amnion Cesarean section was performed in the Central Operating Theatre of Dr. Soetomo General Hospital Surabaya on Healthy full term neonate. After the baby delivered, amnion membrane was cut out, the placenta together with the remaining amnion membrane was 468 | Asea Uninet Scientific and Plenary Meeting 2016 evacuated and placed in the sterile kidney-shape stainless steel receptacle. About 10 cm length was obtained and washed in Phosphate Buffer Saline (PBS) three times to remove the excess blood and blood clot. Next, amnion membrane was soaked in Ringer Lactate solution containing 2.5 μg/mL gentamycin and 1000 U/mL amphotericin B for 20 minutes. The medical ethical review board of Dr. Soetomo General Hospital has already approved this protocol. 2.2 Isolation and Culture of hAMMSCs Amnion membran was dissected into small pieces about 1 cm with knife into fine pieces of 1 mm3 and was used to isolate and culture primary hAMMSCs. Then was transferred to 0.25% trypsin and digested in 37˚C for 40 minutes, then centrifuged, have the supernatant removed, this processed was then repeated twice. The crushed and digested sample, then subjected to PBS containing 0.75 mg/ml collagenase IV (Sigma-Aldrich, St. Louis, MO, USA) and 0.075 mg/mL DNAse I (Takara Bio, Shiga, Japan), incubated at 37˚C for 60 minutes. This was followed by filtration with cell strainer and pellet collection upon centrifugation for 10 minutes to finally obtain the cells. The single cells collected were then cultured on collagen-coated dishes using alpha modification of minimum essential medium eagle (α-MEM) (Gibco BRL, Gaithersburg, MD, USA), supplemented with human leukemia inhibitory factor (10 ng/mL) and fetal bovine serum (FBS) (Gibco BRL). Primary cells growth was observed under the microscope. The timing of cell confluence was recorded. The medium was changed once every three days. When the confluence reached 90%, the cell splitting was done using trypsin. Half to two thirds of the cells were then re-plated onto a new dish of the same medium. The isolation procedure used was according to the Laboratory of Stem Cell, Institute of Tropical Disease, Airlangga University protocol (Rantam et al., 2015). 2.3 2.3.1 The hAMMSCs Phenotypic Characterization Immunocytochemistry Single cell of cultured hAMMSCs were plated onto coverslips. The cells were rinsed five times with PBS tween. 20, drying and fixed with formaldehyde 10% for 15 minutes, and then they washed four times with PBS tween.20 and let to dry for few minutes. The cells were blocked by bovine serum albumin (BSA) for 30 minutes, incubated with fluorescein isiothiocyanate (FITC)-labeled monoclonal antibody anti-human Cellular Differentiation (CD)105, CD90 and CD45 for 60 minutes. Cells were rinsed with PBS twice and ready for analysis. Immunostained cells with CD105, CD90 and CD45 expression were analyzed using fluorescence microscope, and other label like. 2.3.2 Flow Cytometry Cultured hAMMSCs were trypsinized and suspended in α-MEM, washed with PBS, and fixated in formaldehyde 10% for 10 minutes, and finally were closed in 10% BSA for one hour. Cells were incubated using Human MSCs Analysis Kit (BD StemflowTM, BD Biosciences) with primary antibodies mouse anti-human CD90, CD105, and negative cocktail containing CD45, for 40 minutes. The unbound antibodies, then removed by washing with PBS. The bound primary antibodies were labeled using FITC-conjugated anti-mouse antibody by incubation for 30 minutes. The cells were then visualized and analyzed using FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA. 2.4 Proliferation and Differentiation Assay Proliferation assay was analyzed by using markers labeled DAPI, and for the plasticity analysis of stem cells were used markers Oct4, Sox2. Then have been done analysis of Asea Uninet Scientific and Plenary Meeting 2016 | 469 differentiation cells using some markers GFAP, β-Tubulin and nestin, after have been added growth factors (EGF, FGF, PDGF, and Forskolin) in the medium complete. The whole methods have been done according to Rantam, et al., (2015) and differentiation assay according to Chamberlain (2007). 3 RESULTS The biological and molecular crosstalk among FGFs, EGF, PDGF, and Forskolin and others molecular like retinoic acid indicates important plays an essential role in neuron specifications. They have a significant effect on the differentiation of MSCs into neuron. The result of these research like below; 3.1 A Isolation and Culture Stem Cells B C D Fig.1. Isolation and culture of mesenchymal stem cell. A. Isolated stem cell from dental pulp, B. cultured stem cell of dental pulp 7 days, C. isolated stem cell from amniotic membrane and incubated at 37oC 2 days, D. cultured stem cell of amniotic membrane 7 days. Arrow in Fig. C and D. are colony stem cell. Base on the results in Fig.1. have been shown that the both stem cell have relative different as well as by their growing, and the both stem cell can growth monolayer 7 days after cultured in petridish. To determine of stem cells diferensiasi became mesenchymal stem cell have been done characterization by using markers CD90, CD105 and CD45. The results like in Fig.2. 470 | Asea Uninet Scientific and Plenary Meeting 2016 A B C AMSCs/CD105 AMSCs/CD90 AMSCs/CD45 D E F DPSCs/CD105 DPSCs/CD90 AMSCs/CD90 DPSCs/CD45 Fig.2. Phenotyping of stem cells using markers superficial membrane protein to determine of mesenchymal stem cell (MSCs). A&B. amnion membrane derived MSCs expressed CD105 and CD90, C. amnion membrane derived MSCs expressed CD45-. D&E. Dental pulp derived MSCs expressed CD105 and CD90, F. Dental pulp derived MSCs expressed a lack CD45 like at arrow. In these cases are actually stem cell still not purify. perhaps were caused system purify using Ficoll sometime, and the best purification of stem cell are using cell sorter. The both resources of stem cells have been derived MSCs shown that expression CD105, CD90, but negative expression of CD45. Although these MSCs have expressed too CD73, but data is not shown. To analyze of the plasticity like pluripotent stem cells have been used markers Oct4 and Sox2. A AMMSCs D1 AMSCs B C AMSCs/Sox2 AMMSCs/Oct AMSCs/Oct4AMMSCs/Sox 4 D2 4 Fig. 3. Analysis pluripotent isolated stem cell from amniotic membrane and dental pulp using markers Oct4 and Sox2. Imaging microscope (20x). Green fluorescence staining are stem cells expressed Oct4 and Sox2, but without colour are negative stem cells expressed Oct4 and Sox2. And D1 and D2 flow cytometri analysis showed expression of CD90 and there are some CD45 expressed on superficial membrane cells (hAMMSCs) derived MSCs. But hDPMSCs data not shown. In these studies showed that hAMSCs and hDPMSCs expression Oct4 and Sox2, but data of hDPMSCs not shown. Base on proliferation assay by using MTT in Fig.4 Asea Uninet Scientific and Plenary Meeting 2016 | 471 showed little distinct between hAMSCs and hDPMSCs. Staining using DAPI were documented under fluorescence microscope without nad with filter showed similar no different. 3.2 Proliferation Assay Proliferation assay in these research were monitored by using MTT, and staining using DAPI. The both stem cell between hAMMSCs and hDPMSCs have view different while their proliferation as well aas in Fig.4. showed that explored stem cell from hAMMSCs have rapid growth then from hDPMSCs. And also like in Fig 4.B1 and C1 are similar like B2 and C2 the both cell stained using DAPI. A B1 B2 C1 C2 Fig.4. Proliferation of MSCs were analyzed by using MTT, and DAPI. A. Total cell count of cultured MSCs in 5cm Petridis 7 days after cultured MSCs, B.1&2 Amniotic derived MSCs have been stained by using DAPI marker. C. 1&2. Dental pulp derived MSCs have been stained DAPI marker. 3.3 Differentiation MSCs Into Neuron Cells In these chapter has been shown that all bioactive like growth factor have an important role to induce of stem cell to begin of differentiation. Growth factors were added in medium culture of stem cell. After 7 days, medium were collected, and cells were analyzed using some kit like in Fig.5. A2, A3, B2. Neuron like cells/ β-Tubulin A1 A2 Neuron like cells A3 Neuron like cells/βTubulin, Neuron like cells/GFA P B2 B1 Neuron cells Neuron cells/Hoehst Fig.5. Differentiation analysis at 21 days after induced growth factors of amnion membrane and dental pulp derived MSCs 3rd passage. A. Isolated stem cell from Dental Pulp, B. Isolated stem cell from amnion membrane. The both hAMMSCs and hDPMSCs were grown in medium complete using α-MEM, and antibiotic 1/1000, FCS 20%. Stem cells differentiations have some stage 1 until 5 with different properties or capacity into specific cells as well as desire cell type like neuron cell type. In our 472 | Asea Uninet Scientific and Plenary Meeting 2016 studies have been used growth factor EGF, FGF, PDGF and Forskolin. Through addition of growth factors to the complete growth medium have shown that the both cell have ability to generate into neuron cells, like in Fig.5. A2, A3, B2 above. Simple strategy of stem cell differentiation as below; 4 DISCUSION AND FINDING The fifth different stages during the differentiation of neuron cells from MSC stem cells are specification, expansion, and differentiation. Small and large molecules potentially play an important role in the formation of definitive ectoderm and further differentiation into neuron. The results of our studies in stage isolation and characterization Fig. 1. and Fig. 2 & 3 have been shown that human amnion membrane and human dental pulp have high potential as stem cell resources, although the both of stem cell have view different especially in growing properties. hAMMSC more rapid then hDPMSCs. But the both cells have found not only proliferation became multipotent but followed too pluripotent markers Oct4 and Sox2 although not dominant. These finding slowly remove after three time passage. Because stem cell differentiated into progenitor cells (Steward, et al., 2014). But recently found that OCT4 repressed WNT pathway signaling during the self-renewal process (Davidson, et al., 2012) Some different receptors play important roles in the FGF, EGF, PDGF and Forskolin signaling pathway mediated by the four main tyrosine kinase receptors FGFR1, FGFR2, FGFR3, and FGFR4 especially of FGF induction (Ornitz, et al., 1996). Therefore, growth factors promotes a close developmental relationship between the neuron and other organs such as the liver. Furthermore, the effect of growth factors alone is insufficient, but the addition of optimal growth factors along with a liver inhibitor results in others differentiation of MSCs. However, although FGF, EGF, PDGF and Forskolin plays a vital role in tissue and cells formation, the function of the growth factors signaling pathway is not yet fully understood. Eighteen different growth factors influence expression of the various growth factors involved in the regulation of some cell or tissue expansion. It can caused transdifferentiation of MSCs in to many kinds of cell type (Keilhoff, et al., 2008) Asea Uninet Scientific and Plenary Meeting 2016 | 473 EGF, FGF, PDGF, and Forskolin Induction Microenvironment Self Renewal Activated molecule: cAMP, ERK, MERK, RA, and Transcription factors, etc. MSCs asymmetric cell Expansion division (ACD) SC Active endogenous SC Exogenous Stem Cell Quiescence Stem Cell Progenitors cells Transformation Probability or Specific cell type Committed progenitors cells Differentiations Fig.6.Simplify of stem cell strategy differentiation. After induced using EGF, FGF, PDGF, and Forskolin, through microenvironment were MSCs actived to internalize via some molecule like receptors followed actived endogenous stem cells, and gen transcription through promoted cAMP, ERK, MERK, RA, and active transcription factors like CREB, C-fos, C-Jun, c-myc, ELK-1 data not shown, and others. Finally stem cell differentiated into progenitors cells or transformation probability became specific cell type. Also,Transforming growth factor signaling, Fibroblast growth factor signaling, WNT signaling, bone morphogenetic protein (BMP) signaling, and retinoic acid receptor signaling. A comprehensive understanding of neuron development must distinguish extracellular signals at each stage and also recognize the fundamental molecular mechanisms of each molecule and factors that activate its respective signal to trigger MSCs to differentiate into neuron cells (Marson, et al., 2010). Base on the data in Fig.5. shown that hAMMSCs and hDPMSCs can differentiate into neuron cells. Because these cells can be typical induced to proliferate in vitro in response to some signaling like EGF, FGF, PDGF, and forskolin and also retinoic acid. This way MSCs can be induced too using mitogen, neural stem cells futher differentiate into the major cell types of the nervus system, including neurons, astrocytes and oligodendrocytes (Steward, et al., 2014). These experiment and base on the expression of GFAP, β-Tubulin, Nestin, Hoehst, suggested that adult stem cell from different resources can be developed to generate into neurons cells, The second finding is mechanism of differentiation through induced of growth factor like EGF, FGF, PDGF, and Forskolin. Activated MSCs through growth factors and some receptors depend on kinds of receptors. Induced growth factor to target MSCs like FGF, EGF, PDGF and forskolin active differentiation factors through cAMP, RA, MERK, SHH, then active transcription factor. Finally expressed product protein pathway in superficial membrane, although in these 474 | Asea Uninet Scientific and Plenary Meeting 2016 mechanism WNT/beta catenin have promoted in transcription factors (Marson , et al., 2008; Wagner, et al., 2010). 5 CONCLUSION hAMMSCs and hDPSCs derive mesenchymal stem cells (MSCs) are multipotent cells that are able to generate a wide range of cell types, including neural cells, which makes them incredibly interesting in restorative therapies in the future for patients suffering from neurological diseases. A lot of induction protocols indicate that many signaling pathways may be involved in the neural. hAMMSCs and hDPMSCs, indeed, the signalization pathways of Hedgehog, cAMP, Retinoic acid, MERK and the neurotrophins-activated pathways have been implicated into the maturation of adult hAMMSCs and hDPMCSCs into neural-like cells. After an induction process consisting in various activators, lengths and conditions of culture, treated cells adopt a neural morphology express markers (at the transcriptome level as well as at the protein level) that are usually described to characterize neurons at different developmental stages in hAMMSCs as well as in hDPFMSCs. These ways are hAMMSCs and hDPMSCs can develop and have suggested as neural restorative in the future. ACKNOWLEDGEMENT This research was supported by the Indonesian Ministry of Research, Technology and Higher Education, under the grant numbers 147/M/Kp/VI/2015. REFERENCES Biechele, T.L.; Taylor, R.J.; Moon, R.T. (20112). Wnt/β-catenin signaling promotes differentiation, not self-renewal, of human embryonic stem cells and is repressed by Oct4. Proc. Natl. Acad. Sci. USA, 109, 4485–4490. Chamberlain G, Fox J, Ashton B, Middleton J (2007). Mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Ste M Cell 25:2739-2749. Christijogo, (2014) Exploration potential stem cells from New Zealand With Rabbit and human preputium for repair defect peripheral neuron. Dissertation of Aifrlangga University. Davidson, K.C.; Adams, A.M.; Goodson, J.M.; McDonald, C.E.; Potter, J.C.; Berndt, J.D.; Hendrijantini, N.; Kresnoadi, U.; Salim, S.; Agustono, A.; Retnowati, E. ; Hamid, I.S.; Mulawardhana, I.P.; Wardhana, M.P.; Pramono, C.; Rantam, F.A. (2015). Study Biocompatibility and Osteogenic Differentiation Potential of Human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs) with Gelatin Solvent. J. Biomedical Science and Engineering, 8, 420-428 Johannesson, M.; Stahlberg, A.; Ameri, J.; Sand, F.W.; Norman, K.; Semb, H. (2009). FGF4 and retinoic acid direct differentiation of hESCs into PDX1-expressing foregut endoderm in a time- and concentration-dependent manner. PLoS One, 4, e4794. Kamadjaja, D.B.; Purwati; Rantam, F.A.; Ferdiansyah; Parmono, C. (2014). The Osteogenic Capacity of Human Amniotic Membrane Mesenchymal Stem Cell (hAMSC) and Potential for Application in Maxillofacial Bone Reconstruction in Vitro Study. J. Biomedical Science and Engineering, 7, 497-503 Asea Uninet Scientific and Plenary Meeting 2016 | 475 Kamadjaja, D.B.; Purwati; Rantam, F.A.; Ferdiansyah; Parmono, C. (2015). Healing Mechanism and Osteogenic Capacity of Bovine Mineral-Human Amniotic Mesenchymal Stem Cell and Autogenous Bone Graft in Critical Size Mandibular Defect. J. Biomedical Science and Engineering, 8: 733-746. Keilhoff G, Stang F, Goihl A, Wolf G, Fansa H. (2006). Transdifferentiated mesenchymal stem cells as alternative therapy in supporting nerve regeneration and myelination. Cell Mol Neurobiol 7–8:1233–1250. Kubis N, Tomita Y, Tran-Dinh A, Planat-Bernard V, Andre M, Karaszewski B, Waeckel L, Li, C.L.; Zhou, J.M.; Shi, G.L.; Ma, Y.; Yang, Y.; Yu, H.; Jin, S.; Wei, Z.; Chen, F.; Jin, Y.(2009). Pluripotency can be rapidly and efficiently induced in human amniotic fluid-derived cells.Hum. Mol. Genet., 18, 4340–4349. Lo, B.; Parham, L. (2009). Ethical issues in stem cell research. Endocr. Rev., 30, 204–213. Marson, A.; Foreman, R.; Chevalier, B.; Bilodeau, S.; kahn, M.; Young, R.A.; Jaenisch, R.(2008). Wnt signaling promotes reprogramming of somatic cells to pluripotency. Cell Stem Cell, 3, 132–135. Meirelles LS, Chagastelles PC, Nardi NB.( 2006). Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 119:2204–2213 Ornitz, D.M.; Xu, J.S.; Colvin, J.S.; McEwen, D.G.; MacArthur, C.A.; Coulier, F.; Gao, G. (1996).Goldfarb, M. Receptor specificity of the fibroblast growth factor family. J. Biol. Chem., 271, 15292–15297. Penicaud L, Silvestre J-S, Casteilla L, Seylaz J, Pindard E. (2006). Vascular fate of adipose tissue-derived adult stromal cells in the ischemic murine brain: A combined imaginghistological study. NeuroImage 34:1–11. Rantam A.R., Purwati, Budi Setiawan, Sony Wibisono, Ferdiansyah, Joni Wahyuhadi, Edward Mouli, Dwikora N. Utomo, Heri Suroto, Candra Bumi (2015) Induced Monocytes-Derived HSCs (CD34+) with LPS Accelerated Homing Rat Bone Marrow Mesenchymal Stem Cell (BM-MSCs, CD105) in Injured Pancreas. J. Biomedical Science and Engineering, 2015, 8, 333-344 Steward MM, Sridhar A, Meyer JS. (2013) Neural Regeneration; Current Topics in Microbiology and Immunology; New Perspectives in Regeneration. SpringerVerlag Berlin Heidelberg 2013; 367: 163-191. DOI:10.1007/82_2012_302 Takahashi, K.; Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663–676. Wagner, R.T.; Xu, X.; Yi, F.; Merrill, B.J.; Cooney, A.J. (2010). Canonical Wnt/β-catenin regulation ofliver receptor homolog-1 mediates pluripotency gene expression. Stem Cells 28, 1794–1804. YOGYAHEALTH - A COLLABORATIVE PROJECT IN YOGYAKARTA, INDONESIA, FOUNDED UNDER THE UMBRELLA OF ASEA-UNINET AND RUNNING SUCCESSFULLY FOR OVER 7 YEARS. Matthias A. Lechner and The Yogyahealth Collaborative Team UCL Cancer Institute, University College London, London, UK Medical University of Innsbruck and University of Innsbruck, Innsbruck, Austria Gadjah Mada University, Yogyakarta, Indonesia Dr. Sardjito Hospital, Yogyakarta, Indonesia Corresponding Author: Matthias A. Lechner; matthias.a.lechner@gmail.com * Please refer to www.yogyahealth.org* Abstract Background Yogyakarta Province is one of the poorest regions of Java and whole Indonesia and mortality from cancer still remains very high. Most of the patients present at very advanced stages of malignant disease and treatment at this point is often limited to palliative measures only. There is a potential to detect cancers, in particular nasopharyngeal cancer (NPC) and cervical cancer early through raised awareness, education and screening programmes. Material and Methods In 2008 a collaborative project between European institutions and three different departments at the Gadjah Mada University/Dr. Sardjito Hospital, the Department of ENT Surgery, Gynaecology and Obstetrics and Public Health, was established under the umbrella of the ASEA-Uninet cooperation in order to raise the awareness of head and neck cancer, in particular NPC, and cervical cancer and to introduce cancer screening programmes and other health promotion programmes in Yogyakarta Province, i.e. Yogyahealth. Results The Yogyahealth programme has now been running for over 7 years. Together with colleagues in Yogyakarta, we were able to run screening programmes for cervical cancer and head and neck cancer. More than 2400 individuals were screened for cancer in the course of this programme and a new screening programme for nasopharyngeal cancer is about to be introduced. Surgical equipment has been delivered to the Dr. Sardjito Hospital and District Hospitals, kindly sponsored by various companies. Awareness projects are ongoing and funding has been applied for in order to create a mobile application for NPC awareness. Conclusion In conclusion, the lack of patient awareness of cancer, the lack of screening programmes for cancer and limited resources for cancer care in remote areas of Yogyakarta Province are the cause for the high mortality of cancers in this Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 476 Asea Uninet Scientific and Plenary Meeting 2016 | 477 region. Taking into account the efforts of the collaborative programme Yogyahealth and the above results, this programme has continuously promoted health care in Yogyakarta Province. However, far more work still needs to be done over the coming years in order to ensure that this programme will continue to have a significant impact in this region and to further extend it. Keywords: Yogyakarta, public health, cancer, nasopharyngeal cancer, cervical cancer, screening 1 INTRODUCTION Yogyakarta Province is one of the poorest regions of Java and whole Indonesia and maternal mortality and mortality from cancer still remains very high. Most of the patients present at very advanced stages of malignant disease and treatment at this point is often limited to palliative measures only. There is a potential to detect cancers, in particular cervical cancer and nasopharyngeal cancer (NPC) early through raised awareness, education and screening programmes. This led to the development of the following Initiative, i.e. Yogyahealth. 1.1 The development of the programme Yogyahealth is a collaborative global health programme which was founded in 2008 by Matt Lechner, MD PhD, under Prof. Bernd Rode’s, Prof. Erich Schmutzhard’s and Prof. Walter Kofler’s (University of Innsbruck, Austria) guidance together with research teams at the Department of Head and Neck Surgery, Gynaecology and Obstetrics and Public Health at the University Gadjah Mada and Dr. Sardjito Hospital where Mr. Lechner trained on a fully recognised clinical training position in 2008. 1.2 Yogyakarta Women's Health Initiative As described above, Yogyakarta Province (Central Java) is one of the poorest regions of whole Indonesia and both maternal mortality (National statistics 2007: 320 deaths per 100,000 maternities) and mortality from gynaecological cancer still remain very high. Most of the patients present at very advanced stages of malignant disease and treatment at this point is often limited to palliative measures only. There is a potential to detect breast cancer at an earlier stage through health education, and cervical cancer through raised awareness, education and screening programmes. Due to a lack of patient awareness and limited antenatal care in remote areas high-risk pregnancies are often detected too late and further follow-up and management cannot be guided appropriately. Yogyakarta Head and Neck Cancer Prevention and Early Detection Programme: Fighting head and neck cancer, in particular Nasopharyngeal cancer, in Indonesia In Southern and Eastern Asia nasopharyngeal cancer (NPC) is a major health problem. In Indonesia NPC it is the most frequent cancer of the head and neck area and ranks as the 4th most common tumour found in males. The incidence is estimated 6 per 100.000, leading to 15.000 new cases per year. This, however, might be an underestimation due to insufficient cancer registries and undiagnosed patients. Especially in rural areas of Indonesia patients with nasopharyngeal carcinoma (NPC) are often diagnosed at an advanced stage due to limited health care facilities. Most remote areas have fewer than one primary health care centre per 100,000 and some areas do not even one hospital per million, or less than two hospital beds per 10,000(3). Gold standard for diagnosis of NPC is biopsy. However, simple diagnostic test are often not available in district hospitals. When certain facilities are not available patients are 478 | Asea Uninet Scientific and Plenary Meeting 2016 referred to an academic hospital. Patients have to travel long distances and often lack financial means to do so. In many cases patients choose to return home without being diagnosed. By the time the patient arrives at the hospital with more severe complaints, the tumour has progressed to a more advanced stage and possible already spread to other organs. Treatment is often not curative at that stage anymore. Studies conducted in Yogyakarta revealed that 11% of the patients already had distance metastasis at diagnosis. In 90% of cases, advanced stage of disease was seen at diagnosis (according to AJCC staging 2002) (4). The programme also supports a smoking cessation programme in Yogyakarta, Indonesia, led by Dr. Prabandari. 1.3 Improving tracheostomy care in Yogyakarta The formation of a tracheostomy can be a lifesaving operation however it is not without complications. Many of the causes of significant patient morbidity and mortality centre on the subsequent ward management of the tracheostomy. Though some of these complications are unavoidable a large component can be prevented through relatively simple measures. There has been a large drive for standardised tracheostomy care, namely through the protocol known as the St. Mary’s tracheostomy care bundle and the work of the Global Tracheostomy Collaborative (GTC), and outcomes are improving. A number of studies have been published demonstrating the positive effect of introducing ‘Best Practice Guidelines’. In 2008, Hettige et al. introduced the St Mary’s Tracheostomy Care Bundle and audited its effect prospectively, showing a significant reduction in severe clinical incidents from 27% to 10% annually. The same group in a preliminary and a further 38 month prospective cohort study assessed the effect of implementing the St. Mary’s tracheostomy checklist, a dedicated tracheostomy MDT and an educational programme. With these interventions the authors show an expedited decannulation process and a reduction in clinical incidents. As such, we expect to show significant improvements in tracheostomy care and in particular significant reduction in clinical incidents with this quality improvement project. 2 METHODS In 2008 a collaborative project between European institutions and three different departments at the Gadjah Mada University/Dr. Sardjito Hospital, the Department of ENT Surgery, Gynaecology and Obstetrics and Public Health, was established under the umbrella of the ASEA-Uninet cooperation in order to raise the awareness of head and neck cancer, in particular NPC, and cervical cancer and to introduce cancer screening programmes and other health promotion programmes in Yogyakarta Province, i.e. Yogyahealth. The three project arms, the Yogyakarta Head and Neck Cancer Prevention and Early Detection Programme (www.yogyaent.org), a project focusing on the prevention and early detection of head and neck cancer, in particular nasopharyngeal cancer (in close collaboration with Prof. Bing Tan and Dr. S.R. Indrasari), the Yogyakarta Public Health Promotion Link (www.yogyahealth.org/publichealth) which runs in close collaboration with Dr. Yayi Suryo Prabandari, ‘Principal Investigator of Quit Tobacco Indonesia’ (http://quittobaccointernational.org/team-indonesia.html), focusing on tobacco prevention, and the Yogyakarta Women’s Health Initiative (www.yogyahealth.org/womenshealth), which focuses on the promotion of women’s health and the prevention and early detection of cervical cancer, were subject to evaluation. Asea Uninet Scientific and Plenary Meeting 2016 | 479 The results of this evaluation are presented in the following section. For the Yogyakarta Women's Health Initiative, the number of patients screened for cancer was compared with the number of patients referred to a tertiary centre, i.e. the Dr. Sardjito Hospital. Patients were screened at multiple locations in Yogyakarta Province, including Sidoarum, Pogung Lor, Margoluwih, Klepu, Pugeran, Sariharjo, SMPN 1 Magelang, Canden, Seyegan, Puskesmas Kraton, Puskesmas Umbulharjo, Maguwoharjo, Jomegatan, Bantul, Berbah Sleman, Sangrahan, Purwomartani, RS Happyland, Sidaurum, Sambilegi, Klinik Nugraha, Sosrowija, Bagsal Kepatihan, Usada Jl. Timoho, Purworejo District, Prambanan, PWI Yogyakarta, Sentolo, Lempuyangan, Sleman District, and Berbah Village. For the Yogyakarta Head and Neck Cancer Prevention and Early Detection Programme, in particular for the project, aiming to decentralise biopsies in order to increase the rate of early detection of nasopharyngeal cancer, patients were offered to have a biopsy at their own district hospital in the district Wonosari, Province of Yogyakarta. The sample was sent and processed at the university hospital dr. Sardjito. Outcome of the biopsy was directly communicated back to the Ear, Nose and Throat specialist at the district hospital. In this way the patients did not have to travel and all costs were covered by International funding from the dutch cancer society and Asea Uninet Austria. The aim of this study was to determine whether decentralization of the biopsy will lead to more histologically proven NPC of patients who initially refused referral to the academic hospital. For the tracheostomy care project, we are currently performing a quality improvement project in line with the GTC goal to “disseminate best practices and improve tracheostomy outcomes”. This is a preliminary evaluation, leading in future to larger, prospective studies and strong international links. The two main objectives are set to be achieved: (1) To formally introduce and implement the St Mary’s tracheostomy care bundle including emergency airway equipment and the tracheostomy daily care chart. (2) Reaudit: To repeat step one after introduction of the care bundle. 3 FINDINGS AND DISCUSSION The Yogyahealth programme has now been running for over 7 years. Together with colleagues in Yogyakarta, we were able to run screening programmes for cervical cancer in rural areas. More than 2400 individuals were screened for cancer in the course of this programme. Of the 2445 patients for who data are available, 105 patients were referred to a tertiary centre, i.e. Dr. Sardjito Hospital, for further investigation. Along with screening sessions, on the 4th September 2014 at Bagsal Kepatihan, Yogyakarta, we hosted a seminar on Preventive Promotive National Movement for Early Detection of Cervical Cancer, in collaboration with the Department of Obgyn, Indonesian Cancer Foundation and BPJS, which attracted 400 participants. Further Health Education Programmes were run by multidisciplinary teams in remote areas with the aim to increase patient awareness of cervical, ovarian and breast cancer as well as sexually transmitted diseases in the area of Yogyakarta Special Province, helping women to recognize early symptoms of disease and where to seek appropriate help. Standardized Patient Information Leaflets in Bahasa Indonesia (national language) available to everyone and provided to patients attending regional hospitals or peripheral primary care centres in Yogyakarta Special Province have been created and can be downloaded on the programme's website. As multidisciplinary teams from tertiary referral 480 | Asea Uninet Scientific and Plenary Meeting 2016 centres such as the Dr. Sardjito Hospital frequently go to peripheral hospitals those leaflets are printed off beforehand and then given to the patients attending those clinics. Moreover, a Training Homepage for residents at the Department of Obstetrics and Gynaecology (Dr. Sardjito Hospital, Yogyakarta, Indonesia) has been created. For the Yogyakarta Head and Neck Cancer Prevention and Early Detection Programme, in particular for the project, aiming to decentralise biopsies in order to increase the number of early identifications of nasopharyngeal cancer, our preliminary results show us that 33% of the suspects for NPC (7 out of 21) were actually diagnosed with NPC. All those patients were referred to the Dr. Sardjito Hospital for further diagnosis and treatment. All patients had advanced stage of disease or were unable to travel. These preliminary results tell us that many patients who refused to be referred, often have mild symptoms that do not hinder patients in their daily practice, but have already developed advanced stage NPC. This emphasizes the importance of the possibility to diagnose patients in their own district hospital preferably at an earlier stage. In addition the preliminarty results of this study stresses the need of an effective collaboration between the district hospital, the associated academic hospital/tertiary referral centre, the doctors in the primary health care centres and the community they serve. Surgical equipment has been delivered to the Dr. Sardjito Hospital and District Hospitals, kindly sponsored by various companies. Awareness projects are ongoing and funding has been applied for in order to create a mobile application for NPC awareness. For the tracheostomy care project, we are currently bringing this deliverable care bundle to the Dr. Sardjito Hospital, Yogyakarta. We have completed cycle one of the audit of current clinical practice which showed that during a 3 month retrospective review of patient notes no one case was adherent to the guidelines proposed by the St. Mary’s group. In particular there was a lack of documentation. A personalised care plan is introduced for each patient and we are in the process of obtaining the much needed emergency bedside equipment. The following equipment was identified to be required for each bedside pack: Spare tracheostomy tubes (same size and one size smaller), Disposable tracheal dilators, Re-breathe bag with swivel connector, Ambu bag and facemask, Oxygen tubing and mask, Suction unit – This must be checked each shift, Suction catheters, 10 ml syringe, Stitch cutter/scissors, Gauze, and KJ jelly. We are also setting up a screening programme for NPC using trans-oral brush biopsies and quantitative PCR for EBV DNA detection. An application to the local ethical review board has been compiled and will be submitted before the meeting. 4 CONCLUSION AND SUGGESTIONS In conclusion, the lack of patient awareness of cancer, the lack of screening programmes for cancer and limited resources for cancer care in remote areas of Yogyakarta Province are the cause for the high mortality of cancers in this region. Taking into account the efforts of the collaborative programme Yogyahealth and the above results, this programme has continuously promoted health care in Yogyakarta Province. However, far more work still needs to be done over the coming years in order to ensure that this programme will continue to have a significant impact in this region and to further extend it. Asea Uninet Scientific and Plenary Meeting 2016 | 481 REFERENCES Adham, M., et al. (2012). Nasopharyngeal carcinoma in Indonesia: epidemiology, incidence, signs, and symptoms at presentation. Chin J Cancer. 31(4):185-96. Arora, A. (2008). Driving standards in tracheostomy care: A preliminary communication of the St Mary’s ENT-led multi disciplinary team approach. Clinical Otolaryngology. 33:596–599 Cetto, R. (2011). Improving tracheostomy care: a prospective study of the multidisciplinary approach. Clinical Otolaryngology. 36(5) 482-8 Das P., et al. (2012). Tracheotomy-Related Catastrophic Events: Results of a National Survey. Laryngoscope. 122(1): 30-37 Halum, S.L., et al. (2012). A multi-institutional analysis of tracheotomy complications. Laryngoscope. 122(1):38-45 Hettige, R. (2008). Improving tracheostomy management through design, implementation and prospective audit of a care bundle: how we do it. Clinical Otolaryngology. 33(5):488-91 Rokx, C., et al. (2010). New Insights into the Provision of Health Services in Indonesia: A Health Workforce Study (ISBN: 9780821382981). 1–160. Wildeman, M.A. (2013). Primary treatment results of Nasopharyngeal Carcinoma (NPC) in Yogyakarta, Indonesia. PLoS ONE, 8(5):e63706. World Cancer report 2008 (2008); 1–267. ECONOMIC AND SOCIAL SCIENCES Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 482 THINK GLOBALLY AND ACT LOCALLY (THE ALTERNATIF TO ENHANCE LOCAL BUSINESS PERFORMANCE,TOWARDS A GLOBAL BUSINESS) Prihatin Lumbanraja Titinlumbanraja@yahoo.com Faculty of Economics and Business, University of Sumatera Utara Abstract This paper analysis how entrepreneurs of the local business can improve their performance, by entering the global market that spread all over the world. The strategy that can be chosen by local business to operate their business activities in the global market is multinational or multi domestic strategy. Multinational strategy is the business strategy that tried to open their business activities more widely through screening the global market. After they found the suitable foreign markets, the entrepreneurs tried to match the customer need or tastes in the foreign market with their product or service. Occasionally adaptations are necessary to meet local legal requirement, such as packaging, color, size, and taste, a change in the brand name, product design or a new positioning if the product is consumed differently. The marketing of service is similar to the marketing of product, service even find it easier to be marketed globally from the physical product. Keywords : Act Locally, Global Market, Local Business, Think Globally Type of Paper : Conceptual Paper 1 INTRODUCTION Development is primarily a series of deliberate steps taken consciously by a nation (community) or the government to change from an unfavorable situation into a better state. At the bottom of the expected change is a change towards the better, such as: increased income, employment opening, availability of food, clothing and shelter are adequate, and so on. One of the keys to success in development is the development of the field of entrepreneurship. Entrepreneurship has been a major driver for both the domestic and global economy. It’s recognized that economic growth and prosperity of a country lies in the hands of entrepreneurs. In general, the entrepreneur started his business by building and operating a business that might still be a small or medium. Small and Medium Enterprises (SMEs) are the lifeblood of the economy of the people. SMEs spread across the region, villages and towns, and includes almost all types of existing business field. Toughness SMEs as one of the pillars to sustain the nation's economy has been proven, because the sector is able to survive and compete in the midst of the economic crisis. Advantages small and medium enterprises, it has been proven through a post-riot in May 1998, they were able to survive until now as the savior of the national economy. While other business fields just lay down and in ruins. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 483 484 | Asea Uninet Scientific and Plenary Meeting 2016 A small and medium enterprise is a kind of business that absorbs a lot of manpower and has the durability and flexibility in the face of the economic dynamics of a country life. The development of small business continues to increase. By sector, about 60% of small businesses are micro-enterprises engaged in agriculture, livestock, forestry and fisheries, and about 23% engaged in trade, hotels and restaurants and about 7% are engaged in the manufacturing and communications, and the rest spread in the mining and quarrying sector, financial services, construction, electricity, gas and water supply. Given the important role small business sector, particularly in the employment and welfare of society, it is only logical sector to be developed more attention so it really could be the main support of the national economy. Even in the era of globalization, small-medium enterprise sector has great potential to develop into a competitive business and able to integrate with the modern economy. Many examples of SMEs that have proved their excellence and be able to be a source of livelihood of the people, which in turn would likely strengthen the national economy. Local SME products continue guerrilla explore the potential of overseas markets. This is done to block invasion of Chinese products after China-Asean Free Trade Agreement (CAFTA) (Lumbanraja, 2011). Although many ways to penetrate the global market, but in general there is a basic formulation by a group called the "think globally and act locally". This implies that every SME should strive to seek market opportunities around the world, and then they try to meet the needs and wants of the market through various adjustments in the products and / or services they offer with the main characteristics of consumer preferences in the market concerned. This method gives a more rational and more effective, especially for Small and Medium Enterprises, as compared to when they use the approach to create products that are universal world. 2 2.1 THEORETICAL REVIEW Think Globally Act Locally The fact that most people do not want the value of the product in the same state it’s to be very important when a product is sold internationally. This is known as act locally (adaptation strategies). Transactions between national merchants making it are important to recognize the difference between domestic marketing and international marketing. In order to do international marketing, the marketer has to deal with some environmental factors compared to the domestic market as well as the need to confront other conflicts caused by cultural differences, legal and social issues. (czinkota & Ronkainen, 1995). Various expert support of adaptation strategies, which is based on the philosophy that is inherent between complexity and inequality which includes operations in the market place internationally particularly by taking into account the strength of the macro environment, consumer behavior, usage patterns in situations more competition provides an ability to have a marketing program arranged on the individual needs of each part of the market, ( Leonidou, 1996). On the other hand, the philosophy of adaptation offering customer orientation since adaptation is systematically evaluate the behavior of buyers and market characteristics in each occurrence of a foreign state. It results in maximization of profit as income derived from marketing mix can rise more than the cost of adaptation. Adaptation also moving the creativity of thinking and innovation within the company in order to achieve a way to customize marketing in finding specific purpose of customer demand.(Czinkota and Ronkainen,1995;Leonidou,1996). Asea Uninet Scientific and Plenary Meeting 2016 | 485 Factors that affect product adaptation according Leonidou (1999): Otterheim and Anderson, (2003) are as follows: 1) 2) 3) 4) 5) Physical factors (Bennett, 1998), which includes: (1) The natural conditions, (2) climate, (3) The size of the territory, (4) Items of local products are mutually compatible Demographic factors, which include: (1) size / growth of the population, (2) housing size, (3) The structure of the population. Socio-cultural factors: (1) Language, (2) The taste and habits, (3) Education (4) Literacy, (5) aesthetic, (6) Values and behavior, (7) Religion. Economic factors which include: (1) Disposable income, (2) infrastructure facilities, (3) economic situation, (4) The export markets, (5) intensity of competition in the export market. Political and legal factors include: (1) The technical standards, (2) Forecasting unit, (3) Restriction of law, (4) government control, (5) Tax Policy According to The Global Chaser Model, there are two parameters base on the level of ability of companies to develop a chain of global activity (global activity-chain) and the degree of the company's ability to adapt products and services to follow the conditions and characteristics of the market in the destination country (global customization), then a SME can choose four strategic position desired. Fourth selection strategies are: 1) 2) 3) Chase Global Best-Practices, teaching ability in the world (global bestpractices) to build competence in the field of research and product development, production, and marketing of world-class in the domestic market should go beyond national best-practice or not quite satisfied just to be a local player. Thus they must be intense benchmarking to global companies that operate in the country and then working hard to achieve it (catching-up). Join Global Value-Chain, working as part of the value-chain of other global companies, because it is a strategy that should he developed was merge into the value-chain to produce the entire business process is the most efficient and effective in the world. Go Global, relying on their competitiveness on the global image formation and the gains of global utilizing their operations in various countries. Go Local, plenary achievement of global marketing strategy is if the company is able to do act locally, which has become a local in the countries of destination. Companies that have been able to localize (localize) products and services to fit the specific conditions in the destination market. Through market research activities, product development, production, distribution / marketing to after-sales service in the host country, these companies are trying to understand the market characteristics of the country of destination, and then adapt their products and services to fit with the local conditions. 2.2 2.2.1 How to Enter the Global Market Export Activity There are many ways to enter the global business. The easiest way is through exports. Businesses sell their regular production abroad. This method requires relatively little 486 | Asea Uninet Scientific and Plenary Meeting 2016 investment risk and risk-free. It’s the best way to do business internationally, without engaging a human resources or finance in bulk Common assumption states that local companies are generally small and medium enterprises, because they lack the financial and human resources, supplying overseas markets by exporting them from the produce directly to the intended market. Many local businesses and managed to take this way. The role of government in exporting very large and decisive, particularly through policies that favor local businesses (SMEs), such as: delay tax payments for business beginners, providing tax breaks for export commodities and commodity-strategic mainstay. However, import-export activities have a number of limitations, including: businesses can not afford the whole control their markets, meaning that the business only meets the market demand when they received an order or orders. Further, they are also not able to observe the behavior of their competitors in the market. There are two ways to export, namely: Indirect Exporting: Exporting goods or services through various types of exporters based in the country. Business people just follow the instructions. While the second way is to export directly, the export of goods and services performed by the businesses that produce them. 2.2.2 Producing Direct Overseas When management decides to get involved in the manufacturing process overseas, in order to rule the overseas market more intensively, then in general there are five different alternatives available, although not all of them worthy in certain countries, these alternatives are: (1) owned subsidiary as a whole, (2) Joint Venture, (3) the License Agreement, (4) Franchise and (5) Contract Manufacturing (Ball et al., 2004). 1) Owned subsidiaries as a whole Companies that want to have subsidiaries abroad can Start over (from scratch) to build a new plant, or taking over a company that is running. Besides, the business person can buy the distributor, which means they can get familiar with the distribution network of products. In this case the production facilities to be built. It would require a very high investment costs. 2) Joint venture Sometimes it is not possible to have foreign subsidiaries as a whole. The government of the host might not allow it, or the company may lack both the capital and experience to carry out its own investment, or no tax breaks and other benefits if it established a joint venture, then the alternative is to establish a joint venture, the joint venture between two or more organizations who share a common interest in a business or business activity. Joint venture can be: a) Entity formed by the owners of the international companies with local b) Business entity formed by two international companies for the purpose of doing business in third markets. c) Business entity formed by the government (usually the country in which the investment is done) with an international company Asea Uninet Scientific and Plenary Meeting 2016 | 487 d) Cooperation between two or more firms in a limited duration projects. Major construction work, such as: the creation of Dam or airport, often handled through this form. In some situations, however, businesses will be looking for local partners, although there is no requirement of the local government for that matter. This is done to instill a strong sense of nationalism, tax benefits, and expertise and so on. In addition to the benefits, there are some disadvantages, such as: Advantage should be divided and the difficulty of obtaining the right of supervision. 3) License Agreement Contractual arrangement, whereby a company provides access to patents, trade secrets or technology, to other companies to get paid (royalty) rate of 2-5 % of sales during the contract period (5-7 years and can be extended). Currently licensing is the main source of income of international businesses, because: (1) the Court began to justify claims patent infringement over their use so far. (2) The holder of a patent to be more vigilant in prosecuting violators. 4) Franchising Franchise is a form of license in which a company to contract with another company, to operate certain types of businesses under the name formed according to certain rules. Allow recipients agreement to sell products or services using the brand that has been widely published and a set of procedures that have been proven to be good, with a marketing strategy that has been carefully cultivated and controlled. 5) Contract Manufacturing Forms of agreement that the company entered into a contract with another company, to manufacture products according to specifications, but accept the responsibility of marketing. The international business uses contract manufacturers in two ways: a) Contracting with local factories to produce products that comply with their specifications. b) Giving the sub-contract assembly work or production of parts to independent firms abroad. For local businesses who want to enter the global market, then there are various ways that can be selected and considered before, according to their ability and certainly barriers to entry into the target market. Many global companies and large multi domestic with a number of branches around the world started its business by way of export. Once they succeeded in this way, they then set up sales representatives to market overseas exports. Once this stage is successful and able to develop a large enough market, the company will continue to develop its business by setting up factories to assemble imported parts, and finally the finished products produced locally. Concept to seek markets throughout the world for local businesses (SMBs) has long embraced and applied by the majority of local businesses. The increasing of global 488 | Asea Uninet Scientific and Plenary Meeting 2016 competition causing local businesses encourage management to open up new markets, either by taking market share of their competitors and look for markets where the level of competition and the number of competitors is low. In his International Business book, Czinkota (1992) suggests that there are four stages in the process to filter and analyze foreign markets. The process for selecting target markets is done by narrowing the potential markets of several countries and market segments that exist in these countries. Businesses use their best resources to: (1) identify potential markets to enter and (2) then expand the selection process at any time to choose the most interesting. Overall target market selection process is presented in the following scheme Asea Uninet Scientific and Plenary Meeting 2016 ALL COUNTRIES PRELIMINARY SELECTION | 489 Secondary Data Rejected Country The Common Factor Special factors of common Prospects of the products Target State Estimated Potential Market Rejected Country By Product Type National Market Size Countries with A High National Market Potential Market Potential other target market Estimated Sales Potential for Company Product Product Comparison Rejected Country Competition Market Structure Distribution structure Countries with the High End Consumers Potential Sales Identification of Segment Market On The Target Market Rejected Country Primary Data Optimal Market Segment On target market Source : Czinkota (1992) 490 | Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 DISCUSSION Multi-National Corporations as a Means in Making Local Approach A local business was initially a small or medium business to the next development could begin to enter the global market with a variety of ways. One way that can be taken by local businesses to establish their business operations overseas is to use the strategy of multinational or multi domestic. According to Ball et al., 2004, that the business is doing multinational strategy, a business that is expanding its operations by seeking markets abroad, and after finding a suitable overseas markets, the business seeks to tailor products and / or services them to the needs and desires or even consumer tastes that exist in the market. Why enter foreign markets?. Many reasons why local business (domestic) entering foreign markets, among others: (1) Increase Profits and Sales, (2) Acquire greater profits, (3) Protecting the domestic market, (4) Attack competitors in the domestic market and (5) Protecting overseas markets. Apart from the various objectives into overseas markets, multinational strategy has been widely adopted by small, medium or large companies. Many of these businesses have realized that they were in the beginning has experienced some failures. The failure is because they face pressures greater in many foreign markets than in their own country (Home Country). A philosophy that they are experiencing were wrong, the business wants to implement policies and procedures in the foreign market that has just been successfully applied in their home countries. As a result, they experience failures that caused them to change their business strategies to the local strategy, or at least regional strategy. Local strategy or at least regional strategy requires businesses to change their products to suit a variety of markets, regional or even local markets. Many examples of products that have been tailored to the needs of the local or regional markets, For example: Camay Aroma, flavor formula Crest and Head & Shoulders, is an example of the product varies from one area to another (P & G, annual report, 2002). Another example is that many of us have encountered a variety of fast food from America, it must have been reaping huge profits through adaptations in their local markets, such as: add rice as the main menu in the Indonesian market, adding beer when it enters the market in Germany, the Mars company had to change its menu to candy nut candy, while M & Ms Mars launched into the market in Bahrain (Bahrain because people think of peanuts as a healthy diet). There are many other strategies undertaken by multinational businesses, to enable them to enter and dominate their markets overseas. In introducing new products, especially when the goal is rapid market penetration, then the business must realize that "in general, when they noticed the economic strata and social strata in each country, they tend to find greater inequality among countries in terms of cultural values and social (Ball, et al., 2004). In general, the deeper and faster market penetration desired by the business, the greater the modification of products that have to be done. It is not always a physical product that must be changed as a whole. Modifications can be done in a way, changing the characteristics of the product concerned, such as packaging, color, taste, size of product, brand name changes, product design or placement (positioning) of the product, if the product is consumed differently. In addition to product manufacturing, the services can also be marketed globally even services are easier to market than physical products. Many examples of service companies that have successfully marketed their services by following the strategy of multinational or multi domestic, such as Anderson Consulting (Accenture), which has 75,000 professionals in 44 countries offering a range of business skills (Company Overview, 2002), Ernst & Young, has nearly 84,000 professionals around the world (About Asea Uninet Scientific and Plenary Meeting 2016 | 491 Ernst & Young, 2002). Currently the credit card industries were dominated by VISA (55%), Master Card (33%) and American Express (8%). 4 CONCLUSION Now it's the time for small and medium enterprises (SMEs), as a local industry figure begin expanding its business by entering foreign markets (global market). Multinational approach is one alternative that can be applied in an effort to penetrate the market quickly in a variety of areas, where there is a potential market to be addressed. Multinational approach, hinted to the business to make various adjustments to the products and / or services they have for a variety of needs and desires and tastes of the market. In a broad sense, the local business people should be able to find and select markets around the world. Then it becomes a necessity for business people to perform various adjustments which is becoming the dominant element in order to meet the needs and wants of their customers in foreign markets, if they want to succeed. Various adjustments can be: packaging, color, taste, size of product, brand name changes, product design or placement (positioning) of the product, if the product is consumed differently. REFERENCES Ball, Donald A., et al., 2004, International Business, The Challenge of Global Competton, International Edition, Ninth Edition, McGraw-Hill Companies, Inc, New York. Czinkota, Michael R., Rivoli Pietra and Ronkainen IIkka A, 1992. International Business, International Edition, Second Edition, The Dryden Press. Lumbanraja, Prihatin, 2011. Bersama UKM Membangun Ekonomi Rakyat dan Lingkungan Hidup, Jurnal Ekonom, Fakultas Ekonomi USU. www.pg.com/main.jhtml (23September 2002),PreparingtoWininthe21-st Century, “Procter & Gamble Annual Report. http://www.accenture.com/xd/xd.asp?it=enWeb&xd=aboutus\company\co_company.xml September 2002). http://www.ey.com/global/content.nsf/International/About_EY(20September2002). www.visa.com,www.mastercard.com,danamericanexpress.com. THE CAPACITY TO COPE WITH CLIMATE CHANGE OF COASTAL AGRICULTURE HOUSEHOLDS: A CASE STUDY IN THE RED RIVER DELTA, VIETNAM Nguyen Dang Khoa khoand14688@gmail.com* Faculty of Statistics, National Economics University, Vietnam Nguyen Huyen Trang nguyentrang512@gmail.com Faculty of Statistics, National Economics University, Vietnam Abstract Livelihood communities in coastal areas tend to be strongly impacted by climate change (CC). One of the essential duties in national CC adaption strategies is improving households’ adaptation capacity to CC. This plays an important role in mitigating vulnerability, improving resilience, and achieving sustainable income in the long term. From the survey data of 300 agricultural households whose main livelihoods are agriculture (rice cultivation, livestock breeding, salt production, fishing and aquaculture) in three provinces of the Red River Delta in Vietnam, this paper investigates adaptation capacity of coastal agricultural households on some aspect in the context of CC now. Findings suggest that: (i) the capacity to adapt to CC of the coastal agricultural households remains limited, that can not facilitate to households achieve sustainable livelihood outcomes in the context of CC in the future; (ii) households have not been really proactive in responding to the impacts of CC but most of them are still passive; (iii) the research also indicates that adaptive production model and infrastructure planning are important factors impacting households’adaptability to CC (clearly shown through the response outcome of households). These findings also recommend that it is necessary for governments to support households to improve their livelihood, especially access to financial resources, technology and appropriate production models. Keywords: Adaptation, climate change, coastal area, livelihood, agricultural household. 1 INTRODUCTION According to scientists, Climate Change (CC) recently becomes complicated and increasing negative impact to human’s life and production activities. About 58% of Viet Nam’s coastal livelihoods are based on agricultural, fishing and aquaculture that are mostly depend on climate and water resource. Most disaster damage to production and life in Viet Nam are linked to climate and water change (Chaudhry and Ruysschaert, 2007). With the impacts of CC, to actively prevent, mitigate risks and damage, also take advantage of the opportunities for economic and social development, improving adaptability CC for Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 492 Asea Uninet Scientific and Plenary Meeting 2016 | 493 household is identified as the most important solution to cope and is the top priority in policy response to CC in Viet Nam. The enhancement of adaptive capacity for households is the solution to create favorable conditions for households archive better livelihoods and sustainable from impacts and shocks caused by CC. Drawing on Chamber and Conway (1992), Scoone (1998, p5) showed that a livelihood is sustainable when it can cope with and recover from stress and shocks, maintain or enhance its capabilities and assets, and provide sustainable livelihood opportunities for the next generation; and which contributes net benefits to other livelihoods at the local and global levels and in the short and long term. In 2001, the UK department for International Development (DFID) launched a concept of livelihood as a guidance for their own assistance activities in which a livelihood “comprise the capabilities, assets and activities required for a means of living”. This concept is basically similar to the concept of livelihood developed by Chamber and Conway (1992) and Scoone (1998). Adaptive capacity can be studied from different perspectives, including natural science, social science, and environment and resource studies. Adaptive capacity is nowadays often considered in the context of environmental changes and linked to environmental governance. In this domain, adaptive capacity is generally referred to as the capability of a social-ecological system to be robust to disturbance and to adapt to actual or anticipated changes (whether exogenous or endogenous) (Armitage, D. and Plummer, R, 2010, p6). More recently, adaptive capacity is looked at in the context of global CC. The capacity to adapt to CC is defined in many different ways. IPCC defined adaptive capacity as the ability of a system to adjust to CC (including climate variability and extremes) to moderate potential damages, to take advantage of opportunities, or to cope with the consequences (IPCC, 2007, P869). According to MONRE, adaptive capacity is the adjustment of the natural or human system to the changing condition or environment, to take advantage of the opportunities of, or reduce vulnerabilities from actual or potential variation and change in the climate (MONRE, 2008, P6). USAID said that “adaptive capacity refers to the ability of society to plan for and respond to change in a way that makes it better equipped to manage its exposure and sensitivity to climate” (USAID, 2009, P36) The ability to undertake adaptations can be influenced by such factors as management ability, access to financial, technological and information resources, infrastructure, the institutional environment within which adaptation occurs, political influence, kinship network, etc. (Smit and Wandel, 2006, p.287 – 288). Capacity building for households on CC adaptation is considered to be central to CC adaptation policies. However, in addition to efforts made by households themselves, external support in the form of flood control, infrastructure development in access to credit and markets also plays an important role in enhancing the capacity to adapt to CC impacts. (IUNC, 2003). The objective of this study is to general evaluating status of CC adaption capacity of coastal agriculture households on several aspects with the concrete evidence from the case study of three coastal provinces of Red River Delta in Viet Nam where 35% GDP comes from agriculture, and 2/3 of population are relate to agricultural works. Also, study the impact of some factors about resilience of household to CC. This research is to help the policy makers and local governor to understand fully the difficulties, challenges to farmers in agricultural production in CC. The overview of households’ ability to adapt the CC is one of the important factors to suggest solutions for improving CC adaption of famers, and reduce losses and damage. 494 | Asea Uninet Scientific and Plenary Meeting 2016 2 DATA AND METHODOLOGY 2.1 Data collection Data in this study is collected from CC adaptive capacity survey of coastal agricultural households at Red River Delta on 2015. Information collecting method: interviews with questionnaires (Anket) Random sampling method stratified (multi level) specifically: + Sampling unit level 1: 3 representative coastal provinces at Red River Delta selected are: Hai Phong, Thai Binh, Nam Dinh. + Sampling unit level 2: in each provinces, selected 2 districts representative (6 districts were selected) + Sampling unit level 3: in each district, selected 2 communes representative (12 communes were selected) + From each commune, researchers selected random 30 agricultural households to interview with the questionnaire. These households were selected corresponding to the proportion of the group’s economic situation (poor, below average, average, and middling) of the region. Qualified surveys after process are 300. 2.2 Statistical method  Statistic descriptive method is used to disaggregate research according to attributes classify, calculate the parameters reflect the distribution of measurable variables and indicators reflect the adaption capacity to CC of households. Using Binary Logistics to explore the impact of some factors that determine adaption capacity to CC to disaster response results of coastal agriculture households.  3 FINDINGS AND DISCUSSION 3.1 3.1.1 Status of capacity to cope with climate change of Red River Delta coastal agricultural households Livelihoods of coastal farming households through survey data While the social resources are slowly improve, capacity to adapt to CC of households is an important factor to ensure them can achieve the goal to sustainable livelihoods. Many previous studies of CC to agricultural production activities have shown: the livelihood conditions of coastal agricultural communities have significant impact to disaster prevention ability of agricultural households (Tran Tho Dat el al, 2014). The survey results of coastal agricultural households of Red River Delta have shown: Currently coastal agricultural communities mainly have average economic conditions and below (with more than 81% of households), of which 8% poor households, 23% below average, and more than 50% average households, only 18.7% above average and better. Thus, in term of economics, it can be said that the majority of coastal farming households do not have the economic capacity to have good respond from CC impact in the future. Summary table below shows some of the statistic indicators reflecting the livelihoods of households. The result was calculated from survey data of 300 agricultural households of 3 provinces (6 districts, 12 communes) at coastal Red River Delta, Viet Nam. Asea Uninet Scientific and Plenary Meeting 2016 | 495 Table 1. Summary of indicators reflecting household livelihoods from sample surveys at the coastal area of the Red River Delta, Vietnam The group's economic situation Indicators 1. Household structure divided according to economic circumstances 2. The proportion of 15 to 49 per household 3. The percentage of households with women as the main earner 4. The percentage of households with main labor achieved high or higher level 5. Average age of main earner 6. Income from agriculture per household in 1 year 7. The area of agricultural land use per household 8. The total asset value per household 9. Agricultural Costs per household in 1 year 10. The percentage of households have applied production model adaptation to CC 11. The percentage of households had borrowed money to produce 12. The loan amount per household 13. The proportion of households have access to clean water 14. The percentage of households can borrow based on their personal relationship 15. The proportion of households having difficulty in borrowing Unit Total % 100 8,0 23,0 50,3 16,0 2,7 % 48,3 44,4 44,6 50,3 47,1 56,3 % 20,3 58,3 30,4 13,2 12,5 0,0 78,7 33,3 62,3 85,4 100 100 43,5 40,8 46,0 42,9 43,8 39,4 2621,5 1159 1761,7 2528 4116,8 7243 Ha 0,81 0,37 0,52 0,78 1,50 1,06 USD 8958 3145 4509,3 8355,1 15920,6 34084,1 USD 1705,6 574,8 906,5 1621,5 3201 4673 % 42 4,3 8,3 43 100 100 % 83,7 66,7 75,4 84,1 100 100 USD 2014 682,2 1154,2 2088,8 3333,2 4088,8 % 78,3 62,5 62,3 82,1 93,8 100 % 42,2 2,4 10,14 49,0 77,1 100 % 72,4 83,3 75,4 70,9 87,5 62,5 % Year USD Poor Below Above Average average average Good 496 | Asea Uninet Scientific and Plenary Meeting 2016 16. The proportion of households having difficulty in using machinery into production % 68,3 100 91,3 64,9 37,5 (Source: Author's calculations of data from a survey of household capacity to adapt to CC in 2015) From table 1, can be seen in general that: the resource ability and access to livelihood resource of Red River Delta coastal agricultural households are still very limited, it heralds the difficulties and challenge to agricultural households will have to face to achieve the goal of sustainable livelihoods to the impact of CC in the future. Regarding human resource, this is the key resource of households to cope with CC, but the statistics have shown: The proportion of average working people from 15 to 49 per households is only 48.3%. This number is much lower in the households with difficult economic condition (the fact those with difficult economic condition usually born many children, but the majority have not entered the labor force; people who entered labor force often migrant to big cities to find a job, the remain at the local mainly are older people, the average age of households ’main labor force is 40 years old lead to increase the burden of nurturing children and elders) so the productivity of households could be affected significantly. Beside, the percentage of female as main labor force of difficult economic households is relatively high (with 58.3% of poor households, and 30.4% of near poor households; while these groups are very vulnerable by the effect of CC impact). According to Tran Tho Dat et al, (2012, p81-85) has said: the poor and female are vulnerable subjects by the effect of CC. About education level of main labor force, only about 78.7% of main household labor force has High school education level or above; especially with the economic difficulty group, the number is even lower (about 33% of poor households). From the sample survey data of 3 coastal provinces, it can be said the human resource of agricultural households still have many restrictions from quantity, structure and quality that may constrain households to achieve the goals of sustainable livelihoods in the context of CC in the future. About the material resource, Red River Delta coastal areas is a flat land, alluvial agricultural land is quite large, the area of farmland use per household is relatively high (with the average of 0.81ha/household); however this figure is still low in the economic difficult groups (such as: poor group only 0.37 ha/households and below average is 0.52 ha/households). In fact, in many local surveys have shown the low proportion because most of poor and near poor households have small scale of production, in addition to have limit personal capital and labor so they do not use more agricultural land; agricultural activities of poor household is mainly rice planting and vegetable, they do not have the conditions to establish large farms, livestock operations or aquaculture, so they do not use more agricultural land. The average asset value per household in the region is about $8958, indicating the material condition of household remains low. Through households’ opinions, most of them do not have enough tools and modern machinery for production. They also meet many difficulties to apply machinery to production. From table 1, it can be seen that 68.3% households said they meet the difficulties in applying machinery into production. Most of the households point out 2 main reasons: first, the cost to purchase machine is relative high while personal capital resource is limited, hard to borrow capital from the bank; second, the basic condition of local is not guaranteed to apply machinery and modern technology in production. Regarding access to fresh water, through the survey, only 78% said they 25,0 Asea Uninet Scientific and Plenary Meeting 2016 | 497 have access to fresh water; with the poor and near poor households, the number is just over 60%. The average income of households is relatively low, just income from farming per household in the region only reached 2621.5 +/- 151 USD household in 1 year (with p = 95%). The poor group income from agriculture is very low while accessibility to the capital of the ones is also poor (see the following criteria: 11, 12 and 15 in Table 1). It's disturbing that the eligible households is actually difficult for most of the resources and faces barriers in access to capital. Since then the access of other material conditions much more difficult. So it is necessary for governments and local authorities to promote the reduction of poverty and concentrate capital sources to support coastal agricultural households, especially households with special economic difficult conditions (over 30% of households). The ability to leverage social capital of households is also very limited in terms of social resources. The statistics showed that only 42.2% of them could borrow money from their personal relationships. The disadvantaged groups continue to stand at the top end (with only 2.4% of poor households and 10.14% below average number of households can borrow from their personal relationships). The percentage of households applying production model adaptation to CC is relatively low (only 42% of households). The survey results showed that the average income of the application group than 2 times higher than the non-application one. 3.1.2 The initiative of the households in coping with climate change Actively respond morale of households is very important and necessary to prevent the negative impacts of natural disasters caused by CC have on their agricultural production activities. The ability to secure the assets of households will rise and limit the damage to the results of the household livelihood if having good preparation. Even a strong economics manufacturing community can still be great damage to disasters, extreme weather without preparing plans. The survey results also showed the main cause of the failure is due to households subjective and their passive response. One more key study is the understanding of CC in coastal communities still produce specific restrictions (with nearly 40% of respondents said they did not know, did not notice or uninformed about CC but only heard through several media); households have participated in the learning / training disaster prevention knowledge is also very low (only 34.1% of respondents); initiative households regularly updated information is 78.5%; and only 2/3 of households said production plan is needed. An alarming situation is that when asking for the active plan production just about 1/3 households answer yes. Table 2. The initiative in adapting to CC in the group's economic situation (Unit: %) The group's economic situation The evaluation criteria Total Poor The percentage of households has knowledge on CC The percentage of households participates school / training disaster prevention knowledge Below Above Average Good average average 62,0 16,67 24 75,2 94,1 100 34,1 0,00 4 32,4 88,2 100 498 | Asea Uninet Scientific and Plenary Meeting 2016 The percentage of households served to update regularly produce The percentage of households that production planning is necessary The percentage of households regularly scheduled production The percentage of households have converted production within 5 years 78,5 16,70 60 84,7 100 100 62,9 16,70 40 65,7 100 100 33,1 0,00 5 13,3 43,1 64 39,0 0,00 0 41,9 94,1 100 (Source: Author's calculations of data from a survey of household capacity to adapt to CC in 2015) A more disturbing findings from the statistics in Table 2 showed that households with difficult economic circumstances are the most subjective to CC, the poor seem apathetic towards the proactive response activities. They have limited understanding of CC, not regularly updated information and have poor production plan. It is also the cause of their most vulnerable by CC and poverty were even poorer than before the crisis blow or shock that causes CC. 3.2 3.2.1 Impact of determinants of adaptive capacity to disaster response achievements of agricultural households Model specification The research approached the framework of Smit et al (1999, 2001) to specify determinants of adaptive capacity to CC. The adaptive capacity based on the framework of Smit et al (1999, 2001) contains 6 determinants: Economic resources; Technology; Infrastructure; Information, Skill and Management (Human resource); Institution and Network (Social capital); and Equity. However, owing to limitation of survey data, we could not collect all variables representing to these determinants following the framework of Smit et al (1999, 2001). Therefore, we proposed 5 determinants of adaptive capacity to CC based on the framework of Smit et al (1999, 2001) with some light modification (see Figure 1 above) and collected 8 variables representing to the determinants. To measure disaster response achievements, we used the indicator: “the outcome of responding to recent disaster”. Asea Uninet Scientific and Plenary Meeting 2016 | 499 Figure 1. Model to research effects of adaptability determinants to CC response outcome Variables representing to these determinants were assigned as below:      Human resources are represented by three variables: Gender (with 1- male, 2female), Age, Education (with 1- primary school level , 2 – secondary school level, 3 – high school level , 4 - intermediate degree, 5 – bachelor degree and higher) Economic/ Financial resources are represented by economic status (with 1 – poor , 2 – Below average, 3 – Average, 4 – Above average , 5- Good) Technology is represented by status of applying adaptive production model (with 1- Not apply, 2 – Apply) Network (social capital) is represented by capital accessibility from household’s relationships (with 1- easy (no difficulty) , 2 – difficult ) Infrastructure is represented by two variables: fresh water accessibility (with 1lack of water, 2 - full water); and status of planning infrastructure of production zones (with 1- the household is not been in any planed production zones, 2 – the household is been in a planed production zone). In this research, we used binary logistic regression method to find out evidences about the relation between factors determining for adaptive capacity to household’s response ability and to evaluate effects of determinants of adaptive capacity to household’s CC response outcome. Eight proposed variables represent to five determinants in the research model above. And these variables are used as independent variables in binary logistic regression. The outcome of disaster response is considered as the variable reflecting adaptation achievement (with 0 - if the household failed in responding to recent disaster, 1 - if the 500 | Asea Uninet Scientific and Plenary Meeting 2016 household succeeded in responding to recent disaster)45. Thus, binary logistic estimate equation is formed as below: Log (p/1-p) = β0 + β 1X1+ β2X2+....+ β8X8 (1) Where p is probability of success in responding disaster, and X i (with i =1,8) is independent variables in the equation. 3.2.2 Regression results analysis Regression results show that this is a good estimated model for analyzing the relation between determinants of adaptive capacity to household’s response ability (see appendix 2, 3 and 4). Binary logistic regression results are illustrated in tables below: Table 3. Classification Tablea Observed ,00 Probability of Respond 1,00 Overall Percentage a. The cut value is ,500 Step 1 Predicted Probability of Respond Percentage Correct ,00 1,00 130 25 83,9 18 84 82,4 83,3 From the table 3, it can be seen that among 155 failed households in responding to disaster, the equation correctly predicted 130 cases (83,9%); and among 102 cases being successful in responding, the equation correctly predicted 84 cases (82,4%). Generally, the equation correctly predicted about 83,3%. Table 4. Variables in the Equation B Status of planning infrastructure of production zones Status of applying adaptive production model Capital accessibility Education Fresh water accessibility Economic status Gender Age Constant S.E. Wald Df Sig. Exp(B) 95% C.I.for EXP(B) Lower Upper 1,916 ,587 10,671 1 ,001*** 6,795 2,152 21,451 2,721 ,545 24,927 1 ,000*** 15,196 5,222 44,222 -1,068 ,264 2,192 ,799 ,459 -,015 -12,194 ,521 ,281 ,679 ,317 ,531 ,021 2,485 4,198 ,879 10,432 6,342 ,749 ,513 24,077 1 1 1 1 1 1 1 ,344 1,302 8,952 2,223 1,583 ,985 ,000 ,124 ,750 2,367 1,194 ,559 ,947 ,955 2,260 33,853 4,140 4,479 1,026 ,040** ,349 ,001*** ,012** ,387 ,474 ,000 It is assumed that if household’s lost value due to disaster is more than 50 USD, the household is considered unsuccesful in responding. 45 Asea Uninet Scientific and Plenary Meeting 2016 | 501 Note: Variable(s) entered on step 1: Status of planning infrastructure of production zones , Status of applying adaptive production model, Capital accessibility, Education, Fresh water accessibility, Economic status, Gender, Age. The signals ***, **,* show that the null hypothesis is rejected at 1%, 5%, and 10% level of significance, respectively. Thus, the binary logistic estimate equation is specified as below: Log (p/1-p) = -12,194 - 0,015*Age + 0,459*Gender + 0,799*Economic status + 2,192* fresh water accessibility + 0,264*Education – 1,068* Capital accessibility + 2,721*Status of applying adaptive production model + 1,916* Status of planning infrastructure of production zones. From the regression results, we can see the evidence of impacts of factors such as Economic status, fresh water accessibility, Capital accessibility Status of applying adaptive production model, and planning production zones to the probability of successful response. It can be seen clearly that adaptive production model has strongest positive effect on the success probability of households in responding to disaster; and infrastructure significantly impacts to success probability of households. Thus, the assistance of local authority involving infrastructure has positive effects on the success ability of households in response. The research also shows that difficulties in capital accessibility can put resilience of households at risk. On the other hand, we have not clearly seen the impact of variables determining human resource such as gender, age, education to success probability of agriculture households in response. And there are so many other variables that we could not give into the equation because of limitation of data in the survey. This is a limitation of the research, which suggests us to implement continuing studies. 4 4.1 CONCLUSION AND SUGGESTION Conclusion Impacts of CC to agriculture livelihood in coastal areas has been predicted that it will continue to grow up more and more through time. This can cause large damages to agriculture production communities in coastal areas and threat to safety and sustainability of coastal livelihoods if agriculture households in coastal areas have not a good adaptability. One of top central duties in preventing and reducing the impacts of disasters caused by CC is improving the adaptive capacity of agriculture households in coastal areas. From data of the survey in 3 coastal provinces of the Red River Delta shows that the adaptive capacity of coastal communities is generally limited and necessary to enhance more. The poor people have the worst adaptive capacity; they often have difficult problem of livelihood resources and approaching resources to adapt. This research has also shown that adaptation achievement of poorer groups is lower than that of richer groups. Most of households are not proactive in planning for their production themselves; they have little knowledge about CC and respond passively. Besides, the research has shown that adaptive production model has positive effect on households’ adaptability (but only more than 40% of households applying adaptive production models). On the other hand, it is undeniable that assistance of local government can enable households easier to approach livelihood conditions such as fresh water and infrastructure planning etc..., which is conducive to raising their adaptive capacity and bestow upon them better response outcomes. 502 | Asea Uninet Scientific and Plenary Meeting 2016 Improving households’ capacity to copy with CC is really essential and urgent in the context of CC now; and the assistance of government is very essential to consolidate their adaptive capacity to CC. 4.2       Suggestion Local governments should implement propaganda to raising household’s awareness and change people’s thinking in responding to CC. This can help households cope with CC in a more proactive way. Besides, local governments need to review all coastal agriculture production zones; and determine to make planning of specialized production zones. This can help households easier to participate in planning of production areas and apply adaptive production models. Local governments also need to focus on mobilizing all social resources to improve infrastructure in order to create more favorable conditions for households’ production. Government should direct credit institutions and banks to reform financial support policies for agriculture and rural areas. To specify, credit procedure should be simpler and faster; the poor should be supported interest with loaning purpose to buy machines, improve production conditions, or change production model. Agriculture promotion agency should frequently research to find out adaptive production models in order to train, practice and transfer new technology to agriculture households. Households should be more proactive in precluding impacts of CC. To specify, households should actively plan for their production and usually update information, enjoy short courses of adaptive production models, often share knowledge and information together, apply adaptive production models recommended by agriculture promotion agency. REFERENCES Armitage, D. & Plummer, R. (2010), Adaptive Capacity and Environmental Governace, Springer – Verlag Berlin Heidelberg, Springer Series on Envinronmental Management. Burton, I., Huq, S., Lim, B., Pilifosova, O. & Schipper, E.L. (2002), From impacts assessment to adaptation priorities: the shaping of adaptation policy. Climate Policy 2, p145-159. Chambers, R. and Conway, G.R. (1992), Sustainable Rural Livelihoods: Practical Concepts for the 21th Century, Discussion Paper 296, Brighton, UK: Institute of Development Studies. Chaudhry, P. and Ruysschaert G. (2007), Climate Change & Human Development in Vietnam, Human Development Report. IPCC [Intergovernmental Panel on Climate Change] (2001), Climate Change 2001, Synthesis report. IPCC [Intergovernmental Panel on Climate Change] (2007), Climate Change 2007, Synthesis report. IUCN, SEI and IISD (2003). Livelihoods and Climate Change. The International Institute for Sustainable Development. Asea Uninet Scientific and Plenary Meeting 2016 | 503 MONRE [Vietnam Ministry of Natural Resources and Environment] (2008), National Target Program to Respond to Climate Change in Vietnam, Implementation of Resolution No. 60/2007/NQ-CP December 3, 2007 by Government, Hanoi. Scoones, I. (1998), Sustainable Rural Livelihoods: A Framework for Analysis, working Paper 72, Bringhton UK: Institude of Development Studies Smit B. and Wandel J. (2006), Adaptation, adaptive capacity and vulnerability. Global Environmental Change 16, p282 – 92. Smit, B., Burton, I., Klein, R.J.T., Street, R. (1999). The science of adaptation: a framework for assessment. Mitigation and Adaptation Strategies for Global Change 4, p199–213. Smit, B., Pilifosova, O. (2001). Adaptation to Climate Change in the Context of Sustainable Development and Equity. Chapter 18 in Climate Change 2001: Impacts, Adaptation, and Vulnerability— Contribution of Working Group II to the Third Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, UK. Tran Tho Dat, Vu Thi Hoai Thu (2012), Climate Change and Coastal Livelihoods, Vietnam Development Forum, Transportation Publishing House, Hanoi, Vietnam. Tran Tho Dat, Vu Thi Hoai Thu & Pham Ngoc Toan (2014), Vulnerability and Adaptation of Coastal Livelihoods to the impacts of Climate Change: A case study in Coastal Districts of Nam Dinh, Vietnam. Journal of Economics and Development, National Economics University – Hanoi, Vietnam,Vol 6, No2, p39-60. USAID [United States Agency for International Development] (2009), Adapting to coastal climate change: A Guidebook for Development Planners. APPENDIX A1. Sample description Specificity Gender (of breadwinner) + Male + Female Economic status (divided into 5 groups) + Poor + Lower + Middle + Upper + Rich Age (of breadwinner) + < 30 + From 30 to 39 + From 40 to 49 + From 50 to 59 + From 60+ Education + Elementary + Junior High school + Senior High school + College Sample size (n = 300) Percentage (%) 239 61 79,7 20,3 24 69 151 48 8 8,0 23,0 50,3 16,0 2,7 25 91 101 81 2 8,3 30,3 33,7 27,0 7,0 5 59 174 39 1,7 19,7 58,0 13,0 504 | Asea Uninet Scientific and Plenary Meeting 2016 + Bachelor and higher 23 7,7 Appendix 2. Omnibus Tests of Model Coefficients Step 1 Step Block Model Chi-square 142,708 142,708 142,708 Df Sig. ,000 ,000 ,000 8 8 8 Appendix 3. Model Summary Step -2 Log Cox & Snell R Nagelkerke R likelihood Square Square 1 202,561a ,426 ,577 a. Estimation terminated at iteration number 6 because parameter estimates changed by less than ,001. Appendix 4. Hosmer and Lemeshow Test Step 1 Chi-square 25,335 df 8 Sig. ,001 HOUSING PREFERENCE OF EDUCATIONAL BACKGROUND Anita Dianingrum anita.dianingrum@yahoo.com Magister student of Architecture Department, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Arlita Widyasari arlita.widyasari@yahoo.com Magister student of Architecture Department, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Muhamad Faqih faqih@arch.its.ac.id Senior Lecturer of Architecture Department, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Arina Hayati4 arina.hayati@gmail.com Lecturer of Architecture Department, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Abstract According to hierarchy of needs, shelter (housing) is one of the human basic needs. Most previous researches on housing preference focus on indicated variables of housing trends and preferences general, not for specific background. However, this paper examines housing preference of certain group, based on the society level and educational background.. A survey with quantitative approach is used with closed questioners distributed randomly to 100 respondents with higher educational background (bachelor and postgraduate degree). Data is tabulated and analyses quantitatively. The result shows that, land tenure is the most important factor to be considered when people with higher education want to buy a house. Other factors are location, housing quality, price, housing size, physical condition, supported facilities inside the housing, and bonuses. These outcomes can be used as a reference for developer or private sector in providing housing, especially for educated society. Keywords: housing preference, educated society 1 INTRODUCTION A house is something to fulfill the human basic need for shelter. The idea of housing function as a residence is indicated by the hierarchy of needs, proposed by Abraham Maslow (Panudju, 1991). As a consequence, different levels of society have different ideas or perception about housing. That occurs because they have different needs and purposes. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 505 506 | Asea Uninet Scientific and Plenary Meeting 2016 Moreover, the ideas of perceptions would affect housing preference of individuals (Triyuly, 2009). Each individual have different preferences because along with their needs, each of them has specific wishes or wants in order to fulfill their needs. That also applies to fulfill the need of shelter. Those wishes or wants of individual or group, rather than simple needs, often greatly affect preferences and choices in housing. It’s because wishes and wants are closely related to meaning and culture (Rapoport, 2005). Every year, the housing needs of society continues to increase. Based on the data from Central Institution of Statistics (BPS), the number of housing backlog in Indonesia has reached 13.5 million units. As a consequence, the Government of Indonesia through The Ministry of Public Works and Public Housing (PUPR) has been trying to encourage housing construction program for the society through the “Million Houses Programme”. In this programme, the Government allocated only 10 percent of funds for the construction of housing. And the remaining of funds aided by the developer, the society and local government. However, the number of one million houses was divided into 600 thousand houses for the Low-Income society and 400 thousand houses for non Low-Income society. According from such a mechanism, the developer has a big influence in housing construction. Especially for non low-income houses, where the government has been completely handed over to the market mechanism. Developers need to know the housing preferences of different society, in order to fulfill housing of consumen need. So that, housing preference is needed to be examined to serve as a reference for developer or private sector in providing housing. So far, many researches in housing preference are only discussed this topic for another group of society such as Asteriani (2011), Kurniadi (2013) dan Triyuly (2010), has never been done specifically for educated society. Thus similar research with specific target such as educated society is needed. Because with the progress of the national economy, the number of middle class population in the country is growing more rapidly. This affects the size of potential housing market for middle and middle-high class. In general, middle-class consumers are educated young families, professionals, have a critical attitude and familiar with the development of technology and information. Characteristics such consumers should be able to be serviced exclusively by developer or private sector. This study aims to determine Housing Preference of educated societies and how the occupancy ratio of preference based on social class consumers. The result shows variable order of Housing Preference based on the importance level of educated societies and simplifying the variables into smaller groups, called factors. 2 2.1 LITERATURE REVIEW Definition of Housing Preference Preference means options or the act of choosing. The term preference is used to replace the word of interested in something. Preference is desire or tendency of individuals to choose and have something. (Source: Journal planet, Year I 2 July to August 2001, p: 33-42). Housing preferences can also be interpreted as a desire to choose and have certain atrributes in housing, with the occupants as the subject in decision making. Therefore, it means a process where the occupants make their desired conditions of housing fulfilled (Triyuly, 2010). Preferences are related to the behavior, perception, response, and feedback in decision making on some alternatives (Triyuly: 2005). Individual perception of environmental context can be distinguished as environmental perception or preference, and Asea Uninet Scientific and Plenary Meeting 2016 | 507 environmental cognition (Rapoport, 1977: 31). Preferences based on different need levels and interests are affected by the information from publics perception and interaction with other people. Preferences residential of neighborhood communities are affected by: (a) (b) 2.2 Structural factors: the influence / impact of neighborhood configuration Functional factors: the influence / impact of mood and past experience. Description of Educated Societies Regarding the demographic background of respondents, studies have shown that housing preferences are linked to residents’ gender (Devlin, 1994b), family income, age, education, type of employment (Wang and Li, 2006), kinship, religion and attitude toward women (Jabareen, 2005). This study focuses on education background, especially higher education, as a factor that affect individual housing preferences. Thus, only limited individuals with bachelor degree, master degree, or doctoral students are targeted as respondent. Graduate degree is any one that finished undergraduate degrees and continued higher level such as Master's and Ph.D (Piero and Finn, 2011). Post graduate relates to studies done after earning a bachelor's degree or other degree (Meriam Webster dictionary). 2.3 Research on Housing Preference Review from previous researches are done to avoid duplication of research. Results of previous studies are used as a basis or guidelines to conduct this research. The results of several research are associated with the Housing Preferences in Indonesia, such us Febby Asteriani (2011), who discussed "Preference of Residents in Pekanbaru in Determining Housing Location" which purpose of study is to confirm the theoretical factors on choice of housing location and decisive factors in site selection. Research method was survey, simple random sampling and quantitative analysis. The results were studies on each factors in housing site selection considered decisive by occupants. Another research for Deny Kurniadi S. (2013)," Consumen Preferences in Buying Medium Housing Type in Bantul (Study on Housing Kecamatan Banguntapan and Kasihan). This study aims to analyze the attributes that became the main preference for consumers to buy a house and analyze that differences in demographic category. Reserch method are purposive sampling, survey research, and quantitative analysis. The result shows most important attributes of consumer preference is safety factor, followed by location and the next is facility. Demographic categories that most affect consumers is education. Other variables that have influence are sex, age, and income. Demographic variable that does not affect the consumer's preferences is children. Wienty Triyuly (2010), "Identification of Housing Preference for low-income people in Palembang based on hierarchical cluster and discriminat analysis method". The purpose of this study are to identify housing preference for low-income people in Palembang. The result is housing planning & prototype for low-income people and evaluation of occupied houses in Palembang. Some research above only discussed housing preference for another group of societies, no one has focused on educated ones. However, in some other countries, a lot of research has been done that addressed Housing preference for educated societies, such us Khozaei dkk, (2012), "A Shorter Version of Student Accommodation Preferences Index (SAPI)". It developed instruments for examination of student accommodation preferences more specifically by using factor analysis method. Results of this study were to produce a valid and reliable student accommodation preferences instruments (with only 29 items, is 508 | Asea Uninet Scientific and Plenary Meeting 2016 much simpler than the original 60-item instrument). But this study only discussed about Student Accommodation Preferences. 2.4 Supporting Theories Housing Preference Mass media and advertising often use environmental aspects such as vegetation, location, residential or place character, environmental atmosphere, recreational facilities, or status (people who live there) to attract people to stay in certain place. Mass media and advertising can make a different living preference from something assessed (Rapoport, 1977). Amos Rapoport (1977: 82) also stated that: "The decision on location is often associated with residential character, status, prestige, social homogeneity, reforestation, topography, views, security, good schools, and the idea of a combination environmental character usage and application, also social relationships which are associated with the level and social status ". Environmental quality of housing depends on availability of settlements attributes that include location, environment and home. Environmental quality of housing is determined by the accessibility factors, transportation and the distance to the municipal facilities, residential neighborhood arrangement includes physical and social conditions, also ammount the construction, model and availability of housing facilities (Rapoport, 1977). According to Amos Rapoport (1977: 81), people will adjust their preference to select residential neighborhood. Residential Selection adjusted by environment preferences that involve understanding characteristics of people and environment. Public housing preferences are related to community priorities for housing in which low-income people are more concerned with residential location close to the workplace rather than land tenure and quality of housing (Turner, 1972; 166-168). As civilized human beings, people have the power and mind to change and to search for new forms of their house. People want to have low price house and luxury facilities. Environmental factors also affect how people choose or select to live, includes quietude, close to the city and facilities also infrastructure. In addition, friendly neighbors is also a considered option (Kuswartojo, 2005). Studies on housing preferences and choices have been much examined and influenced by several factors, both in macro and micro level. Macro level includes factors of time, space, money and social relationships (Ge and Hokao, 2006), size of place of residence (Jong, 1977; Heaton et al., 1979; Hwang and Albrecht, 1987; Hempel and Tucker, 1979; Tremblay et al., 1980), functional congruity (Sirgy et al., 2005) and neighborhood attributes (Wang and Li , 2006; Lindberg et al ,1989). Other factors in residence housing preferences are outdoor environmental quality (Jim and Chen, 2007), location (Devlin, 1994, Thamaraiselvi & Rajalakshmi, 2008; Karsten, 2007; Lindberg et al., 1989), neighborhood attributes (Hempel &Tucker, 1979), local landscape (Nasar, 1983), safety, and proximity to the city, public transportation, proximity to workplace, sense of safety, medical and health facilities, and educational facilities (Wu, 2010). At the micro level, exterior facade of the residence (Nasar and Kang, 1999; Akalin et al., 2009; Stamps & Miller, 1993; Stamps, 1999), dwelling type (Opoku & AbdulMuhmin 2010; O’Connell et al., 2006; Elliott et al. , 1990), convenience, security, price, orientation and layout (Wang and Li, 2006), as well as the dwelling’s architectural style (Devlin, 1994 a,b; Hempel & Tucker, 1979) are also examined in the study of housing preferences. Similar studies have also examined the role of safety, resale value, maintenance, amenities (Thamaraiselvi & Rajalakshmi, 2008), lot size, housing price, Asea Uninet Scientific and Plenary Meeting 2016 | 509 location, distance attributes (e.g., distance to shops, schools, facilities), range of housing styles available, and the size of the home (Reed & Mills, 2007). Lifestyle Lifestyle according to Kotler, (2002) is a life pattern in the world, expressed in activities, interests, and opinions. Lifestyle is combination and totality of ways, governance, customs, options, and objects that support, implementation based on values system or certain belief system (Piliang in Sachari Agus, 2007: 73). Sutisna (2002: 145) suggests that lifestyle can be identified by how people spend their time (activity), what they consider important in their environment (interest), and what they think about themselves and the world around it (opinion). Lifestyle also affects person's desires to behave and ultimately determine consumption choices (Kasali, 1998: 225). Fulfillment of preferences adjusts to social and economic perspectives, social class and ethnic. Socio-economic perspective, view preferences in relation to life cycle, economic status and lifestyle. While, the perspective of social class and ethnic emphasize the preference in classification or grouping by grade, occupation and ethnic (Earl W, Morris and Mary, Winter, 1978: 270-274). The composition of socio-economic status includes education, income and employment. Environment –Behavior Studies Architecture is defined as a science-based profession that is concerned with problem solving. Design is the Architectural forms of problem solving based on the application of research-based knowledge. Because all orientations based on user oriented, the knowledge is related to how people and environments interect. Therefore, EBS (EnvironmentBehavior Studies) is focused on studying the relationship between humans and the environment (Rapoport, 2005). Culture has a very important role as intermediaries between how people and environments interact. Culture became an approach that can be used to study and understand human characteristics (Rapoport, 2005). Cultural variables related to the built environment come from the dismantling of cultures which are divided into two axes. The horizontal axis describes the built environment more specifically includes the value (ideal, images, schemata and meaning, norms, standards, expectations, rules, etc.), lifestyle and system activity. While the vertical axis describes the tangible expression of a culture, that kinship, family structure, rules, social networks, status, identity and institutions (Rapoport, 2005). Ralph Linton (1945, p. 4), culture refers to the way of life of community. In this context, culture refers to the countless aspects of life. Some anthropologists thought of culture as a rule, or the ideas behind the behavior (Holland & Quinn, 1987, p 4); Most anthropologists thought of culture as learned behavior and beliefs, attitudes, values, and ideals that are characteristic of a community or population (Ember & Ember, 1998, p. 148). 3 RESEARCH METHOD This study is targeted the today’s societies of educated prople. The data collection method is random sampling targeted 100 samples with higher educational background. This research was conducted by distributing questionnaires to the respondents who are mostly located in ITS (Institut Teknologi Sepuluh Nopember) campus area of Surabaya. Questionnaires are also distribured by email for the respondents outside the ITS campus. 510 | Asea Uninet Scientific and Plenary Meeting 2016 The results of the questionnaires are tabulated and using quantitative analysis to determine the frequency and the order of housing preference variables based on their priority. Researchers also conducted a factor analysis using the SPSS program to simplify a number of variables into smaller variables, called factors. Afterward, these results, described an assumption based on an existing reference. Based on the literature reviews of Housing By People (Turner, 1972), human aspects of urban form (rapoport, 1977), and from the collected housing advertisement, some variables of housing preferences are obtained as follows: physical form of the house, housing quality, building area, housing prices, location, availability of support facilities, transaction bonuses, and land tenure. These variables are used to determine the order of housing preference in educated societies and to simplify a number of variable. 4 4.1 FINDINGS AND DISCUSSIONS Review of Respondents Questionnaires are distributed directly to respondents around ITS campus area and also by email for respondents outside ITS campus. Education levels of respondents in this study consist of bachelor degree 19%, master student 57%, master degree 16% and doctoral student 8%. 4.2 Housing Preference for Educated Society The following table shows the sorted priority of housing preferences from the data calculation of 100 respondents with educational background in Indonesia. Based on the table below, discussing about housing preferences of educated society in Indonesia, land tenure is the most important aspect of housing preference for educated societies, despite of other aspects which are location, housing quality, price, housing size, physical condition, supported facilities inside the housing, and bonuses. Specifically, the detailed housing preferences variables for educated society are shown as below : Table 1. Priority of Housing No. 1. 2. Assessment Variables Land Tenure Location of housing Close to education facilities Close to work Close to the hospital Crossed public transport Close to downtown Close to shopping centers Close to the culinary center Close to family Close to the motorway / main road Priority (%) 76,4 74,3 72 65,9 65,1 64,2 63,3 62,6 59,2 Asea Uninet Scientific and Plenary Meeting 2016 3. 4. 5. 6. 7. 8. Close to tourist attractions Close to the airport Close to Club House Close to Golf Housing Quality Infrastructure (sanitation, electricity, water) Environment (green, clean, healthy, etc.) Natural lighting Ventilation Traffic security Security of thieves (CCTV, one gate system) Housing Price Housing Area Housing Physical Building materials Space supporters (front garden) Fence Housing model (minimalist, traditional) Floor level (1floor, 2 floor) Supporting space (double carpot) Supported Facilities Inside The Housing Religious facilities Educational facilities Dining facilities Shopping facilities Congregate facilities Entertainment facilities Sports facilities Tourist facilities Bonuses Investments Advances light Discount Installment cheap Gift Preferences Variables for educated society 53,3 50,3 31,1 28,6 91,2 89 87,8 87,6 76,1 68,6 79,7 77,1 72,5 71,5 68,1 60 82,6 72,9 70,1 69,8 67,3 60,2 59,4 54,6 82,5 76,7 75,7 74,4 57,7 | 511 512 | Asea Uninet Scientific and Plenary Meeting 2016 Source : Author’s Analysis, 2015 4.3 The Factor analysis of Housing Preferences for Educated Society The result of the factors analysis process based on the 41 variables, which reduces to 40 variables. The final results of the factor analysis are classified into 11 factors of Housing Preference, as follows:  Factor 1: Crossed public transport, close to the motorway / main road, close to work, close to downtown, close to the airport, close to tourist attractions, Close to shopping centers, tourist facilities Factor 2 : Space supporters (front garden), ventilation, natural lighting, infrastructure (sanitation, electricity, water), environment (green, clean, healthy, etc.), land tenur Factor 3 : Close to the hospital, close to the culinary center, sports facilities, entertainment facilities, congregate facilities, religious facilities, shopping facilities, dining facilities, educational facilities Factor 4 : Housing prices, Gifts, Installment cheap, Discounts, Advances light Factor 5 : Security of thieves (CCTV, one gate system), traffic security Factor 6 : Close to Golf, Close to Club House Factor 7 : Fence, close to family, close to educational facilities Factor 8 : Housing model (minimalist, traditional), supporting space (double carpot) Factor 9 : Building materials Factor 10 : Investments Factor 11 : Housing area           Based on the result of factor analysis above, 11 group of factor can not be named, because the clasification of groups is very random. It’s caused by invalidity of the data obtained. 4.4 Comparison of Housing Preference for Educated Society and The Others Based on similar studies conducted in different groups, this research is identifying the priority aspects for housing preferences based on a society level: low-class, middle-class, high-class, educated, and small town residents. Subsequently, these outcomes can be used as an underlying consideration for developer or private sector in providing and planning housing which are affordable and suitable for the targeted societies. 1 2 3 4 5 6 7 8 Land Tenur e House Price Bonuse s House Qualit y House size Supporte d Facilities House physical House Locatio n Low-Class Society Land Tenur e House size House Price House Qualit y House physica l Bonuses Supporte d Facilities House Locatio n MiddleClass Society Land Tenur e Land Tenur e House Price House size House Qualit y House Locatio n House physical Supporte d Facilities Bonuse s House Locatio n House size House Price House Quality House physical Supporte d Facilities Bonuse s Priority Small Town Society High-Class Society Asea Uninet Scientific and Plenary Meeting 2016 Well Educated Society Land Tenur e House Locatio n House Quality House Price House size House physical Supporte d Facilities | 513 Bonuse s Table 2. Comparison of Housing Preference in Indonesia based on community groups Source: Analysis Results ,2015 It can be seen that every level of society prioritizes a house with legal land tenure. Conversely, bonuses are considered as the less important aspect for educated, middle class, and high class society. While the low-income and small town society considered location as the last. In addition, supported facilities inside housing has low priority in each group. Because each group of society is more concerened to internal aspect of housing than supported housing like quality of housing, price, size, and physical of housing. 5 CONCLUSION Our research shows that the most important aspect of housing preference of educated people are land tenure, location, housing quality, housing prices, building area, physical condition of the house, additional housing facilities, and transaction bonuses. It can be assumed that educated people have a background of extensive knowledge, thus have many considerations related to Housing Preference. The outcomes of this study can be used as an underlying consideration for developer or private sector in providing and planning housing which are affordable and suitable for the targeted societies, especially for educated society. This research supports some previously stated studies that Housing Preferences are influenced by demographic background of respondents particulary for people with higher educational background. This study has not been widely explored, therefore open an opportunity for further research to be developed. REFFERENCES Arjuna.W. (2013). Kajian Teori Preferensi Bermukim, diakses di http://studyandlearningnow.blogspot.co.id/2013/01/kajian-teori-preferensi bermukim.html, pada tanggal 15 Desember 2015, pukul 10.30. Brian, BS. (2013). Pengaruh Gaya Hidup Terhadap Keputusan Pembelian Rumah. Semarang. Devlin, A. S. (1994). Gender-role and housing preferences. Journal of Environmental Psychology,14(3), 225-235. Earl W, Morris and Mary, Winter. (1978). Housing, Family, and Society. John Willey and Son Inc. Ember, C. R., & Ember, M. (1998). Anthropology: A brief introduction. Englewood Cliffs, NJ: Prentice Hall. Ge, J., & Hokao, K. (2006). Research on residential lifestyles in Japanese cities from the viewpoints of residential preference, residential choice and residential satisfaction. Landscape and Urban Planning, 78 165–178. Heaton, T., Fredrickson, C., Fuguitt, G. V., & Zuiches, J. J. (1979). Residential preferences, community satisfaction and intention to move. Demography, 16(4), 565_573. Hempel, D. J., & Tucker, L. R. (1979). Citizen Preferences for Housing as Community Social Indicators. Environment and Behavior, 11(3), 399-428. Holland, D., & Quinn, N. (Eds.). (1987). Cultural models in language and thought. Cambridge,UK: Cambridge University Press. 514 | Asea Uninet Scientific and Plenary Meeting 2016 Jabareen, Y. (2005). Culture and Housing Preferences in a Developing City. Environment and Behavior, 37(1), 134-146. Jim, C. Y., & Chen, W. Y. (2007). Consumption preferences and environmental externalities: A hedonic analysis of the housing market in Guangzhou. Geoforum, 38(2), 414-431. Jong, G. F. D. (1977). Residential preferences and migration. Demography, 14(2), 169178. Kasali, Reinald. (1998). Membidik Pasar Indonesia : Segmentasi, Targeting dan Posisioniong. Jakarta : Gramedia Pustaka Utama. Kotler, Philip. (2002). Manajemen Pemasaran. Edisi IX (terjemahan), Jilid II. Jakarta: Penerbit Erlangga Jakarta Cetakan XV. Kuswartojo, T. (2005). Perumahan dan Pemukiman di Indonesia, Upaya Membuat Perkembangan Kehidupan yang Berkelanjutan. Bandung: Penerbit ITB. Linton, R. (1945). The cultural background of personality. New York: Appleton-CenturyCrofts. Nasar, J. L. (1983). Adult Viewers' Preferences in Residential Scenes: A Study of the Relationship of Environmental Attributes to Preference. Environment and Behavior, 15(5), 589-614. Nasar, J. L., & Kang, J. (1999). House style preference and meanings across taste cultures. Landscape and Urban Planning, 44(1), 33-42. Opoku, R. A., & Abdul-Muhmin, A. G. (2010). Housing preferences and attribute importance among low-income consumers in Saudi Arabia. Habitat International, 34, 219–227. Panudju, Bambang. (1991). Pengadaan Perumahan Kota Dengan Peran Serta Masyarakat Berpenghasilan Rendah, Penerbit Alumni Bandung. Piero, Mike. (2011). Learning the Terms Undergraduate and Graduate, diakses di http://www.brighthub.com/education/college/articles/86076.aspx. pada tanggal 18 Desember 2015. pada pukul 16.30. Rapoport, Amos. (2005). Culture Architecture and Design. United States of America : Locke Science Publishing Company, Inc. Rappoport, Amos. (1977). Human Aspect of Urban Form. New York : Pergamon. Reed, R., & Mills, A. (2007). Identifying the drivers behind housing preferences of firsttime owners. Property Management, 25(3), 225 - 241. Sachari, Agus.(2007). Budaya Visual Indonesia. Jakarta : Erlangga. Santos, Singgih. (1997). SPSS, Mengolah Data Statistik Secara Profesional. Jakarta : Elex Media Komputindo. Sirgy, M. J., Grzeskowiak, S., & Su, C. (2005). Explaining housing preference and choice: The role of self-congruity and functional congruity. Journal of Housing and the Built Environment, 20 329–347. Sutisna. (2002). Perilaku konsumen dan komunikasi pemasaran, Bandung : PT. Remaja Rosdakarya. Thamaraiselvi, R., & Rajalakshmi, S. (2008). Customer behavior towards high rise apartments: preference factors associated with selection criteria. The Icfai University Journal of Consumer Behavior, III(3). Triyuly, Wienty. (2005). Kebutuhan Perumahan Untuk Keluarga Muda Berdasarkan Perspektif Perkembangan Keluarga di Kota Palembang. Palembang Triyuly, Wienty. (2009). Model Perumahan Bagi Masyarakat Berpenghasilan Rendah Di Kota Palembang Berdasarkan Preferensi Dan Tingkat Keterjangkauan (Affordability) Masyarakat. Palembang. Asea Uninet Scientific and Plenary Meeting 2016 | 515 Triyuly, Wienty. (2010). Identifikasi prefrerensi rumah bagi masyarakat berpenghasilan rendahdi kota palembang berdasarkan metode hierarchical cluster dan discriminat analysis. Seminar Nasional Metodologi Riset dalam Arsitektur. Triyuly, Wienty. (2008). Evaluasi Pembangunan Perumahan Real Estate Berdasarkan Kebijaksanaan Hunian Lingkungan Berimbang. Palembang. Turner, John F.C.(1972). Housing By People. London : Marion Boyars Publisher Ltd. Wang, D., and Li, S.-m. (2006). Socio-economic differentials and stated housing preferences in Guangzhou, China. Habitat International, 30, 305–326. Wu, F. (2010). Housing environment preference of young consumers in Guangzhou, China. Property Management, 28(3), 174-192. . Meriam Webster Dictionary. diakses di http://www.merriamwebster.com/dictionary/postgraduate. pada tanggal 18 Desember 2015. pada pukul 16.45. .(2015). Dirjen Penyediaan Perumahan : Data Kebutuhan Rumah MBR Di Daerah Harus Jelas. diakses di http://www.pu.go.id/berita/10484/DirjenPenyediaan-Perumahan-:-Data-Kebutuhan-Rumah-MBR-Di-Daerah-Harus-Jelas. pada tanggal 4 Februari 2016. pada pukul 22.10. . (2014). Jenis Rumah Berdasarkan Target Konsumen. diakses di http://panduanbisnisproperti.com/jenis-rumah-berdasarkantarget-konsumen. pada tanggal 4 Februari. pada pukul 23.00. BUDGET DEFICITS IN VIETNAM – FROM TARGET ECONOMIC “QUADRANGLE” TO “PENTAGON” Hoang Thi Lan Huong huonghlnhtc@neu.edu.vn National Economics University Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract According to some researchers, the situation of “twin deficits” has existed in many countries. However, in some other studies, there is no causal relationship between budget deficits and current account deficit. Obviously, controversies around the question “Is there causal relationship between budget deficits and trade deficit?” has not yet stopped, and it needs to be studied in more details. Conducting this research, the author wishes to express personal views on the challenges faced by the Government of Vietnam in balancing between budget targets with other important goals. This paper focuses on analyzing the real situation of Vietnam’s budget and current account, combining with two case studies of Brazil and the United States. It was shown that “twin deficits” may exist in a country within a certain period of time. Budget deficit, however, should not be always blamed for trade deficit. In Vietnam, danger of budget deficit always presents and may cause economic instability, especially when “devaluation” has been being used amid rising foreign debt since 2008. In the author’s point of view, the term “target economic quadrangle” should be replaced by “target economic pentagon”, with the fifth top being “budget deficits” instead of the term “poverty ratio” as currently used in Vietnam. In this study, the descriptive statistical method is applied with data collected from various sources, including the World Bank (WB), Asian Development Bank (ADB), International Monetary Fund (IFS-IMF), the Board of Governors of the US Federal Reserve, the US Chamber of Commerce, and the Ministry of Industry and Trade of Vietnam. Keywords: budget deficits, current account (balance) deficit, target economic quadrangle, target economic pentagon, twin deficits. 1 INTRODUCTION For many years, the term "target economic quadrangle" has been popularly used in Vietnam. It refers to a set of measurements to evaluate socio-economic development, with four (4) aspects: (i) Economic growth, (ii) Inflation, (iii) Unemployment, and (iv) International balance of payments. In the past few years, however, the budget deficit of Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 516 Asea Uninet Scientific and Plenary Meeting 2016 | 517 Vietnam has increased again (Figure 7) which is considered one of warning signs of economic instability. Some studies have shown that the financing of the budget deficit through monetary channels (i.e. the central bank’s lending to the government) will push inflation up and put more pressure on financial markets. The phrase "twin deficits", implying budget deficits and trade deficit occur simultaneously, has been increasingly popular in question in Vietnam and abroad. Meanwhile, according to some other authors, there is no relationship between budget deficits and current account deficit. With the study about the impact of the budget deficit to macroeconomic variables in general and the current account balance in particular, the author wishes to express personal views on the challenges facing the Government of Vietnam in balancing between budget targets with other important goals, particularly balancing the current account. In this article, the U.S. and Brazil were selected as case studies. Along with Mexico, Argentina, and Venezuela, Brazil was named to the debt crisis of the 1970s. For over a decade, the current account balance of this country was persistently in deficit while its foreign debt continued to increase (Figure 1). Meanwhile, the U.S. was famous for its "twin deficits" beginning from the early 1980s (Figure 2). These two countries were chosen with the author’s aim of finding out whether external debt is the result of prolonged current account deficit (in the case of Brazil ), or the local currency appreciation (in the case of the U.S.), or all were rooted from the budget deficit. Figure 1: Current account balance and foreign debt of Brazil (1972-1984) Current account (%GDP) Foreign debt/GNI (%) 0 -1 60 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 -2 -3 -4 -5 -6 -7 -8 -9 Source: International Financial Statistics and World Bank 50 40 30 20 10 0 518 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 2: Twin deficits of the U.S. (1971-1990) 0 1 0.5 -50,000 -100,000 1990 1989 1988 1987 1986 1985 1984 1983 1982 1981 1980 1979 1978 1977 1976 1975 1974 1973 1972 1971 0 -0.5 -1 -1.5 -150,000 -2 -2.5 -200,000 -3 -250,000 -3.5 Budget deficit (USD ml) Trade deficit (%GDP) Source: The U.S Government Publishing Office (GPO) & World Development Indicators (WDI) PART 1. HYPOTHESES, LITURATURE REVIEW AND RESEARCH METHODOLOGY 2 HYPOTHESES AND LITERATURE REVIEW Since the debt crisis of Latin American countries in the 1980s, there have been many studies about the relationship between budget deficit and macroeconomic indicators, especially inflation. Sargent (1981) demonstrated that under the deficit, the chance that inflation rises is inevitable, even in the case of a tightened monetary policy. Easterly (1993) also clearly evidenced that financing the budget deficit would trigger the inflation in the medium term. In studying the impact of budget deficits on the current account balance, the classic model theory of David Ricardo was taken as the starting point: Exports - Imports = National savings - Domestic investments (1) Of which: National savings = National budget + Savings of enterprises and the private sector (2) So: Current account balance = Budget + (Domestic savings - Domestic investments) (3) In other words: Current account deficit = Budget deficits + (Investments - Savings) (4) Two of the hypotheses set out on the pass-through channel of the budget deficit to macroeconomic variables in general and the current account in particular are as follows: Asea Uninet Scientific and Plenary Meeting 2016 | 519 Hypothesis 1: "Budget deficit leads to the soaring of foreign debt, high interest costs in the situation that the depreciation of the local currency negatively affects the current account balance. On the other hand, the scarcity of foreign currencies pushes their prices up, resulting on the higher cost of imports. In the context of insufficient exports, this will push the current account balance into deficit. "(Dorbusch 1984 Easterly 1993, Blecker 1999) Hypothesis 2: "The budget deficit is compensated in the form of domestic debt, pushing interest rates soaring. The appreciation of its currencies would cause damage to exports and the current account balance." (Easterly 1993) The debt crisis in Latin American countries was believed to be derived from external shocks such as oil prices and interest rates. However, the budget deficit and the imbalance of the exchange rates were, in fact, main causes of the problem (Dorbusch 1984). Especially, in the case of Brazil, the budget deficit was regarded as the cause of rising foreign debt. Dorbusch asserted the reversed effect of the exchange rate (devaluation) in countries with foreign debt: on the one hand it contributed to improvement of the current account balance, on the other hand it increased the national budget deficit. Referring to formula (4), however, Dorbusch did not clarify impacts of the budget deficit, on return, to the current account balance for the three selected nations which were chosen for case studies: Chile, Argentina, and Brazil. Selecting 10 developing countries including Argentina, Côte d'Ivoire, Chile, Colombia, Ghana, Morocco, Mexico, Pakistan, Thailand, and Zimbabwe, Schmidt-Hebbel & Easterly (1993) studied the relationship between fiscal policy and macroeconomic situation. Analyses of the authors have shown that in the medium term, financing budget deficit was the cause of high inflation in these countries. At the same time, the budget deficit created negative effects on the current account balance from 1980 to 1990 period. In "The Causes of the US Trade Deficit", Robert A. Blecker (1999) analyzed the underlying causes affecting the low national savings rate of this country, including the low level of market openness and the failure of domestic manufacturers in ensuring their competitive advantages. The cause of the US’s trade deficit in 1980s was the appreciation of the dollar as a result of (i) the country’s speculative bubble, (ii) the Latin American debt crisis, (iii) the slow economic growth in Europe, and (iv) the prolonged decline of competitiveness of the American. According to the author, "twin deficits", implying budget deficits and current account balance deficit occurring at the same time, existed in the US, but just right for the 1980-1985 period, and this is no longer true in the 1990s. Thomas Ziesmer (2005) focused on analyzing the impact of currency devaluation to the trade deficit and the budget deficit on the Brazilian case. In the period before 2005, the devaluation had caused more significant impacts to the trade balance than to the balance of budget. However, figures in 2005 showed that devaluation and the improvement of the budget deficit were helpless to restore the trade balance in this country. When the deficit was cut, interest rates tended to decline, the demand for investment and imports increased, intensifying the current trade deficit. In Vietnam, budget deficit has been received significant interest of researchers. With focus on analyzing the savings – investments spread in Vietnam, Nguyen Duc Thanh (2011) concluded the model of economic growth depending on expanding investment (including investment companies and investment by state- 520 | Asea Uninet Scientific and Plenary Meeting 2016 owned enterprises) are the cause of the budget deficit and consequently the current account deficit. In the context of low efficiency of State-owned enterprises, the private sector’s development has been delayed due to high interest rates, and investments have been mainly conducted through imports. In another article, Nguyen Van Dan (2014) analyzed impacts of budget deficits to the rise of interest rates, investment and import demand; and the decline in foreign exchange reserves which, thereby, negatively affected Vietnam’s trade balance. Besides, the fact that the budget deficits have lasted for many years was identified by the author as the source of a debt crisis in the future. It could be said that, the debate surrounding the question "Is there a causal relationship of the budget deficit to the trade deficit?" has not yet stopped and this needs to be further studied. 2.1 Research Methodology With data collected from various sources, including the World Bank (WB), Asian Development Bank (ADB), International Monetary Fund (IFS-IMF), the Board of Governors in the US Federal reserve, the US Chamber of Commerce, the US Treasury, the Bank of Brazil, the Ministry of Industry and Trade of Vietnam ..., the author conducts this analysis based on observations, argues, on the basis of which presents points of views about the above hypotheses together with the issue of budget deficit and deficit financing. PART 2. FINDINGS AND DISCUSSIONS 3 CASE STUDIES: BRAZIL AND THE UNITED STATES Figure 3 and 4 show the changes in the budget deficit and the current account balance of Brazil in the post-crisis period, especially in the periods of 1981-1990 and 1997-2004. The hypothesis of an existence of their positive relationship seemed to be in favor, despite a certain lag of the current account deficit compared with the budget deficit. This, however, was not true in the period 2004-2008, when the Brazilian ‘s economy saw an increase in the deficit together with the improvement of the current account balance and vice versa. Asea Uninet Scientific and Plenary Meeting 2016 | 521 Figure 3: Brazil’s budget and current account deficits (1981-1995) 4 2 0 1981 1982 1983 1984 1986 1987 1988 1990 1991 1992 1993 1994 -2 -4 -6 -8 -10 Current account (%GDP) Budget deficit (%GDP) Source: www.tradingeconomics.com (The Central Bank of Brazil) Figure 4: Brazil’s budget and current account deficits (1997-2012) 3 2 1 0 -1 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 -2 -3 -4 -5 Current account (%GDP) Budget defficit (%GDP) Source: www.tradingeconomics.com (The Central Bank of Brazil) In the case of the United States, Figure 5 shows that there was no relationship between the 2 factors: while the budget improved, the current account balance deficit plunged. However, from 2010 to date, the level of the budget deficit and the current account balance showed a downward trend, which implied to the need for further research in this issue. 522 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 5: Budget and current account deficits in the U.S. (2006-2014) 0 2006 2007 2008 2009 2010 2011 2012 2013 2014 -2 -4 -6 -8 -10 -12 -14 Current account (%GDP) Budget deficit (%GDP) Source: www.tradingeconomics.com (US Treasury and US Bureau of Economic Analysis) Turning back to the "twin deficits" of the U.S. economy in the period 1980-1987, observing Figure 6 we can see, the strong appreciation of the dollar, derived from speculation and Latin American debt crisis, is the direct cause of the deep current account deficit in this period. 0 160 -0.5 140 120 -1 100 -1.5 80 -2 60 -2.5 40 -3 USD Index (1973=100) Current account (%GDP) Figure 6: Current account balance and the US dollar index (1980-1990) 20 -3.5 0 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 Current account (%GDP) USD Index (1973=100) Source: Board of Governors of The Federal Reserve System (US) Thus, impacts of the budget deficit on the current account deficit in both Brazil and the United States were unclear. Does this relationship exist or not in Vietnam? 3.1 Analysis of Vietnam’s budget and current account deficits According to Figure 7, during the period of 1996-2014, there was no close relationship between the budget deficit and the current account deficit. Especially, from 2007 to 2012, while the budget deficit suffered from an upward trend, the Vietnamese economy experienced strong recovery of the current account balance, although this recovery has been Asea Uninet Scientific and Plenary Meeting 2016 | 523 slow recently. However, is it too early to conclude that the current account deficit cannot be affected by the budget deficit? Figure 7: Vietnam’s budget and current account deficits (1996-2014) 8.0 6.0 4.0 2.0 0.0 -2.0 -4.0 -6.0 -8.0 -10.0 -12.0 Current account (%GDP) Budget deficit (% GDP) Source: Asian Development Bank (ADB) According to the first hypothesis, as mentioned above, one of the channel which conveys impacts of the budget to the current account balance is foreign debts, because interest payments are recorded into the current account balance. Figure 8 shows that Vietnam’s of foreign debts were always lower than that of other regional countries for a long period, especially when compared to Philippines and Indonesia. However, the numbers grew up dramatically during 2009-2012. Figure 8: Foreign debts/GNI of 5 ASEAN countries (1996-2014) Vietnam Philippines Source: Asian Development Bank (ADB) Thailand Indonexia Malaysia 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 180.0 160.0 140.0 120.0 100.0 80.0 60.0 40.0 20.0 0.0 524 | Asea Uninet Scientific and Plenary Meeting 2016 2.0 100.0 1.0 0.0 80.0 -1.0 60.0 -2.0 40.0 -3.0 Budget deficit (% GDP) 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 -5.0 1999 0.0 1998 -4.0 1997 20.0 BUDGET DEFICIT (% GDP) 120.0 1996 FOREIGN DEBTS (% GNI) Figure 9: Vietnam’s budget deficits and foreign debts (1996-2014) Foreign debts (%GNI) Source: Asian Development Bank (ADB) Figure 9 reflects the positive impacts of budget deficit to foreign debts of Vietnam in the 2001-2009 period, meaning the improvements of the national budget also went together with the lower dependence on foreign debts. After that, when the deep budget deficit appeared in 2009, foreign debts started to increase. However, during 2009-2012, when the foreign debts had an upward trend again, this relationship did not show off clearly. Foreign debts (% GNI) 120.0 8.0 6.0 4.0 2.0 0.0 -2.0 -4.0 -6.0 -8.0 -10.0 -12.0 100.0 80.0 60.0 40.0 20.0 Current account (%GDP) 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 0.0 Current account (% GDP) Figure 10: Vietnam’s foreign debts and current account (1996-2014) Foreign debt (%GNI) Source: Asian Development Bank (ADB) Considering the correlation between foreign debts and current account balance in Figure 10, we can see that the deep current account deficit during 2006-2008 was not the consequent result of budget deficit through foreign debts channel. It would be more reasonable if we consider it through the inflation channel, when the currency supply took approximately 50% in 2007 (Figure 11), and the inflation grew to 20% in 2008 (Sources: ADB and The State Bank of Vietnam) Asea Uninet Scientific and Plenary Meeting 2016 | 525 Figure 11: Vietnam’s budget deficit, money supply growth, and interest rates (19962014) 80 70 60 50 40 30 20 10 0 -10 -20 2.0 0.0 -1.0 -2.0 -3.0 Budget deficit 1.0 -4.0 -5.0 Budget deficit (% GDP) Money supply growth (%/yr) Interest rate (%/yr) Current account (%GDP) Source: Asian Development Bank (ADB) In 2009, the budget deficit and foreign debts started increasing sharply. However, the current account balance improved much better. This could be explained as following: foreign debts of 2009-2012 had not met the maturity date, or else the interest payment was not much (Figure 12). At the same time, Vietnam’s trade was taking advantages of the stability of exchange rate. Clearly, the situation of Vietnam in 2005-2014 could not provide enough evidences to convince hypothesis 1 which announces that the impact of budget deficit on the current account balance is through foreign debts. Figure 12: Vietnam’s current account and interest payments of foreign debts 12000 10000 8000 6000 4000 2000 0 -2000 -4000 -6000 -8000 -10000 -12000 2005 2008 2009 Current account (USD ml) Source: World Bank 2010 2011 2012 Interest payments (USD ml) 2013 526 | Asea Uninet Scientific and Plenary Meeting 2016 Regarding impacts of budget deficit to interest rates, as followed in Figure 11, looking at the period 1998-2003, it appears that when the deficit started to rise in 1998, the money supply also went up immediately (1999), then the current account became worse. In contrast, the interest rates witnessed a down trend. In 2009, when the budget deficit improved, the current account balance also recovered, the money supply decreased, although interest rates increased highly again. Until 2012, the budget deficit grew steadily, the current account balance started to show unstable, the money supply and interest rates continued to fall down. Obviously, the above analysis does not support the hypothesis: budget deficit does affect the current account balance through interest rate channel. The reasons could be explained as following: (i) the inflexibility of interest rates in Vietnam, and (ii) funding the budget deficit has been applied through the currency channel (1999 and 2007 - Figure 11), directly pressuring on inflation. PART 3. CONCLUSIONS AND SUGGESTIONS From the above observations and analysis, it may be concluded that unsustainability of Vietnam’s current account balance should not be blamed for only budget deficit. There have not been enough evidences that interest rates and foreign debt are channels which convey the impact of the budget deficit to the current account. With an overview of the three countries, it is necessary to reconsider the equation (4), especially attention should be paid to the changes of two components, i.e. Savings and Internal Investment. Vietnam should not depend on "devaluation" due to its sided nature with high possibility of negative effect "imported inflation" overwhelming the positive influence "export competitiveness" (Hoang, T.L.H (2013)). As shown in Figure 13, during 15 years from 1996 to 2010, the economy witnessed an obvious imbalance in the proportion of domestic savings and investments, with the latter always exceeding the former. After 2010, however, the two items has been turning into balance. Figure 13: Vietnam’s domestic savings and investments 40 30 20 10 0 -10 199619971998199920002001200220032004200520062007200820092010201120122013 -20 -30 -40 -50 Gross domestic savings (% GDP) Source: Asian Development Bank (ADB) Gross domestic investments (% GDP) Asea Uninet Scientific and Plenary Meeting 2016 | 527 With reference to the government spending structure (Figure 14), it is admitted that a great proportion of approximately 70-80% of expenditure for development investment is reasonable in the case of a developing country like Vietnam. With limited capital resources, however, how to fund this urgent need to develop the country is still a big question for the Vietnamese government. Figure 14: Vietnamese government spending structure 100 90 80 70 60 50 40 30 20 10 0 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 Current expenditure (%) Development investment expenditure (%) Source: Asian Development Bank (ADB) According to Figure 15, both domestic and foreign borrowings have been increasing sharply in current years, with the latter one exceeding the former. The issue of whether financing the budget deficit through monetary channel or foreign debt, therefore, should be carefully considered, since it could threaten the domestic currency’s and current account’s stability, as the domestic currency declines and loans mature. Figure 15: Vietnamese government expenditure’s financing 40000 30000 20000 10000 0 -10000 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Overall budgetary surplus/deficit (million USD) Domestic borrowing (million USD) Foreign borrowing (million USD) Source: Asian Development Bank (ADB) 528 | Asea Uninet Scientific and Plenary Meeting 2016 It can be said that with all of the above findings and discussions, "budget deficit" should become the fifth top of Vietnam’s “target economic pentagon”. The overall picture reflecting five important indicators of Vietnam’s economy in the past 20 years is showed in Figure 16. Its “pentagon” of each five-year period from 1996 is shown in Figures 17-20. In the period 1996-2000 and 2000-2005, the average deficit level of both current account balance and budget were almost equal (approximately 2% of GDP) with other factors such as growth, inflation, and unemployment being fairly good. Figure 16. Vietnam economy 1996-2014 25.0 20.0 15.0 10.0 5.0 0.0 -5.0 -10.0 -15.0 Current account (%GDP) Budget deficit (% GDP) GDP Growth (%) Inflation (%/năm) Unemployment (%/năm) Source: Asian Development Bank (ADB) Asea Uninet Scientific and Plenary Meeting 2016 Figure 17. Vietnam’s Economic Pentagon 1996-2000 1995-2000 Budget deficit (% GDP) Current account (%GDP) 10 8 6 4 2 0 -2 -4 Unemployment (%/năm) GDP Growth (%) Inflation (%/năm) Source: Asian Development Bank (ADB) Figure 18. Vietnam’s Economic Pentagon 2001-2005 2001-2005 Budget deficit (% GDP) Current account (%GDP) 10 8 6 4 2 0 -2 -4 Unemployment (%/năm) Source: Asian Development Bank (ADB) GDP Growth (%) Inflation (%/năm) | 529 530 | Asea Uninet Scientific and Plenary Meeting 2016 For the period of 2006-2010, the shape of the "pentagon" has changed, with the deep deficit of the current account balance and at the same time an increasing inflationary burden. This was an extremely difficult period of Vietnam economy. However, the budget deficit itself should not be blamed for this economic instability, as in the first 3 years (2006, 2007, 2008) this deficit was quite low. Figure 19. Vietnam’s Economic Pentagon 2006-2010 2006-2010 Budget deficit (% GDP) Current account (%GDP) 10 8 6 4 2 0 -2 -4 Unemployment (%/năm) GDP Growth (%) Inflation (%/năm) Source: Asian Development Bank (ADB) Figure 20 shows positive sign of the Vietnam economy with the current account surplus exceeding the budget deficit. Asea Uninet Scientific and Plenary Meeting 2016 | 531 Figure 20. Vietnam’s Economic Pentagon 2011-2014 Current account (%GDP) 10 8 6 4 2 0 -2 -4 Budget deficit (% GDP) Unemployment (%/yr) GDP growth (%/yr) Inflation (%/yr) Source: Asian Development Bank (ADB) However, whether the current account surplus is truly sustainable or not is still questionable. In particular, the recovery of the current account is showing signs of slowing down, while the trade deficit, by the end of the first half of 2015, has returned after three years of surplus (Figure 21). If this continues, reconsideration of the relationship between budget deficits and current account deficits, which identifies a risk of twin deficits in Vietnam, is extremely necessary. Figure 21: Vietnam’s Trade Balance (2014-2015) 20000 15000 10000 5000 0 2014M11 2014M12 2015M1 2015M2 2015M3 2015M4 2015M5 2015M6 -5000 -10000 Exports (USD ml) Imports (USD ml) Source: International Financial Statistics (IFS) Trade balance (USD ml) 532 | Asea Uninet Scientific and Plenary Meeting 2016 REFERENCES Barro, Robert J. (1989), “The Ricardian Approach to Budget Deficits”, The Journal of Economic Perspective, Vol.3, No.2, 37-54 Blecker, Robert A. (1999), “The Causes of the U.S. Trade Deficit”, Trade Deficit Review Commission Dorbusch, R. (1984), “External Debt, Budget Deficit and Exchange Rates Disequilibrium”, National Bureau of Economic Research Working Paper Series, No.1336 Easterly, William & Klaus Schmidt-Hebbel (1993), “Fiscal Deficits and Macroeconomic Performance in Developing Countries”, The World Bank Research Observer, Vol.8, No. 2, pp. 211-237 Helkie, William L. & Peter Hooper (1987), “An Empirical Analysis of the External Deficit”, International Finance Discussion Papers, No. 304 Hoang, T.L.H (2013), “Improving Exchange Rate Policy in Vietnam in 2010-2020”, PhD. Thesis, National Economics University Nguyen, Duc Thanh (2011), "From the Economic Growth Pattern of Relying on Public Investment to Accumulative Macroeconomic Risks in Vietnam" (Vietnamese version), Vietnam Center for Economic and Policy Research. Nguyen Van Dan (2014), “Twin Deficits in Vietnam and Implications”, Worldwide Economic and Political Issues (Vietnamese version), Vol. 7 (219), pp. 64-71 Sargent, Thomas J. & Neil Wallace (1981), “Some Unpleasant Monetarist Arithmetic”, Quarterly Review, Federal Reserve Bank of Minneapolis Ziesemer, Thomas (2005), “How to cure the trade balance? Reducing budget deficits versus devaluations in the presence of J- and W-curves for Brazil”, No.019, Maastricht Economic Research on Innovation and Technology DOES INFORMATION DISCLOSURE AND TRANSPARENCY MATTER TO PERFORMANCE OF LISTED FIRMS IN VIETNAM? Le Quang Canh canh@neu.edu.vn* National Economics University, Vietnam Nguyen Vu Hung nguyen.vdh@gmail.com National Economics University, Vietnam Abstract Information disclosure and transparency is one of the key pillars of corporate governance, and it is widely used to evaluate governance of each enterprise. Both theoretical and empirical studies confirm that governance would closely associate with performance of firms. This paper investigates whether information disclosure and transparency matters to performance of listed firms in Vietnam, with a focus on quality of information disclosed. Applied regression techniques in a sample of 354 firms listed in the Hanoi Stock Exchange, empirical results show that more information disclosure associated with lower firm performance proxied by ROA and Tobin Q, but timeliness and accessibility of information disclosure strongly associates with better performance of sampled firms. This research contributes to the literature by adding new empirical evidence and unique explanations of reversed relationship between information disclosure and performance of firms, and confirming the importance of timeliness and accessibility aspects of information disclosure on performance of the listed firms in Vietnam. Keywords: Disclosure and transparency, corporate governance, firm performance, Vietnam 1 INTRODUCTION Information disclosure and transparency is one of the key pillars of corporate governance, and it is widely used to evaluate governance of each enterprise. OECD (2004) developed the principles of corporate governance in which enterprises should disclose information timely, reliably, and accessibly on governance-related issues, including financial reporting situation, operating process, ownership structure, and board and management structures. The lacks and low standards of disclosure and transparency would lead to financial scandals implicitly in each enterprise, and the collapse of big corporations in recent years such as Enrol, Xerox, Tyco and WorldCom,… is vivid evidence for the consequences of poor quality of information disclosures and transparency on their corporate governance. It is necessary to improve information disclosure and transparency on corporate governance in order to effectively prevent the similar incidents that would occur in the future. Information disclosures and transparency of enterprises have impacts on behaviors of agents in the market. It would help investors and lenders allocating resources more efficiently, reducing capital costs, and ensuring stakeholders to use their rights more Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 533 534 | Asea Uninet Scientific and Plenary Meeting 2016 effectively. Moreover, more information disclosure also helps the public understanding operation of enterprises, development strategy and policies, performance, ethical standards, and relationship with its stakeholders that make business environment more transparent and encourage the firm going towards sustainable development. In this sense, more information disclosure contributes to better performance of firms. In the opposite side, too much information disclosed may cause negative effects. According to Banerjee, Masulis and Pal (2014), once too much information disclosed relatively to the rivals, it would be helpful to them in mitigating competitive advantages, reducing market share, profitability, and market values of disclosed firms. If there is a lack of information disclosure and transparency due to conflict of interest between shareholders and managers, policies on requirement of high quality of disclosure and transparency would be issued. Those policies can result in behaviors that protect interest and benefits of managers, and eventually it can negatively affect firm performance and market values of firms (Banerjee and Masulis, 2013). Information disclosure and transparency has two opposite effects on performance of firms. This net effect can be positive, negative, or neutral depending which kind of effects is dominant. A question naturally raised here is whether more information disclosure and transparency associates with better firm performance in Vietnam. Using the information disclosure and transparency scorecard conducted by Hanoi Stock Exchange based on methodology suggested by IFC-SSC and GCGF (2012) and research results of Nafosted II 5.2-2012-03, this study investigates effects of information disclosure and transparency on performance of listed firms. It also estimates and evaluates importance of timeliness and accessibility aspects of information disclosure on performance of listed firms. Estimated results show that, in the context of mandatory disclosure applied on listed firms in Vietnam, more information disclosure associates with lower performance which is proxied by ROA and Tobin Q. Empirical results also suggests the importance of timeliness and accessibility aspects of information disclosure on performance. This research contributes to the literature by adding new empirical evidence of reversed relationship between information disclosure and performance, and confirming the importance of timeliness and accessibility aspects of information disclosure on performance of the listed firms in Vietnam. Following this introduction, section 2 provides an overview of literature on information disclosure and transparency, impacts of disclosure on performance. In section 3, data collection and description, estimated models are described. Section 4 presents estimated results and discusses their implications. Section 5 concludes the paper. 2 LITERATURE REVIEW Investigating effects of corporate governance on firm performance has been attracted much attention of scholars, researchers, and managers. Previous studies usually use different measures of corporate governance for different aspects ranging from mandatory requirements to voluntary contributes of good corporate governance practice to investigate this relationship. By using the agency theory and institutional theory, the previous studies find that the corporate governance has mixed effects on performance of firms (e.g. Bhagat, Sanjai and Black, 2002; Edward and Clough, 2005; Bhagat and Black, 2008; Le, Luong, and Vu 2015). Information disclosure and transparency is an important contribute of corporate governance, especially for investors when they easily have enough information on structural organization, ownership structures, control and management, financial situation, and operating process. More information disclosed would help allocation of Asea Uninet Scientific and Plenary Meeting 2016 | 535 resources more efficient, reducing capital costs and promoting more transparent managerial decisions. Information disclosure and transparency is generally understood as the widespread availability of reliable and relevant information on governance and related aspects of firms to the publicity. According to the OECD (2004), information disclosure should meet the key criteria such as truthiness, timeliness, and accessibility. From the firm perspective, information disclosure includes two different levels: mandatory requirements of the current laws on information disclosure and transparency and applications of voluntary information disclosure standards from the best practice of corporate governance. Disclosure includes information availability of many perspectives. For example, OCED (2004) emphasizes on financial reporting availability, operating process, ownership structures, and corporate governance; Patel and Dallas (2002) mentions disclosure on ownership structures and rights of shareholders, financial disclosure and transparency, structures and corporate governance of the firms; or Banerjee, Masulis and Pal (2014) considers disclosure on financial accounting, operation, ownership structures and rights of shareholders, and structures of board of directors and managers. In the previous studies on effects of information disclosure and transparency on performance of firms, variables of information disclosure and transparency are usually proxied by information disclosure and transparency index/scores (see more in Patel and Dallas, 2002; Banerjee, Masulis and Pal, 2014; Zaman and et al., 2015) or some other aspects contributed to disclosure and transparency index, in which two sub-components mostly used are disclosure on ownership structures and financial reporting disclosure and transparency. Information disclosure and transparency has mixed effects on firm performance. Many studies have found the more information disclosure the better performance of firms will be. Patel and Dallas (2002), a pioneer study on this topic, finds that more information disclosed helps reducing capital costs and increasing performance of firms. This empirical result has been shared by many others (e.g. Gompers et al., 2003; Collett and Hrasky, 2005; Istridis, 2008; Stiglbauer, 2010). The previous studies also find information disclosure has a reverse effect on performance of firms, meaning that the more information disclosed the lower performance is. For example, Bassen et al. (2009) suggests that a firm with higher level of information disclosed associates with the worse performance of firms in Germany; Zaman, Arslan and Siddiqui (2015) provides evidence that disclosure on ownership structure of a firm has a reversed relationship with rate of return to total assets and rate of return to equity in the Pakistani firms; Banerjee, Masulis and Pal (2014) reveals a negative relationship between disclosure and transparency with performance of firms in Russia. Literature also documents some studies that do not find any statistically significant relationship between disclosure and performance of firms (e.g. Habib, 2008; Sharif and Lai, 2015). Thus, impacts of information disclosure on performance of firms are mixed depending on variables proxied for measurement of disclosure and performance as well as institutional aspect of each country. In the transitional period and the first stage of applying corporate governance, a natural question raised is whether information disclosure and transparency increases performance of firms in Vietnam. This paper also goes further to investigate the role of timeliness and accessibility aspects of information disclosure in order to fully understand how disclosure and transparency affects performance of listed firms in Vietnam. 536 | Asea Uninet Scientific and Plenary Meeting 2016 3 3.1 ANALYTICAL FRAMEWORK, DATA AND METHODS Analytical framework The agency theory predicts that information asymmetry between shareholders/owners and managers can lead to moral hazard actions and conflicts of interest. Information asymmetry results in an increase in agency costs, capital costs, and a decrease in profits and market values of the firms. Disclosure and transparency helps reducing those costs and increasing profits of firms through providing necessary information for allocating investment, monitoring actions of agency, and reducing costs of information asymmetry (Bushman and Smith, 2003). In the context of a transitional economy and initial stage of implementing corporate governance, toot much information disclosure can relatively decrease comparative advantage of the disclosed firms, significantly increase the costs of disclosing information and transparency, and reduce attractiveness of firms in the short run once bad corporate governance or operating process is disclosed (see more in Stiglbauer, 2010). In the light of institutional theory, requirements on disclosure and transparency would impose costs on disclosed firms resulting in higher transaction costs; therefore, the firms tends to evade running good corporate governance. This would result in bad economic outcome of firms in the long-run. In addition, information disclosure is not only about disclosing subjective and targeted information to the publicity but also ensuring truthfulness, timeliness and accessibility as suggested in OECD (2004). Studying effects of information disclosure and transparency would consider the importance of timeliness and accessibility aspects of disclosure. Thus, analytical framework of this paper can be described as following. Figure 6: Analytical framework Benefits Disclosure& transparenc y Timeliness/ accessibility Performance Costs As above arguments, impacts of information disclosure and transparency on performance of firms can be positive, negative or neutral depending on benefits and costs imposed on disclosure and transparency activities. This paper is further to investigate importance of timeliness and accessibility aspects of information disclosure on measuring effects of information disclosure on performance of firms based on a hypothesis that timeliness positively associates with firm performance. Asea Uninet Scientific and Plenary Meeting 2016 3.2 | 537 Data and variables A research sample consists of 354 enterprises listed in the Hanoi Stock Exchange46. Data used in this paper have been widely published on mass media, following the current requirements. Data on information disclosure scores were conducted and published by HNX (2015), and in this paper, they are adapted from sub-component D in the principles of corporate governance of OECD (2004). These scores are calculated following the methodology guided by IFC-SSC and GCGF (2012). Based on information disclosure and transparency scores evaluated by HNX (2015), the information disclosure and transparency scores are divided into three sub-components: scores of disclosure and transparency, scores of measuring timeliness, and scores measuring accessibility. To understand how the disclosure and transparency scores are computed, audience can refer to IFC-SSC and GCGF (2012) and HNX (2015). Other variables in the estimated models are collected from the 2014 Annual reports of the listed enterprises under the research project of Nafosted II 5.2-2012-03. The variables used in this paper are defined as in the Table 1, and their statistical description is presented in the Annex 1. Table 1: Definition of variables used in the estimated models Variables Definitions Firm performance variables ROA Return on total assets After tax profits divides by total assets TOBINQ Tobin Q ratio Market values of firm divides by total assets Variables measuring disclosure and transparency CBTT Disclosure & Disclosure & transparency scores calculated by transparency scores HNX based on methodology suggested by IFCSSC and GCGF (2012) KTHOI Timeliness of Calculated by HNX (2015) on methodology information suggested by IFC-SSC and GCGF (2012) and disclosure requirements of the Circular 52/2012/TT-BTC. It equals 1 if all 10 items required are disclosed timely; and 0 if one of ten does not meet the requirements PBIEN Accessibility of Calculated by HNX (2015) on methodology information suggested by IFC-SSC and GCGF (2012) and disclosure requirements of the Circular 52/2012/TT-BTC. It equals 1 if an enterprise has its total accessibility score larger than the average level, and 0 if its total accessibility scores smaller than the average level. Other variables SIZE Size of firms Measured by numbers of labor according to the Decree 56/2009/NĐ-CP SHNNg Having foreign It equals 1 if a firm has foreign ownership ownership regardless how much it is, and 0 if not. 46 That is number of firms listed in Hanoi Stock Exchange on March 31, 2014. Enterprises listed after this day were not used to evaluate information disclosure and transparency scores conducted by Hanoi Stock Exchange in 2015 (see more HNX, 2015). 538 | Asea Uninet Scientific and Plenary Meeting 2016 LEV SNNY NNCC 3.3 Ratio of debt by total assets Years listed in the Hanoi Stock Exchange High corruption risk industry Total debts divided by total assets Measured by time a firm has been listed in the HNX to the end of 2014. It refers to research results of World Bank (2012) and CECODES, VFF-CRT & UNDP (2015) Estimated results In order to measure impacts of disclosure and transparency on performance of firms, this paper uses a standard estimated model as: 𝑌 = 𝛼 + 𝑋𝛽 + 𝑍𝛾 + 𝜃𝐷 + 𝜖, in which, Y is dependent variables proxied by ROA and Tobin Q, X is a vector of interested variables measuring information disclosure and transparency, Z includes control variables measuring characteristics of firms, D is an interaction term between disclosure scores and timeliness or disclosure scores and accessibility, and 𝜖 is error terms. This paper uses OLS estimation technique to estimate impacts of information disclosure and transparency scores on ROA and Tobin Q of listed firms. In the estimated models, the roles of timeliness and accessibility on measuring the effects of disclosure on performance are also investigated. Estimated results are presented in the next section. 4 EMPIRICAL RESULTS Before estimating the impacts of disclosure and transparency on performance, multicolinearity test is conducted. The full Pearson correlation results are presented in the annex 2. Sufficiently small Pearson correlation and VIF imply no high multicolinearity among the independent variables used in the estimated models. In order to get into objectives of the paper, there are two estimated models are applied. Models (1) has dependent variables are ROA and Tobin Q, while independent variables include disclosure and transparency scores, interaction terms of D&T scores with timeliness, and other control variables. Model (2) also includes dependent variables as ROA and Tobin Q, while independent variables consist of D&T scores, interaction terms of accessibility with D&T scores, and other control variables. Note that disclosure and transparency scores in the two models are different. Disclosure scores in the model (1) is obtained by subtracting total disclosure and transparency scores by scores of 10 items measuring timeliness, while disclosure scores in the model (2) is obtained by subtracting total disclosure and transparency scores by scores of 8 items measuring accessibility aspect of information disclosure (HNX, 2015). Estimated results are in the Table 2. Table 2: Estimated results on impacts of information disclosure on performance of listed firms Model (1) D&T1 ROA Tobin Q -0.0044** -0.0515** D&T2 Timeliness -0.1165* -1.7311*** Model (2) ROA Tobin Q -0.0039* -0.0337* Asea Uninet Scientific and Plenary Meeting 2016 D&T1 * timeliness 0.0039** | 539 0.0518*** Accessibility -0.0986 -1.1255* D&T2*accessibility 0.0018 0.0265* Having foreign ownership 0.0222 -0.0241 0.0288 -0.0332 Years of listing -0.0044 -0.0374 -0.0023 -0.0350 High corruption risk industry 0.0157 -0.2669* 0.0031 -0.2843* Ratio of debt/total assets -0.1044*** -0.5747** -0.0610** -0.4658* Mandatory D&T scores 0.0032* 0.0005 0.0048*** 0.0033 Enterprise size Yes Yes Yes Yes Constant Yes Yes Yes Yes Observations 354 354 354 354 0.2522 0.2699 0.2955 0.2520 R-squared Note: *, **, and *** show statistically significant at 10%, 5% and 1%, respectively. Estimated results suggest a negative relationship between information disclosure and return on asset in the studied sample of listed firms in the Hanoi Stock Exchange. It means that the more information disclosure the lower ROA and Tobin Q will be, with the significant level of those coefficients is 5% for model (1) and 10% in the model (2). These empirical results are similar conclusion of previous studies (e.g. Goetzmann et al., 2004; Black et al., 2006; Bassen et al., 2009; Banerjee, Masulis and Pal, 2014; Zaman, Arslan and Siddiqui, 2015). Thus, information disclosure does not help increasing performance of the firms but reducing returns on assets (ROA) and market value of listed firms (Tobin Q). This estimated result can be explained by three main reasons in the context of listing firms in Vietnam. Firstly, requirements on information disclosure and transparency are a financial burden of firms, especially for small and medium size enterprises and firms that have not had any exports. Information disclosure increases the reporting and disclosing costs, while most of listed firm believe that they are running well with the current ownership structures. Secondly, disclosed information can mitigate competitive advantage of the disclosed firms relatively to their rivals because some disclosed information may reveal development strategy or business plans to the rivals. Under the light of the game theory, the rivals will take advantage of disclosed information to move their actions that accelerate competitive advantage against disclosed firms. This prediction seems to be relevant in the context of corporate governance and institutional issues in Vietnam (Nguyen Vu Hung and Le Quang Canh, 2015). Thirdly, information disclosure by the firms would be considered as an inflation of financial results and unreliable accounting data, especially in transitional economies (Banerjee, Masulis and Pal, 2014), but the market was pretty well to recognize. As a result, market values of firms would not be much positively affected. 540 | Asea Uninet Scientific and Plenary Meeting 2016 Figure 7: Roles of timeliness and accesability on the effects of disclosure on performance of listed firms Next, the paper investigates the roles of timeliness aspect of information disclosure on effects of disclosure and transparency on performance by focusing on interaction term of D&T1 with timeliness. Empirical results show that estimated coefficient is statistically significant at 10% for ROA and 1% for Tobin Q. These results imply the importance of timeliness aspect of information disclosure on estimating effects of information disclosure on performance. Figure 2a shows a shift from negative to positive effects while information disclosure moves towards timeliness, which suggests the importance of timeliness in the relation between information disclosure and ROA. The similar results are also found a shifting from negative to positive impacts of timeliness on the effects of disclosure on the Tobin Q ratio, even the magnitude of the effect is relatively small in Figure 2b. To investigate roles of accessibility aspect of information disclosure, model (2) replaces a variable measuring accessibility instead of timeliness in the model (1). Estimated results imply that partial importance of accessibility aspect of information disclosure on measuring effects of disclosure and transparence on ROA and Tobin Q of the listed firms. For the performance proxied by ROA, a positive estimated coefficient but not statistically significant, even at 10% level, means that accessibility is not statistically important for measuring effects of information disclosure on ROA of the sampled firms. When using Tobin Q as a proxy of performance, empirical results finds a statistically significant coefficient at 10% level. It implies that accessibility aspect of disclosure is significant for measuring effects of information disclosure on Tobin Q ratio of the sample firms. However, as presented in the Figure 2d, the important magnitude of accessibility on effects of disclosure on Tobin Q is not much (showing by near-zero slopes in the Figure 2d). In this sense, accessibility aspect of information disclosure has partial effects on investment Asea Uninet Scientific and Plenary Meeting 2016 | 541 decisions in the stock market rather than effects on performance measured by financial indicators. Besides, another interested estimated result is effects of institutional aspect of each industry that a firm is belonged. Estimated result shows that a high corruption risk industry is associated with a lower Tobin Q ratio, but is not related to ROA of the listed firms 47. This issue is saved to further investigate in another paper (see more in Nguyen et al. forthcoming). 5 CONCLUSIONS Information disclosure and transparency is a key pillar of corporate governance. Information disclosure is strongly associated with performance of firms. In the empirical studies, effects of information disclosure on performance of firms are mixed, including positive, negative, and neutral depending on many reasons such as institutions, corporate governance, and other related issues (Banerjee, Masulis, 2013; Banerjee, Masulis and Pal, 2014). This paper investigates effects of information disclosure on ROA and Tobin Q of the listed firms in Vietnam with a further focus on importance of timeliness and accessibility. Using a research sample of 354 listed enterprises on the Hanoi Stock Exchange in 2014 and data collected under the research project Nafosted II 5.2-2012-03, this paper suggests that the more information disclosure is associated with the worse performance of listed firm proxied by ROA and Tobin Q. However, if information is disclosed timely, it would help to positively increase the effects of information disclosure on ROA and Tobin Q, while accessibility is significant for increasing the market values of the listed firms only. These empirical results contribute to the literature by providing empirical evidence on effects of information disclosure and transparency on performance and the importance of timeliness and accessibility aspects of information disclosure on measuring effects of disclosure and transparency on performance of the listed firms in Vietnam. These empirical results also suggest some implications as followings: Firstly, costs of financial reporting and disclosing as requirements may be a burden, especially for the small and medium size enterprises listing in the stock markets. It can be a possible reason explaining for the negative effects of information disclosure on performance of those firms. This empirical result naturally raises an issue on actively disclosing requirements towards voluntary disclosing and the best corporate governance practice of the listed firms. Secondly, timely and accessible information disclosure would be regulated rather than mandatory information disclosure in general. The empirical result does not imply that the listed firms do not have to disclose information as required by the principles of corporate governance and the current regulations. Instead, they should focus on disclosing information timely and accessibly to the publicity that would bring positive effects of information disclosure on performance of listed firms in the context of a transitional economy in Vietnam. 47 According to the World Bank (2012) and CECODES, VFF-CRT & UNDP (2015), high corruption risk industries include many sectors/industries. In this paper, two most corruptive industries selected are mining and construction. This variable is exogenous form the estimated models. 542 | Asea Uninet Scientific and Plenary Meeting 2016 Thirdly, more concentration on governance monitoring and controlling in the listed firms in Vietnam is needed. Mandatory requirements on disclosure and transparency may lead to adverse actions to protect benefits of managers. Information disclosure leads to conflict of interest between shareholders/owners and managers. It results in actions that protect interests of managers rather than benefits of public/small shareholders. Fourthly, listing in the Stock market is good for better corporate governance and real value of firms. The strongly negative relationship between disclosure and performance implies that unreliable accounting numbers in Vietnam was pretty well recognized by the Stock market. As a result, market values of firms would not be able much positively affected even more information was disclosed. Stock market will be a good filter for better firm performance in the long-run. Although this study focuses on the case of Vietnam, the empirical results provides good evidence on the relationship between information disclosure and performance of firm. It also has wider implications beyond the country, especially in a transitional economy with infancy of corporate governance applied. REFERENCES Banerjee, S., Masulis, R. (2013). Ownership, investment and governance: The costs and benefits of dual class shares, Nanyang Business School Bhagat, S., Black, B. (2002) The non-correlation between board independence and long term firm performance. Journal of Corporation Law. 27. p. 231–274. Bhagat, S., Bolton, B. (2008) Corporate governance and firm performance. Journal of Corporate Finance. 14. p. 257–273. Black, B., Love, I., Rachinsky, A. (2006) Corporate governance indices and firms’ market values: Time series evidence from Russia. Emerging Markets Review. 7 (4). p. 361–379. CECODES, VFF-CRT & UNDP (2015). Chi so Hieu qua quan tri va hanh chinh cong cap tinh o Viet Nam (PAPI) 2014: Do luong tu kinh nghiem thuc tien cua nguoi dan. Bao cao nghien cuu chinh sach chung cua CECODES, VFF-CRT, va UNDP, Ha Noi, Viet Nam Collett, T., Hrasky, S. (2005) Voluntary disclosure of corporate governance practices by listed Australian companies. Corporate Governance: An International Review. 13(2). p. 188-196. Edward, M. & Clough R. (2005) Corporate governance and performance: An exploration of the connection in a public sector context. Issues Series Paper. 1 Goetzmann, W. N., Spiegel, M., Ukhov, A. (2003). Modeling and measuring Russian corporate governance: The case of Russian preferred common shares. NBER Working Paper No.9469 Gompers, P.A., J.L. Ishii, & Metrick. A. (2003). Corporate governance and equity prices. Quarterly Journal of Economics. 118(1). p. 107–155. Habib, A. (2008) Corporate transparency, financial development and the allocation of capital. Abacus. 44(1). p. 1-21. HNX (2015). Bao cao cong bo thong tin va minh bach cho cac doanh nghiep niem yet tren So giao dich chung khoan Ha noi nam 2015, Tai lieu luu hanh noi bo Iatridis, G. (2008) Accounting disclosure and firms' financial attributes: Evidence from the UK stock market. International Review of Financial Analysis. 17(2). p. 219-241. IFC-SSC and GCGF (2012). Bao cao The điem Quan tri Cong ty 2012, To chuc Tai chinh Quoc te, Washington, DC 20433, Hoa Ky Asea Uninet Scientific and Plenary Meeting 2016 | 543 Le Quang Canh, Nguyen Thai Bao and Nguyen Vu Hung (2015). Quan tri voi ket qua hoat đong cua cac doanh nghiep tu nhan lon o Viet Nam, Tap chi Kinh te & Phat trien, 215, p.10-19 Nguyen, V. T., Ho, D. B., Le, Q. C., & Nguyen, V. H. (forthcoming). Strategic and transactional costs of corruption: Perspectives from Vietnamese firms Patel, S. Dallas, G. (2002). Transparency and disclosure: Overview of methodology and study results-United States, Standard & Poor Stiglbauer, M. (2010). Transparency and disclosure on corporate governance as a key factor of companies’ success: a simultaneous equations analysis for Germany, Problems and Perspectives in Management, 8(1), p. 161-173 World Bank (2012). Tham nhung tu goc nhin cua nguoi dan, doanh nghiep va can bo cong chuc, Nha xuat ban Chinh tri Quoc gia ANNEX Annex 1: Statistical description of variables Mean Std. err. Min Max Returns on asset (ROA) 0.013 0.138 -1.085 0.462 Tobin Q 0.514 1.219 0.020 21.921 D&T1 36.138 9.039 5.000 56 D&T2 40.01 8.12 10 57 Timeliness disclosure 0.847 0.360 0 1 Accessibility disclosure 0.596 0.491 0 1 Having foreign ownership Years of listing Small size 0.675 6.300 0.297 0.469 2.100 0.457 0 1 0 1 13 1 Medium size 0.249 0.433 0 1 Large size 0.455 0.499 0 1 High corruption risk industry 0.271 0.445 0 1 Ratio of debts on total assets 0.511 0.244 0 1.119 Annex 2: Matrix of Pearson correlation and VIF 1.000 0 0.179 1* 0.175 4* SNN Y 1 1.000 0 0.334 7* 0.432 9* 0.232 5* 0.095 5 0.006 7 1.000 0 0.117 3 0.064 0 Size2 0.196 1* 0.044 1 0.100 5 CBTT KTH OI PBIE N SHN Ng 2 3 4 5 6 1.000 0 0.137 0 0.008 2 1.000 0 0.168 1 7 8 9 10 VI F 3.9 2 6.9 5 1.4 2 1.1 1 1.1 2 1.0000 1.6 0 544 | Asea Uninet Scientific and Plenary Meeting 2016 NNC C 0.059 3 0.088 2 LEV 0.040 2 0.070 1 0.077 0 0.037 6 TTH U 0.625 3* 0.404 5* Size3 0.058 2 0.067 6 0.048 2 0.100 6 0.256 6* 0.016 1 0.054 9 0.004 3 0.508 3* 0.229 9* 0.091 1 0.096 9 0.5253 * 0.2332 * 0.0653 0.2135 * 1.000 0 1.6 9 0.093 6 1.000 0 0.277 9* 0.045 7 0.298 1* 0.064 8 1.2 0 1.00 00 0.02 70 1.2 4 1.00 00 Note: * shows statistically significant at 5% VIF >10 is considered as high multicolinearity thus would affect estimated results (Kutner, Nachtsheim, and Neter, 2004). 8.6 9 SERVICE E-MARKETPLACE PLATFORM FOR SENIOR CITIZENS Leszek A. Maciaszek leszek.maciaszek@ue.wroc.pl Wroclaw University of Economics, Poland Abstract e-Marketplaces for services (such as Airbnb, OpenTable, or BlablaCar) are governed by different business and technology principles than e-Marketplaces for products (such as Alibaba, eBay, or MarcadoLivre). In the case of eMarketplaces for senior citizens, service innovation must be requestor-focused. Immobile (residential, fixed) and mobile ambient (sensors, actuators) intelligence devices cover the spectrum of requestor (consumer, patient) monitoring (daily living, health status, intensive care). On the society side, the aim is to enable older persons, nearing or in retirements, healthy or unhealthy, to live socially-included and economically-active lives. On the IT side, the aim is to provide innovative systems and solutions embracing contemporary shifts of computing paradigm to service science, cloud computing, mobile connectivity, business processes, and societal participation. In this paper we report on selected business and technological implications of embarking on the development of a service e-Marketplace platform for senior citizens. We discuss plausible business models, identify major success factors, and present software engineering challenges underpinning development of such platforms. Keywords: e-Marketplace, e-Service, Ambient Assisted Living, Business process Models, Service-Oriented Software Engineering. 1 INTRODUCTION Physical and psychological health of older persons brings concrete social and economic benefits and it is an important enabling factor for the sustained economic growth in the world of otherwise unsustainable-economically demographic change. The increased participation of older persons, while demanded by the demographic change, is very much in line with the observed transition to a decentralized and skill-based service economy. The experience, knowledge and wisdom of senior citizens are a huge asset and underutilized enabler of Internet-facilitated service economy of today. The understanding and explanation of these complex relationships constitutes the social and economic background for our research. Globally, life expectancy for people born between 2010 and 2015 is 70 years (77 in Europe) and it is expected to keep rising. Moreover, population aged 60 or over accounts in 2015 for 12% of the global population (24% in Europe) and this age group is the fastest growing (3.26% per year) (UN, 2015). The demographic changes have many economic and social implications. On one hand, senior citizens are healthier and more active than past generations. This impacts on the lifestyle needs of senior citizens. On the other hand, longevity is associated with longProceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 545 546 | Asea Uninet Scientific and Plenary Meeting 2016 lasting medical conditions and disabilities. This impacts on the healthcare needs of senior citizens. As reported in Pritchard and Potter (2011) and elsewhere, the increasing life expectancies and associated healthcare expenditures are becoming unsustainable for world economies. To sustain the pension and healthcare growing costs, there is a need to activate older persons by providing opportunities for greater economic and social engagement and to extend care from hospitals, nursing accommodations, etc. to the home surroundings of consumers/patients. With the assistance of tele-monitoring and tele-treatment, health management can contribute to the benefits and become a part of life engineering (Oesterle, 2014; Hess et al. 2014). From the technology perspective, the first discourse is termed Independent Living (IL), the second – Ambient Assisted Living (AAL). In both cases, the battle ground is to deliver appropriate services to senior citizens. Information technology plays here an ever increasing role, including through provision of e-Marketplaces for products and services of interest to senior citizens. A service e-Marketplace platform for older persons can be seen as a Lifestyle Engineering & Health Management facility offering concierge-mediated, requestor/supplier-negotiated, and cyber/physical-based delivery of services to requestors (consumers, patients). The purpose is to enable elderly people (in particular, but not exclusively) nearing or in retirements, healthy or unhealthy, to live socially-included and economically-active lives. e-Marketplaces for services (such as Airbnb, OpenTable, or BlablaCar) are governed by different value propositions, business models and technology principles than e-Marketplaces for products (such as Alibaba, eBay, or MarcadoLivre). The differences stem from differences between products and services. A requestor of a product request a tangible thing and takes the ownership of that thing when provided by the supplier. A requestor of a service requests an action without taking the ownership of the service. This said, we must recognize that most services have an element of products in them and vice versa. The dichotomy between these two concepts has been replaced by a service-product continuum (Targowski, 2009). On one hand, products are servitized; on the other hand, services are productized (Cusumano, 2008). In the context of R&D reported in this paper, we must distinguish between a service and an IT service. We follow here the definitions of ITIL (IT Infrastructure Library) (Aguter, 2013, p.17):   "A service is a means of delivering value to customers by facilitating outcomes customers want to achieve without the ownership of specific costs and risks." "A service provided by an IT service provider. An IT service is made up of a combination of information technology, people and processes. A customer facing IT service directly supports the business processes of one or more customers, and its service level targets should be defined in a Service Level Agreement. Other IT services, called supporting services, are not directly used by the business, but are required by the service provider to deliver customer-facing services." From the IT perspective, vendors of traditional “boxed” software products use the cloud as a means of servitizing the product (and offering it without changing the ownership); on the other hand, productized services (i.e. automation of services, such as movies over Internet) enable “people to participate in a growing number of service-related activities without having to be physically present” (Targowski, 2009, p.57). Asea Uninet Scientific and Plenary Meeting 2016 | 547 e-Marketplaces differ significantly from traditional e-Commerce systems. Firstly, they reinstate the function of intermediaries between the requestor/buyer and supplier/seller (i.e. the function that traditional e-Commerce systems can do without). Secondly, and more importantly, e-Marketplaces connect actors in many-to-many collaborative networks, in which diverse offerings of suppliers are facilitated by diverse intermediaries and meet with diverse realizations of requestors. Such systems emphasize the appointment coordination process between the three parties. We define the appointment coordination as “a process, which leads to establishing time, locations, participants and goal of the appointment” (Biziel et al., 2016). The research reported in this paper stems from our experiences and knowledge gained during the on-going development of the Amiona platform (http://amiona.com/), and the research conducted within the Competence Center Services for Society (CC S4S) (http://s4s.ue.wroc.pl/) as well as within the framework of the Active Retiree and Golden Workers Gate (ActGo-Gate) project (https://actgogate.iwi.unisg.ch/). The paper has the following structure. The next Section discusses the business models for service e-Marketplaces and list the factors for making the platform a success. In Section 3, we address selected software engineering challenges faced by the developers of a service e-Marketplace. In the Conclusions Section, we place our research in the wider context of the innovation chain in service e-Marketplace R&D and relate this context to the history, experience and knowledge gained in our R&D initiatives and projects. 2 BUSINESS MODELS AND SUCCESS FACTORS Service innovation is requestor-focused. Requestor market, as the primary driver of service e-Marketplace innovation, challenges the way companies innovate and evolve with IT. The innovation ideas need to tap into the phenomenon of consumerization and personalization as the tendency for new IT solutions to emphasize requestor-focused service provision and to emerge first in the personal requestor market and then spread into business and government organizations. Consumerization opens up an opportunity for new business models and ways of value creation. The shifts to consumerization and personalization underlies next generation service e-Marketplace solutions, in which service requestor is placed in the center of attention, while the service supplier is given enough incentive to use the e-marketplace (and, in most business models, pay for the use of it). The formula of consumer being a core entity in lifestyle engineering domain matches well the traditional marketing principle that "the customer is always right". A notable exception has traditionally been public-sector, in particular healthcare services. In the health management domain the service supplier (physician) has supreme power over the service requestor (patient), who is seen as a grateful, passive entity. Next generation service e-marketplaces bring about a wave of change. The road is bumpy, though, for reasons of (1) professional autonomy of service providers and (2) perception that resource utilization in publicly-funded health services constitutes public rather than private (patient) good (Laing and Hogg, 2002). The business models need to consider three dimensions: economic, operational and strategic (Osl et al., 2008). The models for the use of a service e-Marketplace platform vary and can involve many actors. A vendor of a cloud Software-as-a-Service (SaaS) solution offers tenant instances to suppliers of concrete e-Marketplace services. Suppliers/intermediaries act as context integrators for interested service providers (e.g. a hospital). A provider enlists service performers (e.g. a nurse) as subscribers to a cloud- 548 | Asea Uninet Scientific and Plenary Meeting 2016 based service e-Marketplace platform. A performer delivers the service to a requestor (e.g. a patient). Figure 1 presents actors and revenue streams for the service e-Marketplace business case. Requestors (consumers, patients) solicit services of Suppliers by using service e-Marketplace system. Services can be obtained via Intermediaries, who have access to service context and information about requestors' standing. They can act as concierge or call centers and can make appointments for services on behalf of Providers. Alternatively, Requestors can make direct appointments with Providers via the service eMarketplace platform. In a typical situation, Provider employs Performers, who actually execute a service. Volunteers and informal carers Thank you Requestor Supplier (consumer, patient) Payment for advice , appointment, and service execution Donations Public authorities Life & health insurance companies Membership & subscription payment for platform use Payment for getting requestor’s business platform business co-funding platform business co-funding service e-Marketplace platform Membership & subscription payment for platform use Payment for LE&HM instance Payment for ambient intelligence service e-Marketplace platform Provider Employment Performer Service e-Marketplace SaaS owner Cyber-physical systems Intermediary Payment for enterprise functionality Payment for government databases Enterprise information systems Government information systems Fig. 1. Actors and revenue streams in service e-Marketplace business case. The Intermediary aspect of e-Marketplace platform enables human-driven concierge-like appointment coordination made possible by all communication means (Internet, telephone, email, etc.). However, the principal modus-operandi of the platform is to encourage Requestors and Suppliers to manage appointment and service provisioning with web-based applications using context-aware and purpose-designed mobile and non-mobile devices. In some cases, in particular in e-health domain, delivery of services can be auto-activated by sensing/computing/actuating capabilities of cyber-physical systems (Haque et al., 2014). Such systems utilize technologies of IoT (Miorandi et al., 2013) and environments of ambient intelligence (Cook et al., 2009). A troublesome side-effect of any chosen service e-Marketplace business model is a cold start problem and a catch 22 situation. How to entice service providers and performers to pay for and use a vendor's service e-Marketplace platform, if there are no requestors yet? On the other hand, how to entice requestors to request services prior to a significant presence of providers and performers on the platform with their service offers? One way of alleviating the cold start problem is by creating local communities of requestors, which not only can create "volume" to attract providers and performers, but can even use barter trade to switch between the roles of requestor and provider/performer. Asea Uninet Scientific and Plenary Meeting 2016 | 549 Technological novelty and attractiveness of a service e-Marketplace platform is a necessary condition for a business success, but it is not a sufficient condition. By observing “rising stars” in service e-Marketplaces, such as airbnb.com, in our R&D we identify and subscribe to five major success factors: 1) 2) 3) 4) 5) 3 Trust (service e-Marketplace platform must provide mechanisms facilitating trust between all actors; the mechanisms must integrate the remaining four factors into a coherent trust-building endeavor). Guarantee (service e-Marketplace platform must offer safeguards to actors in a monetary form for such things as lost business to a performer or damages to a requestor). Payment system (service e-Marketplace payment system must offer a trustworthy and reliable means of transferring money between the actors; the means should include refunds, cancellation policies, protection under Terms of Service, etc.). Verification (service e-Marketplace platform must ensure a proper identification and verification of performers and requestors prior to allowing them to use the system and must seek opinions after a service delivery concluded). Community (most services offered via a concrete instantiation of the service e-Marketplace platform are “localized”, i.e. services are enacted in geographically-closed communities; accordingly the platform must facilitate community building by allowing barter services etc. and permitting the community to evolve the platform). SOFTWARE ENGINEERING CHALLENGES Because the IT is an empowerment and enhancer in the service economy and because older persons are asset and potential engine in the service economy, then there is an obvious need to provide to seniors a friendly easy-to-use service e-Marketplace platforms. This is a huge challenge because of the “lost in the cyberspace” resistance of older persons to using Internet via mobile and non-mobile devices (Heart and Kalderon, 2013). A corresponding challenge is that the delivery of software and systems that are easy to use implies that they are difficult to design and implement. In service e-Marketplaces, the delivery of services to actors is performed (typically) on Everything-as-a-Service models (Banerjee, 2011), in which software, platform and infrastructure are made available as services paid for according to the usage. This creates ubiquitous marketplace where commercial, social, government, health, education and other services are facilitated, negotiated, coordinated and paid for through service e-marketplace platforms. Figure 2 illustrates a requestor-centric view of service e-Marketplace processes. The diagram distinguishes between the IL and AAL environments and contexts. In both environments, ambient intelligence (Cook et al., 2009; Sadri, 2011) has an important role to play. Immobile (residential, fixed) and mobile ambient intelligence devices (sensors, actuators) cover the whole spectrum of requestor (consumer, patient) monitoring (daily living, health status, intensive care). They provide input to cyber-physical systems (Hague et al. 2014), which in turn supply information to concierge systems (intermediaries in Figure 1), to EHR systems (Frączkowski et al., 2014), and to emergency and alerts handling facilities. In parallel, requestors provide real-time input to concierge and EHR systems as well as can request emergency assistance. 550 | Asea Uninet Scientific and Plenary Meeting 2016 Fig. 2. Requestor-centric view of service e-Marketplace processes. The upper part of Figure 2 relates to the services required by a requestor. Some services can be automatically or semi-automatically identified through the process of service matching and selection. Although not directly shown in Figure 2, this process can be triggered in a way oblivious to a requestor - it can be cyber-physical or concierge/intermediary initiated. It can also be activated and negotiated directly by a requestor. Service order and execution can flow from service matching and selection. In all cases, a requestor will be directly involved in ordering and execution of a service. The process itself can be advised by experts (suppliers and other professionals) and by social networks. Finally, the process of payments and accounts is noted in Figure 2. The established discipline of software engineering (e.g. Maciaszek and Liong, 2005) advocates architecture-driven forward-engineering processes. Modern practices challenge such processes. They also challenge the rigid top-down development epitomized in three consecutive phases of systems analysis, design and implementation. While the architectural patterns, principles, and frameworks remain a valid software engineering objective for development of a service e-Marketplace platform (ref. e.g. Maciaszek et al., 2015a; Maciaszek et al., 2015b), the ways of achieving that objective have changed in modern practices. Main practices that underlie this trend are DevOps and microservices. DevOps is an approach for merging development and operations (Huttermann, 2012). On the level of user interface and web programming, DevOps is supported by approaches known as responsive development, progressive enhancement, graceful degradation (Overfield et al., 2013). Asea Uninet Scientific and Plenary Meeting 2016 | 551 The microservice architectural style is “an approach to developing a single application as a suite of small services, each running in its own process and communicating with lightweight mechanisms, often an HTTP resource API” (Lewis and Fowler, 2014). Together, DevOps and microservices allow for an agile development while not jeopardizing the most crucial software quality - adaptability (i.e. understandability, maintainability and evolveability). With DevOps plus microservices at work, the owner/vendor of service e-Marketplace platform sets up cloud tenant instances for service e-marketplace businesses. Service e-Marketplace system is then a cloud instance of a generic Software-as-a-Service platform. Customization and variability of instances is based on the technology of multi-tenancy and uses the emerging principles of Service Line Engineering (SLE) (Mohabbati et al., 2013; Walraven et al., 2014)). 4 CONCLUSIONS Our research has resulted from and has been partially financed by the University of St. Gallen’s Competence Center Independent Living (CC IL). Consequently, our research objectives have been aligned with the objectives of CC IL (http://il.iwi.unisg.ch/) and extended by various R&D initiatives of our own Competence Center Services for Society (CC S4S) at Wroclaw University of Economics (http://s4s.ue.wroc.pl/). The objectives have been: 1) 2) 3) 4) Providing a service platform for participation of older persons in various economic models (paid and unpaid) supported by mobile and non-mobile software applications with intelligent matching of supply and demand to allow situational and personal delivery of services to seniors. Reducing the social exclusion of the elderly and the associated economic and human cost by an Internet-enabled integration of otherwise fragmented services already provided by social organizations, government entities, insurance organizations, health care providers, banks, retail stores, etc. A related objective is to create and support new opportunities for provision of services that would not be possible without the platform. Extending the IL functionality of the service e-Marketplace platform into e-health area to include the AAL functionality and cater for people with chronic illnesses and disabilities. To this aim, the platform needs to integrate with clinical/hospital care systems in order to empower patients in obtaining professional and home care. Furthermore, the platform needs to tap into Big Data analysis to enrich medical case management and recommend better therapies. This in turn opens up new possibilities for better service coordination and delivery to patients. Tapping into the expertise of our other research center Service-Oriented Systems Engineering and Management SOSEM (http://sosem.ue.wroc.pl/) in order to make the service e-Marketplace interoperable with cyberphysical monitoring systems (IoT sensors and actuators) and with social, enterprise and government systems (such as social networking sites, Electronic Health Records (EHR), Customer Relationship Management (CRM), Enterprise Resource Planning (ERP) systems). The service e-Marketplace research agenda focusses on the dedicated science and engineering for designing software systems and applications supporting provision of eservice solutions in general, and specifically for lifestyle engineering and health management. By centering on consumerization, personalization, and collaborative context- 552 | Asea Uninet Scientific and Plenary Meeting 2016 dependent value creation, the R&D into service e-Marketplace shifts towards what Brenner et al. (2014) call user, use & utility research (or 3U research, to use another parlance). Our service e-Marketplace agenda concentrates on IT-supported lifestyle engineering and health management. Within this agenda, we conduct both fundamental and pragmatically-minded research along the design science principles (Hevner and March, 2003; Hevner et al., 2004; Niederman and March, 2012, Oesterle et al., 2010). While design science is the preferred scientific method for much of information systems research, it becomes the necessity for R&D into service information systems, as per three convincing arguments identified by Boehmann et al., 2014: 1) 2) 3) Service systems cannot be meaningfully validated in laboratory experiments. An external validity in real-world contexts (piloting of innovation) is necessary. Novel service systems can only emerge with actors’ acceptance and involvement (through participatory design and action research). Service systems engineering develops software models and artifacts and is, therefore, design-oriented by their very nature. Within the realm of design science, our R&D follows the recommendation and practice of consortium research (Oesterle and Otto, 2010). The consortium research method bridges the practitioners' knowledge with scientific objectives. In effect, it bridges practical relevance with scientific rigor. Within the realm of consortium research, the service e-Marketplace embraces the innovation chain as pictured in Figure 3. The diagram extends the model of evolution of the engineering discipline proposed by Shaw (2009). The innovation chain originates from a craft practice of available technology that leads to some localized use of it. If successful, the craft practice evolves into a production line under management control. This results in a commercial market for a line of products. Competition and a natural human inquiry lead to science, based on observations, experiments and proofs in order to confirm stipulated theories. When the volume of confirmed theories gets sufficiently significant, an engineering discipline emerges and allows production with predictable outcomes. Consequently, a related economy emerges as a network of producers, distributors and consumers of products and services based on these products. The final beneficiary of the innovation chain is society at large. Fig. 3. Innovation chain in service e-Marketplace research (extended from Shaw (2009)) An important underpinning of the service e-Marketplace research is a desire for using rigorous qualitative and quantitative investigation methods. While qualitative and quantitative research can be conducted independently and in parallel, there is a realization Asea Uninet Scientific and Plenary Meeting 2016 | 553 that quality characteristics of software systems can and should be quantified, as evidenced in software metrics research (Fenton and Pfleeger, 1997; SQuaRE, 2011). In particular, we use the SQuaRE standard (SQuaRE, 2011) as a reference model for investigation into quality of proposed service e-Marketplace solutions, and the Amiona platform as its existing practical incarnation. Interestingly, experiments and pilot studies that recently have been conducted with Amiona point to the overwhelming importance of the SQuaRE quality of usability as the main requirement for making Amiona a business success (Biziel et al., 2016). ACKNOWLEDGEMENTS I am grateful to Hubert Oesterle for his constructive comments on earlier versions of CC S4S research agenda (that eventually led to this paper) and for important hints how to extend and improve it. REFERENCES Aguter, C. (2013). ITIL® Lifecycle Essentials. Your essential guide for the ITIL Foundation exam and beyond, IT Governance Publishing, 375p. Banerjee, P. et al. (2011). Everything as a Service: Powering the New Information Economy, Computer (IEEE), March, pp.36-43 Biziel, G. Franczyk, B. & Slowik, J. (2016). Efficiency of the Appointment Coordination Process’ Model in the Emerging Business (manuscript accepted for publication at the Sixth International Conference on Business Intelligence and Technology. BUSTECH 2016) Boehmann, T. Leimeister, J.M. and Moeslein, K. (2014). Service Systems Engineering. A Field for Future Information Systems Research, Business & Information Systems Engineering, 2, pp.73-79 Brenner et al., (2014): User, Use & Utility Research. The Digital User as New Design Perspective in Business and Information Systems Engineering, Business & Information Systems Engineering, 1, pp.56-61 Cook, D.J Augusto, J.C and Jakkula, V.R. (2009). Ambient Intelligence: Technologies, Applications and Opportunities, Pervasive and Mobile Computing, 5, pp.277-298 Cusumano, M.A. (2008). The Changing Software Business: Moving from Products to Services, IEEE Computer, January, pp.20-27. Fenton, N.E. and Pfleeger, S.L. (1997). Software Metrics. A Rigorous and Practical Approach, 2nd ed., PWS Publishing Company, 638p. Frączkowski, K. Mazur, Z. and Mazur, H. (2014). Preconditions for Processing Electronic Medical Records, in: BDAS 2014, CCIS 424, S. Kozielski et al. (eds)., Springer, pp.504-514 Haque, S.A. Aziz, S.M. and Rahman, M. (2014). Review of Cyber-Physical System in Healthcare, International Journal of Distributed Sensor Networks, Article ID 217415, 20p. Heart, T. and Kalderon, E. (2011). Older Adults: Are They Ready to Adopt Health-related ICT?, International Journal of Medical Informatics, 82, pp.e209-e231 Hess, T. Legner. C. Esswein, W. Maass, W. Matt, C. Oesterle, H. Schlieter, H. Richter, P and Zarnekow, R. (2014). Digital Life as a Topic of Business and Information Systems Engineering?, Business & Information Systems Engineering, Published online: 17 July 2014, 7p. 554 | Asea Uninet Scientific and Plenary Meeting 2016 Hevner, A.R. and March, S.T. (2003). The Information Systems Research Lifecycle, Computer (IEEE), November, pp.111-113 Hevner, A.R. et al. (2004). Design Science Research in Information Systems, MIS Querterly, 28, 1, pp.75-105 Huttermann, M. (2012). DevOps for Developers, Apress. Laing, A. and Hogg, G. (2002). Political Exhortation, Patient Expectation and Professional Execution: Perspectives on the Consumerization of Health Care, British Journal of Management, Vol. 13, pp. 173-188 Lewis, J. and Fowler, M. (2014). Microservices. A Definition of this New Architectural Term, Retrieved from: http://martinfowler.com/articles/microservices.html#CharacteristicsOfAMicroser viceArchitecture Maciaszek, L.A., Liong, B.L. (2005). Practical Software Engineering. A Case-Study Approach. Addison-Wesley. Maciaszek, L.A. and Skalniak, T. (2015a): Confluent Factors, Complexity and Resultant Architectures in Modern Software Engineering. A Case of Service Cloud Applications, In: Fifth International Symposium on Business Modeling and Software Design BMSD 2015, ed. B. Shiskov, ScitTePress, pp.27-45. Maciaszek, L.A. Skalniak, T. and Biziel, G. (2015b): Architectural Principles for Service Cloud Applications, In: Business Modeling and System Design. 4th International Symposium BMSD 2014. Revised Selected Papers, ed. B. Shiskov, Lecture Notes in Business Information Processing LNBIP 220, Springer, pp.1-21 Miorandi, D. Sicari, S. Pellegrini De, F. and Chlamtac, I. (2012). Internet of Things: Vision, Applications and Research Challenges, Ad Hoc Networks, 10, pp.14971516 Mohabbati, B. Asadi, M. Gasevic, D. Hatala M. and Mueller, H.A. (2013). Combining Service-Orientation and Software Product Line Engineering: A Systematic Mapping Study, Information and Software Technology, Article in press http://dx.doi.org/10.1016/j.infsof.2013.05.006, 15p. Niederman, F. and March, S.T. (2012). Design Science and the Accumulation of Knowledge in the Information Systems Discipline, ACM Transactions on Management Information Systems, Vol. 3, No. 1, pp.1:3-1:15 Oesterle, H. (2014): Business oder Life Engineering?, HMD Praxis der Wirtschaftsinformatik, Springer, Volume 51, Issue 6, pp 744-761 Oesterle, H. and Otto, B. (2010). Consortium Research. A Method for ResearcherPractitioner Collaboration in Design-Oriented IS Research, Business & Information Systems Engineering, 5, pp.283-293 Oesterle, H. et al. (2010): Memorandum on Design-Oriented Information Systems Research, European Journal of Information Systems, pp.1-4 Overfield, E., Zhang, R., Medina, O. and Khipple, K. (2013). Responsive Web Design and Development. In Overfield, E., Zhang, R., Medina, O. and Khipple, K. (Eds), Pro SharePoint 2013 Branding and Responsive Web Development, pp.17-46, Apress Osl, P. Sassen, E. and Oesterle, H. (2008.: A Guideline for the Design of Collaborative Business Models in the Field of Ambient Assisted Living, Deutscher AALKongress mit Ausstellung. Berlin, Offenbach: VDE Verlag GmbH, pp.179-183. Available at: http://works.bepress.com/hubert_oesterle/169 Pritchard, R.E. and Potter, G.C. (2011.: Senior Citizens, Social Security, and Healthcare Costs, Journal of Business & Economic Research, Vol. 9, No. 1, pp.23-28 Sadri, F. (2011): Ambient Intelligence: A Survey, ACM Computing Surveys, Vol. 43, No. 4, Article 36, 66p. Asea Uninet Scientific and Plenary Meeting 2016 | 555 Shaw, M. (2009). Continuing Prospects for an Engineering Discipline of Software, IEEE Software, November/December, pp.64-67 SQuaRE (2011). Systems and software engineering — Systems and Software Quality Requirements and Evaluation (SQuaRE) — System and software quality models. ISO/IEC 25010, 44p. Targowski, A. (2009). The Architecture of Service Systems as the Framework for the Definition of Service Science Scope, International Journal of Information Systems in the Service Sector, 1(1), pp.54-77 UN (2015). World Population Prospects. Key Findings & Advanced Tables. 2015 Revision, United Nations, 66p. Walraven, S. et al. (2014) Efficient Customization of Multi-Tenant Software-as-a-Service applications with Service Lines, The Journal of Systems and Software, 91, pp.4862 HOUSING PREFERENCE FOR LOW-INCOME PEOPLE IN INDONESIA Desy Rahmadaniyati desydr@gmail.com Magister Student of Architecture Department, Laboratory of Housing and Human Settlement, Institut Teknologi Sepuluh Nopember (ITS) Muhammad Faqih faqih@arch.its.ac.id Senior Lecturer of Architecture Department, Laboratory of Housing and Human Settlement, Intitut Teknologi Sepuluh Nopember (ITS) Arina Hayati arina.hayati@gmail.com Lecturer of Architecture Department, Laboratory of Housing and Human Settlement, Intitut Teknologi Sepuluh Nopember (ITS). Abstract Housing preferences need to be specified in each society groups. Any planning and provision of housing that ignores society preferences are commonly resulted in disparity phenomenon between user’s needs and developer's needs as the provider. People preferences in determining residences are vary because every individual has different wants and ideals, which are affected by diverse factors. This paper aims to identify housing preference for low income people in the city of Surabaya, Indonesia. From literature analysis, eight main aspects are defined as comprehensive indicators in sorting the priority of housing preferences. Questionnaires were given to 100 respondents with low-income economic background. The gathered data are analysed with the quantitative descriptive research method. The result shows that the land tenure is considered by low income society as the most important aspect of housing preferences, while the location of house or residence is considered as the last. These outcomes can be used as the underlying considerations in providing and planning affordable and suitable housing for an Indonesian lower class. Keywords : housing preferences , low income people 1 INTRODUCTION Housing is commonly identified as a basic commodity that all people need for survival (Beamish, et all, 2001). Altman and Chemers (1980) in Jabareen (2005) argue that family dwellings simultaneously satisfy the needs of the occupants for personal identity and for bonds with the community and culture at large. In addition, dwelling environments also need to be supportive for its user and need to be congruent with their ‘culture’. Therefore, Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 556 Asea Uninet Scientific and Plenary Meeting 2016 | 557 housing, neighborhoods, and other environments are used differently by different people or groups (Rapoport, 2005:52). In accordance with Environment Behavior studies, housing is related to the understanding about cultural-based built environment design, conceiving human, culture, and environment as the interrelated components (Rapoport,2005). ‘Culture’ is hence influencing everyone’s interpretation with the respectively rules (ideals, norms, standards, etc) (Rapoport,2005:25). ‘Meaning’ is the most important aspect of function and crtitical element in wants, evaluation, and preferences of environments and many of its characteristics. In this instance, ‘meaning’ plays a major role in helping to explain the major differences in evaluation and preferences, and thus choice between users as a whole, and designers, and among different groups of users in any one city (Rapoport,2005:48). Specifically, in choosing environments and its characteristics (space organizations, shape, materials, etc), wants are more important than needs (Rapoport, 1998). In the other words, various way of interpreting something results in puzzling large number of different wants and preferences (Rapoport, 2005:54). When choosing a residence, individuals and households make choice of the type of residence and its environment. The choice is guided by needs or preferences of housing, and sometimes be restricted by their income and opportunities offered by the housing market (Dieleman & Mulder, 2002 in Jabareen, 2005). In line with this, research on housing preferences shows that there are some factors that influence people in choosing their residence. One of those factors is demographic variables, such as age, and the household size. However, from the research, economic variables such as income and equity in the house dominate the housing-choice patterns (Clark & Dieleman, 1996 in Jabareen, 2005). In Indonesia, there are few preceding studies related to housing preferences in some particular cities (Nurhadi,2004;Umilia&Serlin,2013; Malahati,2013;Triyuly,2010). Nurhadi (2004) highlighted research on housing preference based on the disparity phenomenon between user’s needs and developer's needs as housing provider. That instance is resulted from housing provision which is not considering various preferences of different income levels among societies. Thus, it can be concluded that housing preferences should be divided into low, middle, and high income groups. The main focus of this study is to identify housing preferences for low-income people in Indonesia which is based on a more comprehensive indicators. Housing planning and provisions for low-income society however need a bottom-up approach, which is considered from their own housing preferences (Triyuly,2010). These efforts are necessary so that the governments and housing provider can exactly solve the housing needs of the low economic background. Generally, the precedings researches have not yet based on any comprehensive indicators, and also not specifically addressed to any particular society level. The priority aspects of discussed issues also still rely on only one reference, regardless of Indonesian housing market conditions. Therefore, this study focuses on housing preference for people with low economic background. This study aims to describe the ideal and suitable housing preferences for low-income society in buying or building their own house, especially in Surabaya Indonesia. The research questions are: How is the housing preferences for the low-income people in Indonesia based on comprehensively determined indicators? and How is its comparison with the other society level? 558 | Asea Uninet Scientific and Plenary Meeting 2016 2 2.1 LITERATURE REVIEWS Definition of Housing Preference Preference is a greater interest in or desire for somebody/something than somebody/something else (OALD,2011 in Akkila,2012). Thus, preference can be referred to a condition when a person prefers something opposed to all other alternatives he/she is faced with. Within this case, choice and preference are two different things. Preference can be seen as a potential choice (Hasu,2010 in Akkila,2012), while choice can be seen as a the revealed preference (Coolen & Hoekstra,2001 in Akkila, 2012). In housing context, preferences relate to the variety of options on the housing market (Akkila,2012). A housing preferences is ideal housing for particular individual or household. The variety of housing choice makes it more important than shelter. Many kind of locations, structure types, sizes, styles, and construction types provide unique living environments (Beamish,et all, 2001). In addition, housing preferences can also be interpreted as user’s wants in choosing and owning any housing attributes, representing the condition when someone try to achieve desired conditions of his dwelling (Triyuly,2010). However, the complexity of people’s lives makes housing choice a decision that is influenced by a variety of factors, such as age, income, and household size (Beamish, et all, 2001). In choosing their house, both individual and household are also influenced by different needs, perception, and society interactions as well (Triyuly,2010). In line with this, preceding researches show the domination of demographic and economic variables in affecting housing choices and preferences (Jabareen, 2005). Consequently, housing preferences are needed to identify factors based on every level of societies. Social class and socio-economic status are terms that have been used by social scientists in describing a cluster of demographic characteristic, including income, education, and occupation. People in different classes may have different expectations for personal and family behavior and for housing preferences and choices (Beamish,et all,2001). Moreover, Melly G. Tan in Koentjaraningrat (1981) specifically describes that society’s socio-economic condition can be seen through the three aspects, which are occupation, education, and income. Based on this, groups among societies are classified into the low, middle, and high level of socioeconomic condition 2.2 Definition of Low-Income People According to Koentjaraningrat (1981), low-income people is a family which its income is lower than its needs in fulfilling their minimum living demands. Beside that, the low income society / Masyarakat Berpenghasilan Rendah (MBR) has limited purchasing power and also needs government support in acquiring a house(Regulation of The Minister for Public Work and Public Housing No.42, 2015). Related to income level, in accordance with The Regulation of State Minister for Public Housing No.14 in Indonesia (2010), low income society has maximum monthly income of 2.5 million Rupiahs (Rp.2.500.000,00 per month). Specifically, The Indonesian State Minister for Public Housing classifies the low-income into three main targets: group I (Rp. 1,7m<income<Rp. 2.5m), group II (Rp. 1m<income<Rp. 1.7m), and group III (lower than Rp. 1 m). This classification is cited on The Regulation of The Minister for Public Work and Public Housing No.5 about Provision of Housing and Human Settlement Provision (2007). 2.3 Supporting Theories There are some supporting theories related to the influencing factors of each person’s housing preferences. According to Rapoport (2005), ‘culture’ affects the way someone interpreting something, while the interpretation results in variety of wants. When Asea Uninet Scientific and Plenary Meeting 2016 | 559 determining choice and preferences, it should also be reiterated that wants often play a much role than needs. In choosing an environment, such as housing, people choose not only the particular system of settings and its larger context, but also the particular environmental quality of those systems in a particular location. This is clear if one examines housing advertisements which emphasize meanings, and frequently show the vegetation, views, butterflies, sunsets, human relationships, recreations, rather than the dwelling itself. Past reports on housing preferences have identified several concepts that influence housing choice. These are included housing values, economic status, cultural norms, stage in family life cycle, and particular housing needs (Beamish, et all, 2001). Lifestyle is influenced by household type, social class, and housing values. The impact of lifestyle on housing choices is then filtered by the housing norms that are present in a culture, including six norms identified by Morris and Winter (1978). Finally, housing preference is determined as the actual choice that consumers make (Beamish, et all, 2001). The process of choosing one’s house encompasses interlinked influences of both internal and external factors. Preference, market conditions, availability, government regulations, real estate agents, friends and family are all considered as the internal factor, while lifestyle and socioeconomic status are the external one. (Coolen dkk,2011; Levy,et all,2008 in Wildish,2015 ). Furthermore, Morris et all (1978) in Triyuly (2010) argue that housing preferences fulfillment is also adapting socioeconomic and socio-ethnic perspective. The socioeconomic sees the relations of preferences with lifecycle, economic status, and lifestyle, while the socio-ethnic more emphasizes preferences in classification by the type of class, occupation, or ethnic. The following Figure 01 shows a conceptual framework about some influencing factors in housing preference. Figure 01. Conceptual Framework for Influences on Housing Choice Source : Beamish,et all,2001 In addition, Khozaei et all (2012) examined influencing factors in housing choices from many literatures into the macro and micro group. At the macro level, factors include time, space, money and social relationships, size of place of residence, functional congruity, neighborhood attributes, outdoor environmental quality, location, local landscape, safety, and proximity to the city, public transportation, proximity to workplace, health facilities, 560 | Asea Uninet Scientific and Plenary Meeting 2016 and educational facilities. On the other hand, at the micro level, the exterior facade, dwelling type, convenience, security, price, orientation and layout, and architectural style are also examined in the study of housing preferences. 2.4 Preceding Studies There are some existing researches related to housing preferences in Indonesia. Nurhadi (2004) in his study discussed about People Preferences in Choosing Urban Housing in Tangerang City, Indonesia. He realized that there is a phenomenon of disparity between user’s needs and housing developer’s needs. It is resulted from an effort to provide housing that ignores various society’s preferences among different income levels. The conclusion of the study is some differences of housing preferences among low, middle, and highincome level in society, that should be taken into account by government and developer as the housing provider (Nurhadi,2004). Umilia & Serlin (2013) also discussed the housing preferences issue. Without specifically addressed to particular group, the study aims to determine The Influencing Factors in Choosing Residence Location on Surabaya Suburban Area. This research shows some factors that affect people in choosing residences location, which consist of proximity to stores, availability of clean water, religious facilities, aesthetic, access to public transport, access to education facilities, availability of electricity network, and the price of land or house. In general, accessibility is concluded as the primary factor in choosing residences location in Surabaya Suburban area. Beside that, Malahati (2015) in her similar research also discussed about The Influencing Factors in Dwelling Preferences in Medan. In tune with Umilia dan Serlin (2013), Malahati’s study was not specifically addressed to particular society group as well. The result in her study shows that the factors in housing preferences are agglomerated into physiological needs (residences amenities), security and safety needs (residences protection), social needs (proximity to education and commercial facilities), economics (purchasing power), and a modern residences design. The sorted classifications in housing preferences are adopted Maslow’s theory about the hierarchy of human needs (Malahati,2013). However, Triyuly (2010) studied about The Indentification of Housing Preference for Low Income Society in Palembang City which highlited the low income group, but was too specified for particular context and phenomena in Palembang City development. The observed aspects in her study are also restricted in building space and material. She concludes that there are five types of housing cluster that appropriate for the characteristics of several level in low-income people. These preferences results are influenced by socio-economic condition (Triyuly,2010) In several preceding studies, most of them are only discussed the preference issues based on a phenomena in a particular area, rather than considering many priority factors in housing preferences as a whole. Therefore, this study aims to identify main priorities in housing preferences based on literatures and the condition of the housing market in Indonesia. Thus, the gathered factors will be more comprehensive and able to be generalized. 3 RESEARCH METHODS This study uses a quantitatively descriptive methods. The data gathering in this study use stratified random sampling, giving a number of questionnaires to respondents in Surabaya, including Sukolilo, Menur Pumpungan, and some other areas. The questionnaires are targeted to 100 respondents with low economic background based on the determined criteria, whose income is not more than 2.5 millions Rupiahs. While filling the questionnaires, respondents are asked to assess many priority aspects with the Likert scale, Asea Uninet Scientific and Plenary Meeting 2016 | 561 using point 1 (least important) to 10 (most important). To determine the sorted preferences priority, data were analysed using quantitative technique, while to classify the detailed variables, the data were analysed using factor analysis in SPSS statistic program. Factor analysis is useful to identify the underlying dimensions that explain the correlations among several variables (Suliyanto,2005). 3.1 Criteria Formation The formation of criteria or priority aspects in questionnaires used in this study is based on the preceding literature reviews about housing preferences and the housing market condition observed through housing advertisements in newspapers, brochures, and reclames. Typical aspects or housing attributes are offered in housing market such as ‘strategic location’, ‘green environment’, ‘one gate system’, and so on. As a result, based on previous reviews, eight indicators are determined as the main aspects of housing preferences priorities, described as following variables: a) The House Physical Aspects Architectural style (minimalist,traditional,etc); additional spaces (double carport, yard); fencing; building material; number of storey b) The House Quality Air circulation system; lighting system; environmental safety (CCTV, gate system); traffic safety; infrastructure (sanitation, electricity, clean water); environmental ambience (green, clean, healthy, etc) c) The House Size d) The House Price e) The House Location Accessed by public transport; proximity to various amenities (main road, family dwelling, education, work, city center, airports, tourism, commercial, medical and health, and culinary facilities) f) Aviability of Supporting Facilities in Residences Sport facility; education facility; entertainment facility; tourism facility; gathering facility; religious facility; commercial facility; and culinary facility. g) The Bonuses Purchasing prize (cellphone, motorbike); Investation; cheap mortgage; discount; affordable down payment h) The Land Tenure 4 FINDINGS AND DISCUSSIONS In this study, questionnaires are given to 100 respondents with low economic background, based on determined criteria, which has monthly income that is not higher than 2.5 millions Rupiahs. The respondents consist of 65% of women and 35% of Men. Based on discussed classification of low income level, the respondents are 38% from group I (Rp1.700.0002.500.000), 42% from group II (Rp1.000.000-1.700.000), and 20% from group III (<Rp 1.000.000). The age amongst all respondents are vary : 26% are under 30 years, 45% are between 30-40 years, 21% are between 41-50 years, 5% are between 51-60 years, and 3% are higher than 60 years. Beside that, the occupation of all respondents are mostly entrepreneurs (53%), and the rests are employees(26%), civil servants (5%), teachers (3%), freelancers (6%), housewives (4%), drivers (2%), and 1% retirement of ABRI/ Indonesian Armed Force. Most of respondents are already married (73%), have own house (65%), live with main family (67%), and consists of 3-4 household members (55%). 562 | Asea Uninet Scientific and Plenary Meeting 2016 4.1 Housing Preference for Low-Income Society The following diagram shows the sorted priority of housing preferences from the data calculation of 100 respondents with low economic background in Surabaya, Indonesia. TENURE SIZE PRICE QUALITY PHYSIC BONUSES FACILITIES LOCATION Diagram 01. Percentage of Housing Preferences for Low Income People Source : Author’s Analysis, 2015 Based on the diagram, it can be seen that the land tenure gets the first position in the low income priority of housing preferences, in the amount of 96% of entire respondents. There is a significant domination of it among the others. The size, price, and quality of house are quite competitive with slight differences in: 79%, 78% and 77%. The next factors are the physical aspects (67%), bonuses (62%), and the residences facilities (60%). Thus, the less considered aspect is house location, in the amount of 55%. Specifically, the detailed housing preferences variables for low-income group are shown as below : No Priority (%) Assessment Variables 1 96 Land Tenure 2 79 House Size 3 78 House Price House Quality 86% : House Infrastructure 84% : Natural Air Circulation System 4 77 83% : Natural Lighting System 80% : Environment Ambience 67% : Traffic Safety 63% : Environment Safety House Physical Aspect 74% : Building Materials 70% : Architectural Style 5 67 69% : Additional Space (Front and back yard) 65% : Fencing 63% : Additional Space (Double carport) 61% : Number of Storey Bonuses 77% : Affordable Down Payment 73% : Cheap Mortgage 6 62 63% : Discount 53% : Long Term Investation 43% : Purchasing Prize 7 60 Residence/ Housing Facilities Asea Uninet Scientific and Plenary Meeting 2016 8 74% : Religious Facility 65% : Aducation Facility 63% : Commercial Facility (Shopping venue) 63% : Culinary Facility (Eating Venue) 58% : Collective Facility (Gathering venue) 57% : Entertainment Facility 56% : Tourism Facility 51% : Sports Facility House Location 72% : Accessed by Public Transport 71% : Proximity to Workplace 69% : Proximity to Education Facility 66% : Proximity to Health and Medical Facility 64% : Proximity to City Center 61% : Proximity to Main Road 60% : Proximity to Department Stores 59% : Proximity to Family Dwellings 58% : Proximity to Culinary Center 56% : Proximity to Tourism Venue 34% : Proximity to Airport 26% : Proximity to Clubhouse 25% : Proximity to Golf Court | 563 55 Table 01. Housing Preferences Variables for Low-Income People Source : Author’s Analysis, 2015 Based on Table 01, discussing about housing preferences of low income group in Surabaya Indonesia, they highly expect legal land tenure of their dwelling. Affordable house size and price become the second and the third considerations for them. The next important aspect is surely the house quality. In discussing house quality, all aspects (variables) are considered important, emphasizing the completeness of house infrastructures such as access to clean water, electricity, and descent sanitation. The natural air circulation and lighting system are also rated as the ideal house characteristics. Therefore, they realise that openings in house such as ventilations, doors and windows should be maximalized. Further, environmental ambiences (such as cleanliness and surrounding greeneries), traffic safety, and environmental safety are judged as the supplementary aspects in housing quality. The fifth priority aspect in the lowincome’s preferences is the physical aspect of the house. In discussing this aspect, the building materials (including its type, efficiency, price, quality, etc) is the most important thing, and then followed by the architectural style, yards, fences, carports, and the last is storey of the house. Afterwards, the sixth preferenceof the low-income is bonuses. This aspect is also critical because the low class always expect affordable down payment and cheap mortgage for their house, while the discounts, investation, and prize (when purchasing house) are less considered. Moreover, seen from ‘residences facilities’ as the seventh housing preference, low-income group in Surabaya tends to underline the worship facility (mosque, church, etc). Subsequently, they also prefer education facilities, commercial facilities (supermarkets, department stores, etc), culinary facilities, collective facilities (place for gathering), entertainment facilities, tourism facilities, and sport facilities as the last important thing to be provided in their residence area. 564 | Asea Uninet Scientific and Plenary Meeting 2016 Finally, the less prioritized aspects in low-income society’s housing preferences are house/residence location. One thing they know is that their house should be easily accessed by public transport, so that they can cheaply go to anywhere they want. Thereafter, an ideal housing location for the low class is the proximity to: workplace, education facility, hospital (medical and health facility), city center, main road, department stores (commercial facilities), family dwelling, culinary center, and tourism area. However, proximity to airports, clubhouse, and golf court are not important for them since those are less compatible with their daily lifestyle. 4.2 The Factor Analysis of Housing Preferences for Low-Income Society To identify the underlying dimensions amongst all assessment variables in this study, factor analysis process is done twice: the first is comprehensively based on the 8 main determined aspects, and the second is specifically based on the entire 41 variables (ignoring the groupings). The result of the first factor analysis process shows that the housing preferences for low income people in Surabaya Indonesia are divided into two main aspects: the internal (related to the house specifically) and the external (related to the residences area or something that is not directly related to the particular house). Diagram 02 represents the position and the order of eight main aspects in two groups. Diagram 02. The Result of Factor Analysis Based on The 8 Main Factors Source : Author’s Analysis, 2015 On the other hand, the result of the second factor analysis process based on the 41 variables shows that the low class’ housing preferences in Surabaya are classified into 9 groups of factors. The details are described as below:  Factor 1. Ideal Housing Criteria (Commercial) A housing that is equipped with facilities for: commercial, worship, entertainment, sport, education, and communal activitites. Also have easy access to tourism center, medical and health care, airports, stores, and near to family dwellings.  Factor 2. Ideal House Criteria (Commercial) A house that is equipped with descent infrastructure, front yard, double carport, adequate house size, affordable house price, good quality building material, and sufficient number of storeys.  Factor 3. Healthy Housing Criteria Asea Uninet Scientific and Plenary Meeting 2016 | 565 A house that is equipped with natural lighting system and natural air circulation system. Also, the housing area should have comfortable environment ambiences, such as cleanliness and greeneries.  Factor 4. Crucial Housing Criteria A house should be easily accessed by public transport, have legal land tenure, and located near from the workplace.  Factor 5. Additional Criteria (1) Be equipped with culinary facilities (or located near), located near a clubhouse, have a kind of prize when purchasing a house.  Factor 6. Financial Criteria Have discount when purchasing the house, housing investation, affordable down payment, and the cheap mortgage.  Factor 7. Surrounding Safety Criteria Have a safe surrounding roads and traffics, environmental safety (including CCTV, and guarded gate system), and have sufficient house fencing.  Factor 8. Additional Criteria (2) Housing that is located near culinary facilities, and near golf court  Factor 9. Proximity to The City Center Housing that is located near main roads or highways From these groupings, the factors that get high score based on the calculation result in SPSS program, and identified as the important factors for the low income people in Surabaya Indonesia are only factor 1 and factor 3. 4.3 Comparison of Housing Preference for Low-Income Society and The Others Housing preferences need to be specified in each society group. Any planning and provision of housing that ignores society preferences are commonly resulted in disparity phenomenon between user’s needs and developer's needs as the provider. People preferences in determining residences are vary because every individual has different wants and ideals, which are affected by diverse factors, including the levels of societies. Therefore, along with some similar studies, this research is identifying the priority aspects for housing preferences based on a society level: low-class, middle-class, high-class, educated, and small town residents. Subsequently, these identifications can be used as an underlying consideration in providing and planning any residences which are affordable and suitable for the targeted societies. The following Table 03 shows the comparison of housing preferences priorities among various groups. Priority High-Class Society Middle-Class Society Low-Class Society 1 2 3 Land House House Tenure Location Size 4 House Price 5 House Quality 6 7 8 House Housing Bonuses Physical Facilities Aspect Land Tenure House Price House Size House House House Housing Bonuses Quality Location Physical Facilities Aspect Land Tenure House Size House Price House House Bonuses Housing House Quality Physical Facilities Location Aspect 566 | Asea Uninet Scientific and Plenary Meeting 2016 Small Town Society WellEducated Society Land Tenure House Price Bonuses House Quality House Size Land House House Tenure Location Quality House Price House Size Housing House House Facilities Physical Location Aspect House Housing Bonuses Physical Facilities Aspect Table 03. Housing Preferences Comparison in Several Society Groups Source : Author’s Analysis, 2015 It can be seen that every level of society prioritizes a house with legal land tenure. Conversely, bonuses are considered as the less important aspect for educated, middle class, and high class group. While the low-income and small town people considered location as the last. In addition, residences facilities are less choosen amongst all because, each group tends to foster the internal aspect related to the house physically, like price, size, and quality. 5 CONCLUSION AND SUGGESTIONS Housing preferences for the low-income people are divided into two parts: the internal and the external aspect. Internal aspect consists of the factors related to physical aspect of house, while the external one is related to any factors outside the physical aspect of house, such as residences area. For all low-income people in Surabaya, legal land tenure is considered as the most important thing in housing, keeping in mind the awareness of their vulnerable house condition and its risk to be evicted. The internal aspect of the house, such as size, price, quality, and physical factors are being the subsequent considerations. These are preferred after land tenure because low income people really depend on their affordability, in order to attempt at least a minimum standard dwelling for their own. Cheap down payment and mortgage are also being the two expected things for them. However, the avalability of housing facilities as the external aspect is not considered as an important thing because so many internal aspects to afford. Beside that, in line with small town society, the house location is less prioritized by the lower class. Generally, housing preferences are necessary to be considered based on specific societal level, so that any housing provision can really deliver the ideal, suitable, and affordable housing solution for the targeted group. REFERENCES Akkila, Emmi Ilona. 2012. Master Thesis : Families Residing in Kallio – A Choice? University of Helsinki. Beamish, Julia O, dkk. 2001. Lifestyle Influences On Housing Preferences. Jurnal Vol. 28 No. 1 & 2, 2001. Virginia Tech. Jabareen, Yosef. 2005. Culture and Housing Preferences in a Developin City. Journal Environment and Behaviour, Vol. 37 No.1, Januari 2005. Sage Publication Khozaeia, F, dkk (2012). A Shorter Version of Student Accommodation Preferences Index (SAPI). American Transactions on Engineering & Applied Sciences. Volume 1 No.3. ISSN 2229-1652 eISSN 2229-1660 Koentjaraningrat. 1983. Metode-metode Penelitian Masyarakat. Gramedia. Jakarta Asea Uninet Scientific and Plenary Meeting 2016 | 567 Malahati, Cut Dhaifina. 2015. Faktor-Faktor yang Mempengaruhi Preferensi Bermukim di Kawasan Kampung Susuk Medan (Studi Kasus : Perumahan Classic Residence). Departemen Arsitektur Fakultas Teknik, Universitas Sumatera Utara, Medan Nurhadi, Imam. 2004. Preferensi Masyarakat dalam MemilihPerumahan Perkotaan Kota Tangerang (Studi Kasus : Perumahan Banjar Wijaya, Poris Indah. Dan Perumnas IV). Master Thesis. Universitas Diponegoro, Semarang. Peraturan Menteri Negara Perumahan Rakyat, Nomor 14 Tahun 2010 tentang Pengadaan Perumahan Melalui Kredit/Pembiayaan Pemilikan Rumah Sejahtera dengan Dukungan Bantuan Fasilitas Likuiditas Pembiayaan Perumahan Peraturan Menteri Pekerjaan Umum dan Perumahan Rakyat Republik Indonesia , Nomor 42/PRT/M/2015 tentang Bantuan Uang Muka Bagi Masyarakat Berpenghasilan Rendah untuk Meningkatkan Aksesibilitas Kredit/Pembiayaan Pemilikan Rumah Bersubsidi Rapoport, Amos. 2005. Culture, Architecture, and Design. Locke Science Publishing Company : Chicago, Illinois, USA Suliyanto. 2005. Analisis Data Dalam Aplikasi Pemasaran. Ghalia Indonesia, Bogor. Triyuly, Wienty. 2010. Identifikasi Preferensi Rumah Bagi Masyarakat Berpenghasilan Rendah Di Kota Palembang Berdasarkan Metode Hierarchical Cluster Dan Discriminant Analysis . Seminar Nasional “Metodologi Riset dalam Arsitektur” – Juni 2010. Teknik Arsitektur Universitas Sriwijaya, Palembang. Umilia, Ema & Serlin, Medina. 2013. Faktor-Faktor yang Mempengaruhi Masyarakat dalam Memilih Lokasi Hunian Peri Urban Surabaya di Sidoarjo. Jurnal Teknik Pomits Vol. 2, No. 2, (2013) ISSN: 2337-3539. Jurusan Perencanaan Wilayah dan Kota, FTSP, Institut Teknologi Sepuluh Nopember (ITS), Surabaya. Wildish, Bianca. 2015. Housing Choice and Preference : A Review of The Literature. Auckland Council Technical Report, TR2015/019 THE HOUSING PREFERENCE OF THE URBAN MIDDLE CLASS SOCIETY IN SURABAYA, INDONESIA Emiria Letfiani emiria20@gmail.com Magister student, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Andarita Rolalisasi andarita.rolalisasi@gmail.com PhD candidate, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Muhammad Faqih faqih@arch.its.ac.id Arina Hayati arina.hayati@gmail.com Lecturer, Department of Architecture, Laboratory for Housing and Human Settlement, Institut teknologi Sepuluh Nopember (ITS) Presented at the: ASEA-UNINET International Workshop Bali, 15th-18th, February 2016, Udayana University, Widya Sabha, Campus Bukit Jimbaran . Abstract Housing, neighborhood, and other built environments are used differently by different groups. Therefore evidence of attempts to make environment for supportiveness of various groups that congruent with their culture are need to be explored. This means that the fitness of the built environment is not only assumed by most architects or the modern movement practitioners, but also need to be examined from the preferred choice of people. The research objective discusses the housing preferences of the middle class society who live in the urban city of Surabaya, Indonesia. Because As previous research reviewed, the similar research does not conduct in Indonesia. The method is a quantitative empirical study. Variables of housing preference data were collected from housing advertise such as Jawa Pos Newspaper; theoretical review, previous research on housing preference, and brochures. Variables consist of location, supporting facilities provision, building of house, and quality of house, house size, plot size, price, installment, and bonus if available. Next step was conducting questionnaire from data which were collected and then the authors shared the questionnaire through social media such as facebook, application group like whatsapp, and email, because target respondents are those who use internet in their everyday life to simplify the collecting data. After those questionnaire were collected and being sorted, authors began to analyze their findings. The last step was writing the paper research. This research found that middle class society in Surabaya city are preferred to the land ownership status which related to the land legalization. Keywords: Housing, preference, middle class society group, urban, Indonesia. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 568 Asea Uninet Scientific and Plenary Meeting 2016 1 | 569 INTRODUCTION Housing expresses culture by its design or the use in everyday life. House forms, the internal layouts, and the layout of dwellings in a neighborhood can be disruptive or supportive of the culture of their occupants (Bochner, 1975; Ozaki, 2002; Rapoport, 1969). Altman and Chemer (1980) argued that family dwellings simultaneously to satisfy the needs of the occupants for personal identity and bonding with the community and culture at large. Rapoport (2005) describes how dwelling is closely related to human culture. Rapoport identified that housings, the neighborhood and the environment are used in different ways by different groups. Therefore the environment must be able to support a variety of group which is having the same culture. Shelter is a basic need of survival people. Residential needs illustrated how one survives (Beamish, 2001). Individuals and household have two options when choosing a dwelling that are the type of housing and the type of residential environment. Household choices are based on the need or the preference and restricted by income and opportunity offered of the housing market. Housing choices are closely linked to the selection of residential neighborhoods (Dieleman & Mulder, 2002). Choosing a dwelling is not as simple as it looks. The option of dwelling cannot be generalized due to the difference on any preferences and the needs of people. The diversity of housing preferences makes housing is not just a shelter. As well as the complexity of human life makes someone’s decision of housing influenced by many factors (Beamish, 2001). Previous research showed that economic variables such as income and the fairness of the election, dominated the pattern of housing preferences. Meanwhile, demographic variables such as age and number of family members also played an important role in the housing preferences (Clark and Dieleman, 1996, p. 135). This paper presented the empirical study result on the housing preferences of the middle class society who live in the urban city of Surabaya, Indonesia related to their culture, lifestyle, and the residential environment. As we know that nowadays housing needs is rising in line to population growth. Indonesia's population from 2000 to 2010 increased by 1.49% (Indonesia Statistic Bureau, 2015) which is a potential market of housing developers, but housing preferences cannot be generalized due to various types of human characteristic. Based on previous research, many factors influence the housing preferences, such as: age, income generation, social class group, environment conditions, adjacency to public facilities or family, as well as the decision in choosing preferred housing. Also, previous studies stated that housing preferences related to human culture and lifestyle. The study of housing preferences that associated with a social group of consumers will be very useful as a guide for provision of housing by developers and government. Moreover research on the housing preferences that related to social groups of community has never been done in Indonesia. The built environment in general and housing in particular, is used differently by different groups in order to support those groups that are congruent with their culture. This means that one size does not fit everyone as it is thought by most designers and modern movements (Rapoport 2005: 52). Product design should be designed to understand the characteristics of human being and also appropriate and supportive too. The design and its part should be able to support the user, and also accordance with their want and activities (Rapoport 2005: 1). Preferences are related to culture (Rapoport, 2005: 69) and the culture is related to lifestyle (Rapoport, 2005: 107). Choosing a residential environment not only depends on system of settings and its context, but also depends on the quality of a particular environment in a particular system, in certain systems, trade-offs between the travel time 570 | Asea Uninet Scientific and Plenary Meeting 2016 and the size or type of housing, the environment or the quality of housing, and other social characteristics and so forth. People modify the environment in various ways; most often is modified semi-fixed elements such as furniture. This showed that 'want' is often play as important role than 'need' in the preferences and choices (including in the design), and ‘want’ is closely linked to the meaning and culture (Rapoport 2005:54). Jabareen (2005) found that housing preferences in Gaza is determined by the cultural components, mainly those related to issues of gender, politics, religion, kinship and social relations. Among the components of culture, kinship and attitude towards women are important variables for the Palestinian to find a new home. Palestinian preferred to stay close to his extended family than live with multifamily which affects the privacy of the family, especially women in the household. The housing preference that related to lifestyle is influenced by many factors these are age, education, socio-economic status, income, wealth, number of children, marital status, location, value, and hobbies that affected to lifestyle. Wendell Bell described the urban people lifestyle differentiated to : the career person - it is important to close the workplace because it takes a short time to go to work; kinship – emphasized to family activities space and time that they spent with their family; and consumership – people who focus to have a new goods and services. Lifestyle of each person is unique. But the factors basis such as demographic characteristics (age, household size) and socioeconomic (income, education) helped showing their lifestyle. Value and want also help in characterizing the lifestyle of individuals and families (Beamish 2001: 3-19). Culture influences lifestyle and preferences (Rapoport 2005: 108). Lifestyle is the result of choices and its influence the design. For example housing arrangement influenced by religion in Bangladesh, a kitchen is a place for cooking the food fatty and spicy for many households and guests requiring a spacious kitchen. Moreover privacy in housing arrangement can be influenced by religion, for example , the living room and the dining room had to be separated between women and men. It shows that privacy prevents women from visiting male guests (Rapoport 2005: 109). Preferences can be seen as a potential option (Hasu, 2010). Options can be seen as the 'appearance' of preferences (Coolen & Kasper, 2003; Calpham, 2002; Giddens, 1991). 'Want' plays more important role than the 'need' in the preferences and choices (include choice on design process) and the ‘want’ associated to meaning and culture (Rapoport, 2005). There were two options of dwelling choice that made by individuals and household these are the type of dwelling and the type of environment. The choice made by particular household is guided by the needs or preferences and restricted by income generation and opportunities offered by the housing market. The choice of a specific dwelling is inextricably connected with the choice of the desired residential environment (Dielman & Mulder, 2002, in Jabareen, 2005). This study is focus on the housing preferences for the middle-class society, so the understanding about middle class society is needed to know. Several criteria are proposed to determine a social community group. Asian Development Bank (ADB) described that middle-class society has range per capita per day expenditure of USD 2 - USD 20 (ADB, 2015). According to Kompas Research Center referred to the World Bank criteria stated that the middle class community has daily expense about US $ 10 - 40 (equivalent to IDR. 138,000 - IDR. 552 000 a day) (Kompas, 2015). Herru Widiatmanti (2015) stated that the middle class community group is a socioeconomic term between the working class and their upper class community group. Those include professionals, advanced workers and management. They earn between IDR. 2.6 million 6 million (www.bppk.kemenkeu.go.id, 2015). This study referred to the Ministry of Finance RI Asea Uninet Scientific and Plenary Meeting 2016 | 571 criteria that middle-class community group is people who earn between IDR. 2.6 million 6 million a month. 2 RESEARCH METHODS This study uses a quantitative method which is described through the factor analysis. The factor analysis is a technique which used to find factors to describe a correlation among variables. The data were collected through questionnaire which built by google docs then we shared it through group application such as whatsapp and line’s group and e-mail to respondents who live in Surabaya and use internet in everyday life. The minimum target of respondent is 100 respondents who earn income 2.6 million to 6 million rupiahs based on the determined of Herru Widiatmanti about middle class society. To fill the questionnaire, respondents are asked to assess their priority using point 1 (least important) to 8 (most important). After the data were collected, then the data were analyzed by using factor analysis in SPSS. The Variables First, we reviewed the housing theories such as Rapoport’s (2005), Beamish’s (2010) and Turner (1972). Second, we reviewed the housing advertisments in newspapers and brochures. We found eight variables that are: (1) the physical aspect; these are the design style (minimalist, traditional, etc), additional space (such as double carport and front yard), fence design, building material, number of storey, (2) the quality of houses, these are air circulation system, natural lighting, security system (CCTV, one gate system, etc), traffic safety, infrastructure (sanitation, electricity, etc), the environment (green, clean, healthy, etc), (3) the house size, (4) the house price, (5) the house location, these are accessed by public trasportation, close to main road, family, education facility, work place, city center, airport, tourism, shopping center, hospital, culinary, golf course, and club house, (6) availability of the housing facilities, such as sport-center, education, entertainment, tourism, gathering, worship, shopping center and culinary facility, (7) bonuses, such as prizes, investment, affordable down payment, discount, affordable house price, and (8) land ownership. 3 3.1 FINDINGS AND DISCUSSION Respondents Overview In this study, we gained 108 respondents. They are 62% women and 38% men. All respondents are productive age group: 25-40 years old (47%), 41-50 years old (41%), and the rest are 51-65 years old. Most respondents have master degree (63%) with various occupation that are civil servant (25%), lecturers/teachers (21%), entrepreneurs (16%), students (2%), Self-employee (4%), Housewife (11%), employees (15%), Retired employees (3%), MC (1%), Farmers (1%), and lawyers (1%). Most of the respondents are married, having a house, living with main-family and the average of household number are about 3-6 people. 3.2 Housing Preferences of the Urban Middle Class Society in Surabaya, Indonesia The following diagram below shows the priority of housing preferences for middle class society in Surabaya. 572 | Asea Uninet Scientific and Plenary Meeting 2016 Diagram 1. Housing Preferences of Urban Middle Class Society of Surabaya PREFERENCES' DIAGRAM 100 90 80 70 60 50 40 30 20 10 0 97 96 96 95 92 91 86 78 Source: Authors Analyzed Result, 2015 Based on the diagram above, we can see that land ownership is the highest priority for the middle class society. The second priority is house price and then house size, house quality, housing location, the house physical aspect, supporting facilities which is available in residence and the last is bonuses. The value of priority is not too significant as the awareness of respondents of every aspects is important for them. The Factor Analysis of housing preferences for middle class society Number of variable is used in this study are 41 variables which already grouped into 8 groups. For the next analysis uses factor analysis with SPSS program to reduce the data, so that correlated data can be grouped. After conducting analysis factor through SPSS program, we achieved 10 factors with random variables in every factors. The following factors shown below : 1. Factor 1 consist of : security system, close to city center, main road, airport, and discount. 2. Factor 2 consist of : close to education facility, hospital, and family residence; and availability of worship and gathering facility in residence. 3. Factor 3 consist of : air circulation system, natural lighting, close to work place, investment, affordable down payment and price. 4. Factor 4 consist of : close to shopping center; availability of sport, shopping center and entertainment center facility in residence. 5. Factor 5 consist of : house price, housing environment, additional space (double carport). 6. Factor 6 consist of : house size, accessed by public transportation, additional space (front yard), education facility. 7. Factor 7 consist of : tourism facility. 8. Factor 8 consist of : house style and traffic safety. 9. Factor 9 consist of : building material and infrastructure. 10. Factor 10 consist of : close to tourism facility and golf course. Asea Uninet Scientific and Plenary Meeting 2016 3.3 | 573 The Housing Preference Comparing Between Social Classes of Community Group and Location As this research was conducted, similar studies were also carried out with different target of respondent group. Four groups of respondent target are living in the city of Surabaya and one group is living in countryside of Surabaya. The respondents are lower, middle, and upper of economic classes and high educated class of society. Based on questioners’ analysis comparison, we found that the highest housing preference is about the legality of land ownership. The housing preference of urban middle class society of Surabaya seems similar with preference of urban upper class and high educated class (see the Table 1). Researches on the housing preference of various community group respondents are important for the guideline of the housing provision in accordance with the target housing consumers by the house developers and government. Tabel 1. The Housing Preference Based on the Community Social Class and its Location Urban Lower Class Urban Middle Class Urban Upper Class High Educated Class Land Ownership Land Ownership Land Ownership Land Ownership House Size House Price Housing location Housing location House Price House Price House Size House Size House Quality Bonus House Quality House Quality House Price House Price House Quality The house physical aspect Housing location House Quality House Size House Size Bonus The house physical aspect The house physical aspect The house physical aspect Supporting Facilities Provision Supporting Facilities Provision Supporting Facilities Provision Supporting Facilities Provision Supporting Facilities Provision The house physical aspect Housing location Bonus Bonus Bonus Housing location Land Ownership Small Town (countryside) Source: Authors Analyzed Result, 2015 4 CONCLUSION AND SUGGESTION Based on the result above, we can see that middle class society prioritizing land ownership which is it can be the proof of legal ownership of their land. Afterward, house price is being the second priority because it is related to their income. The third priority is house size which is related to family size. the fourth priority is house quality which is related to air circulation system, natural lighting, etc. The fifth priority is the housing location which is related to the closeness of their house to some facilities such as education, hospital, shopping center facility, etc. The sixth priority is the house physical aspect which is related 574 | Asea Uninet Scientific and Plenary Meeting 2016 to the house style, building material, etc. The seventh priority is availability of housing facility and the last is bonuses. The conducting of this research is very useful for the government of Surabaya and developers to provision housing and to resolve the housing demand in accordance to the society class. Besides of land ownership, middle class society is also take a look at the house price which is affordable for them. So, based on this research, the government and developers have some consideration in provision housing. In this study, the research was conducted in Surabaya city and researcher expecting that there will be a wider research’s target about housing preferences to help government and developers for housing supply because a research in this field is very rare in Indonesia. REFERENCES Rapoport, Amos. (2005). Culture, Architecture, and Design. Chicago, Illinois, USA : Locke Science Publishing Company. Asian Development Bank, 2015. Siapa Kelas Menengah? (accessed from okezone.com on December, 3rd 2015) Norberg-Schulz, Christian. 1985. The Concept of Dwelling. University of Colorado Liberaries : Boulder. Department of Housing and Planning. The Housing We’d Choose : a Study for Perth and Peel. Western Australia : Housing Report. Akkila, Emmi Ilona. 2012. Families Risiding in Kaillo a Choice?. Master Thesis. Faculty of Social Science, University of Helsinki. Coolen, Henny dan Ozaki, Ritsuko. 2004. Culture, Lifestyle and the Meaning of a Dwelling. Netherland : OTB Research Institute for Housing, Urban and Mobility Studies. Delft University of Technology. Widiatmanti, Herru. 2015. Penghasilan Kelas Menengah Naik = Potensi Pajak?. Badan Pendidikan dan Pelatihan Keuangan Kementerian Keuangan (bppk.kemenkeu.go.id) Messters, Jannie dan Coolen, Henny. 2009. Dismantling the Dwelling –A Systematic Approach to Investigating the Meaning of The Dwelling. Netherland : OTB Research Institute for Housing, Urban and Mobility Studies. Delft University of Technology. Beamish, Julia O, dkk. 2001. Lifestyle Influences On Housing Preferences. Jurnal Vol. 28 No. 1 & 2, 2001. Virginia Tech. Kompas, 2015. Siapa Kelas Menengah Indonesia? (accessed on December, 3rd 2015) Ahlbrandt, Roger S. 1984. Neighborhoods, People and Community. New York and London : Plenum Press. Bochner, S. 1975. The House Form as a Cornerstone of Culture. In R. W. Brislin (Ed.), Topics in Culture Learning (Vol. 3, pp. 9-20). Honolulu, HI : East-West Centre. O’Riordan, Timothy. 1976. Human Behaviour and Environment. New York : Plenum Press. Kubo, Tomoko. Changes in the Housing Market in Tokyo : Residential Preferences and Condominium Supply. Meiji University. Triyuly, Wienty. 2010. Identifikasi Preferensi Rumah Bagi Masyarakat Berpenghasilan Rendah Di Kota Palembang Berdasarkan Metode Hierarchical Cluster Dan Discriminant Analysis . Seminar Nasional “Metodologi Riset dalam Arsitektur” – Juni 2010. Teknik Arsitektur Universitas Sriwijaya, Palembang. Jabareen, Yosef. 2005. Culture and Housing Preferences in a Developin City. Journal Environment and Behaviour, Vol. 37 No.1, Januari 2005. Sage Publication. THE EUROPEAN UNION CONTEMPORARY RAPPROACHMENT TO ASIA PACIFIC COUNTRIES Evi Fitriani evi.fitriani09@ui.ac.id International Relations Department, University of Indonesia Abstract The European Union has developed as an active international actor especially in the last two decades. This regional institution has not only pursued trading and economic interests of the member countries but also promoted another role as the champion of human rights, democracy and environment in many parts of the world. This article addresses EU relations with Asia Pacific by focusing on EU interactions with the Association of the Southeast Asian Nations (ASEAN) and Australia. ASEAN and EU relations have been established since 1970s. This region-to-region engagement has gone through three crises that shape not only the nature of the relations but also the perceptions of each side towards each other. The first is the strained relations during 1980s due to different political values. The second is the Asian financial crisis that hit some ASEAN countries towards the end of 1990s; the crisis that switched European previous interests and hopes from Asia. However, the most recent event is the financial crisis in the Euro zone that is concomitantly with continuously high economic growth in East Asia, including main countries in ASEAN. As the result, ASEAN countries seem to perceive the EU as an important partner, especially for their market, but the character of the inter-regional relations is likely to change.As a former penal colony of the Britain, Australia is a traditional partner of the EU. Australia and EU member states also share many political, social, and cultural values. Naturally, the relations between EU and Australia are much closer and developed. In the context of EU crisis and the high growth in Asia, this article observe EU approach to ASEAN and Australia. Would the traditional links sustained amids amounting economic interests? Or would the EU and Australian harnes their long-established connections to deal with ASEAN countries? The article applies historical, rational and constructivist approaches. It will contribute to the literature on EU and Asia-Pacific. Keywords: EU-ASEAN, EU-Australia, EU external relations, EU in Asia Pacific 1 INTRODUCTION Since the 1990s, the European Union (EU) has participated in global affairs as an active international actor. In many parts of the world, this regional institution has not only pursued trade and economic interests for its member countries, but also promoted another role as the champion of human rights, democracy, and the environment. The former role is aligned with EU’s traditional goals in undertaking external relations, whereas the latter is associated with newly shaped concerns. These two kinds of interests often turned the EU’s Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 575 576 | Asea Uninet Scientific and Plenary Meeting 2016 diplomatic maneuvers into contradictions which, in turn, have resulted in inconsistent and ineffective external policies.48 The EU’s insufficient institutional capability and its member states’ divergent interests also challenge external diplomacy. These phenomena appear in the EU’s relationships with the Association of Southeast Asian Nations (ASEAN) beginning in the early 1980s and with Australia beginning in the early 1960s. Recently, the EU approached Asian countries more intensively to seek economic opportunities in the world’s fastest growing region to balance the setbacks resulting from the financial crisis in the Eurozone. This article addresses the EU’s contemporary relationships with Asian countries by focusing on its interactions with two partners, namely ASEAN and Australia. It includes an analysis of the EU’s approaches to two partners in the context of the financial crisis in the Eurozone and the growing economies in East Asia. How do the EU’s approaches differ for ASEAN countries and Australia? What strategies were employed by the EU in dealing with these different types of partners? Would the EU’s historical linkages with Australia be sustainable amidst mounting and often-competing economic interests of the Europeans and the Australians, or, would the EU and Australia harness their long-established connections to obtain better deals with Asian, particularly ASEAN, countries? These questions are focal points of this study. It aims to clarify and understand the EU’s motivations, strategies, and interactions with different partners in the same region. Although others have argued that the EU was constrained in its efforts to act as a competent international actor, nevertheless this study shows that the EU has been able to apply different strategies for its diverse partners, despite the same underlying motivation to pursue economic gain. The EU seems to have taken advantage of its historical linkages and shared values with Australia to revitalize its traditional relations with the country, but it has overlooked the dynamics of ASEAN-Australian relations. This article combines historical, rational, and constructive approaches to analyses. It traces the diplomatic histories between the EU and ASEAN, as well as between the EU and Australia before analyzing current trends. The article applies qualitative methodology through the comparative study. Data were collected from official documents, a literature review, and interviews with key actors. Previous studies on post-colonial relations between the EU and ASEAN are available. So is the literature on the EU and Australia relations. Studies on EU-ASEAN relationships spread in various dimensions, from politics and economics to culture,49 and from comparative regional integration to inter-regionalism.50 They are often included in B. Rosamond, “Three Ways of Speaking Europe to the World: Market, Peace, Cosmopolitan Duty and the EU’s Normative Power,” The British Journal of Politics & International Relations, Vol. 16, 2014, pp. 133-148. 49 E. Palmujoki, ‘EU-ASEAN Relations: Reconciling Two Different Agendas’, ContemporarySoutheast Asia, Vol. 19, No. 3, 1997, pp. 269-285. M. Leifer and S. Djiwandono, ‘Europe and Southeast Asia’ in H. Maull, G. Segal, & J. Wanandi (eds), Europe and the Asia Pacific, London: Routledge, 1998. G. Wiessala, ‘Catalysts and Inhibitors—The Role and Meaning of Human Rights in EU-Asia Relations’, CERC Working Papers Series, No. 1, Melbourne: University of Melbourne, 2007. G. Forster, ‘The European Union in South-East Asia: Continuity and Change in Turbulent Times’, International Affairs, Vol. 75, No. 4, pp. 743-758. 48 M. Petersson, ‘Myanmar in EU-ASEAN Relations’, Asia-Europe Journal, Vol. 4, No. 4, 2006, pp. 563-581. A. Acharya, Constructing a Security Community in Southeast Asia: ASEAN and the Problem of Regional Order, London: Routledge, 2009. E. Fitriani, Observing ASEM from Southeast Asia, Singapore: ISEAS, 2014. B. Wilson, ‘Regional Policy in the EU Mode of Regionalism: 50 Asea Uninet Scientific and Plenary Meeting 2016 | 577 the literature regarding EU-East Asia relations.51 Similarly, the literature on EU-Australia varies from a historical focus (culminating with the contemporary stage) to a focus on strategic energy and environmental issues.52 However, the existing literature does not focus on triangular relations between the EU-ASEAN and EU-Australia. Comparative studies on these parties in the context of shifting global power and the EU crisis are also insufficient. This article contributes to the literature on EU diplomacy in Asia as well as on EU interregional relations with ASEAN and bilateral engagement with Australia. 2 WHY STUDY THE EU’S RELATIONS WITH ASEAN AND AUSTRALIA? The EU is an endless source of academic enquiries not only because it is the oldest institution of regional integration that has inspired many similar movements in other parts of the world, but also because it is a successful peace project that could bring adversary countries in a war-torn continent like Europe to build and pursue common goals. However, the EU’s efforts to act as a single international actor are often hindered by its nature as a political and economic entity with power that depends on its sovereign member states. A comparison of the EU’s approach toward ASEAN and Australia is interesting academically because almost all ASEAN member states and Australia were colonies of EU member states with divergent post-independent paths. Southeast Asian countries typically build their own Asian identities and become enmeshed in political and economic linkages with non-European partners.53 By contrast, Australia has maintained its European connections through the present time; it has even recognized Britain’s Queen as the head of state.54 This study is timely because the EU is experiencing a financial crisis, yet ASEAN and Australia are located in a region currently perceived as of the world’s economic growth. Implications for Asian Integration’, Australian and New Zealand Journal of European Studies, Vol. 4, No. 2, 2013, pp. 17-29. 51 L. Yeo, Asia & Europe: The Development and Different Dimensions of ASEM, London: Routledge, 2003. Fort and Webber (eds.), Regional Integration in East Asia and Europe: Convergence or Divergent?London: Routledge, 2006. M. Beeson, Regionalism and Globalization in East Asia: Politics, Security and Economic Development, New York: Palgrave Macmillan, 2007. 52 B. Grant, The Crisis of Loyalty: A Study of Australian Foreign Policy, Canberra: the Australian Institute of International Affairs, 1972. E. Thompson, ‘The EU and Southern Cross: The Effects of EU Energy Policy on EU-Australia Energy Trade’, Australian and New Zealand Journal of European Studies, Vol. 3, No. 2, 2011, pp. 18-32. EU Delegation to Australia and New Zealand, Celebrating 50 Years: EU-Australia, Canberra, 2013. 53 M. Osborne, Southeast Asia: An Introductory History, 11th Ed, Sydney: Allen & Unwin, 2013. G. Singleton, D. Aitkin, B. Jinks, & J. Warhurst, Australian Political Institutions, 5th Ed, Melbourne: Longman, 1997. 54 578 | Asea Uninet Scientific and Plenary Meeting 2016 Table 1. Basic Profile of the EU, -ASEAN and Australia EU ASEAN Australia Member states 27 10 1 Population (in millions) 504 600 22 GDP (in trillion US$) 16 2.2 GDP per capita (in US$) 32000 3600 EU two-way Trade in Goods (in € billions)* - EU two-way Trade in Service (in € billions)* - EU investment (in € billions)* - 2010: 2011: 2012: 2010: 2011: 2012: 2011: 148.9 164.6 181.4 40.1 45.9 51.1 271.1 2010: 39.4 2011: 46.1 2012: 48.3 2010: 18.6 2011: 21.8 2012: 23.1 2011: 159.2 Sources: Various Data from http://ec.europa.eu/trade/policy/countries-and-regions The significance of this study derives from several considerations. First, comparing the EU’s relationships with ASEAN and with Australia involves observing how continuity and change take place in international relations. With high economic growth and expanding markets, East Asia—both Northeast Asia and Southeast Asia—has been supporting the global economy when traditional world powers like the U.S. and Europe are dealing with economic crises. Western countries may maintain their positions as the largest global economies; however, their capabilities to shape the world’s economy and politics have relatively been reduced considerably, and their futures depend increasingly on Asian markets. With the shift of world power to Asia, it is important to observe the interactions of traditional powers like the European countries with ASEAN member states and Australia to identify continuity and change. This study could also reveal how historical linkages — be they pleasant or painful— play roles in contemporary international relations. Second, the study promotes understanding of the EU’s strengths and weaknesses as an international actor, in dealing with two different types of partners: a regional institution (ASEAN) and a single country (Australia). The findings will be significant for building further knowledge regarding the EU’s external relations and inter-regionalism. The third consideration is the invisible influence of the U.S. and China. This study does not focus on these two major powers, yet they seem to shape the interactions of the EU-ASEAN and EU-Australia. Thus, this study could reveal where the place for the EU is in contemporary Asia. Asea Uninet Scientific and Plenary Meeting 2016 3 | 579 EU-ASEAN RELATIONS: STRAINED BUT ECONOMIC INTERESTS PREVAIL The EU-ASEAN relationship has been long-lasting but strained. In 1977, the ASEAN Ministerial Meeting agreed to establish cooperation with the European Economic Community (EEC). This decision was followed by the first EU-ASEAN Ministerial Meeting in Brussels. The second meeting took place in 1980 in Kuala Lumpur, where the two regional institutions created the EC-ASEAN Cooperation Agreement and set up the Joint Cooperation Committee (JCC). However, closer relations were hindered by political tensions. In the 1980s and early 1990s, some EC member states condemned circumstances pertaining to political and human rights in various ASEAN member countries.55 Europeans were critical of political and economic practices of authoritarian regimes that were rampant in Southeast Asia at the time. In the eyes of the Southeast Asian countries, the Europeans were regarded as hypocrites. Memories of European colonialism and imperialism were still fresh for Asians. A typical refrain was, “After all [the] destructions and exploitation carried out by European countries for centuries in Asia, Africa, and America, how could the Europeans talk about human rights and economic fairness?” For the Southeast Asian regimes, partly to defend their misconduct and partly to articulate the Asian perceptions of Europeans, the Europeans simply did not have the credibility to criticize human rights practices. As an inter-governmental organization, the ASEAN expressed those feelings to the EC. Indeed, the five ASEAN countries at the time—Indonesia, Thailand, Philippines, Malaysia, and Singapore—shared the opinion that European countries had violated the ASEAN’s principle of non-interference by commenting on their domestic affairs. The “non-interfere” principle was applied among ASEAN countries as a code of conduct agreed to in the Treaty of Amity and Cooperation (TAC) in 1971. ASEAN countries demanded that all partners respect this principle; however, the EC countered that Asian countries were bound by universal values stipulated in the 1948 UN Declaration of Human Rights. This political tension not only constrained the relations between the EU and ASEAN countries, but it also sparked criticism toward “the ASEAN way.” It was perceived as hindering ASEAN relations with Western countries and hampering further development of the ASEAN institution. In addition, the Europeans’ criticism of Southeast Asian countries indicated that European colonial behavior was prevailing. The tendency of Europeans to act with an air of superiority, evidenced by easily commenting according to their own perspectives, has created distance between the Europeans and the Asians. There were some efforts to stimulate EC-ASEAN economic relations at the end of the 1980s, but they were hindered by political problems. Two initiatives—the ASEANEuropean Business Council and the ASEAN-EC Working Group on Industrial Cooperation—were created, but there was no corresponding political support. After the Maastricht Treaty was signed, one organ within the EU –the European Commission- paid attention to East Asia because some countries in the region recorded impressive economic growth, a phenomenon known as the “Asian Miracle.” The Commission issued a strategy in 1994 (i.e., New Asia Strategy) with an initial objective to strengthen the EU’s economic presence in Asia and to maintain the European leading role in the world economy.56 Subsequently, the EU involved in ASEAN regional initiatives 55 Palmujoki, Op. cit, Patersson, Op.cit. Wiessala, Op. cit. Commission of the European Communities, Communication from the Commission to the Council, C0M (94) 314 final, Brussels, 13,July 1994. 56 580 | Asea Uninet Scientific and Plenary Meeting 2016 such as the Asian Regional Forum (ARF) began in 1994- and the Asia-Europe Meeting (ASEM), which began in 1996. Nevertheless, the European tendency to interfere in domestic affairs of ASEAN countries caused a crisis in EU-ASEAN relations. The EU condemned Southeast Asian countries for supporting Myanmar’s efforts to become an ASEAN member in 1997; in 2004, the EU rejected an ASEAN proposal to accept Myanmar to the ASEM. In the ASEM case, the ASEAN countries managed to take a diplomatic gain from the EU due to China’s support; the EU gave in to maintain relations with Asian countries.57 However, the Asian financial crisis at the end of the 1990s changed European attitudes toward Asian countries. Despite meaningfully helping damaged Asian economies, the EU took advantage of the crisis by strategically cornering Asian countries into affiliating with global financial institutions whose key actors were EU countries.58 For the ASEAN countries, their experience with Europeans in the financial crisis showed that they were not genuine partners, as their economic motives superseded the ideal objectives of partnerships. Although the Europeans appeared to behave rationally, they lost the Asians’ trust. Clearly, recognizing trusted and reliable partners during times of needs is important in the Asian cooperative culture. A decade after the Asian financial crisis, the World Bank Report in 2007 stated that Asian economies grew even stronger than before the crisis. The EU responded quickly by approaching ASEAN countries. The Nuremberg Declaration on an Enhanced EUASEAN Partnership was signed in March 2007. In November, the first ASEAN-EU Commemorative Summit was held in Singapore, and the plan to establish region-to-region free trade was adopted. This plan was abandoned in 2009 because the EU was experiencing difficulties in negotiations with ASEAN member countries, with their highly diverse economic levels and political postures. Subsequently, the EU established bilateral free trade agreements (FTAs) with certain ASEAN countries like Singapore. It is currently negotiating FTAs with Malaysia, Vietnam, and Thailand. However, a negotiation for the Comprehensive Economic Partnership Agreement (CEPA) with Indonesia has been hindered by the EU’s position to maintain complementary trade relations, which keeps Indonesian commodities at unfavorable terms of trade. The EU also places tariffs as well as non-tariff barriers on Indonesia’s exports, which include forestry products and crude palm oil (CPO). The economic relations between EU and ASEAN countries have developed, although not on a full scale. Despite a decrease in trade since the Asian financial crisis at the end of the 1990s, EU countries are ASEAN’s second biggest trading partner after China. In investments, the EU maintains its position as an economic power by supplying foreign direct investment (FDI) to ASEAN countries. In the midst of the financial crisis in the Eurozone European countries were the major source of FDI to Southeast Asian countries from 2009 to 2011.59 57 Fitriani, Op. cit. Far Eastern Economic Review ‘What a Different a Crisis Makes’, Vol. 161, Issue 6, 16 April 1998, p. 63. See also G. Richard and C. Kirkpatrick, ‘Reorienting Inter-Regional Cooperation in the Global Political Economy: Europe’s East Asia Policy’, Journal of Common Market Studies, Vol. 37, No. 4, 1999, pp. 687-710. J. Ruland, ‘The EU as an Inter-Regional Actor: The Asia-Europe Meeting’ in S. Chirativat. F. Knipping, P. Lassen, and C. Yue, Asia-Europe in the Eve of the 21st Century, Bangkok: Centre for European Studies, Chulalongkorn University, 2001. 59 ASEAN Secretariat FDI Statistic 2013. 58 Asea Uninet Scientific and Plenary Meeting 2016 | 581 Recently, the EU engaged in intensive economic and security diplomacy with ASEAN countries. In 2012 and 2013, there were more than 50 visits by EU leaders and officials to Southeast Asian countries.60 In 2012, EU and ASEAN leaders agreed to take the cooperation a higher level by launching the ‘Bandar Seri Begawan Plan of Action to Strengthen the ASEAN-EU Enhanced Partnership’ and by acceding the EU to ASEAN’s TAC. There are three factors that seem to encourage EU’s current rigorous approach to ASEAN countries. First, economic performance and the growing middle class in ASEAN countries drive the EU to expand markets for European products to recover from trade deficits with Southeast Asia and the financial crisis. Second, the EU’s interest in the Chinese market greatly surpasses its interests in Southeast Asian countries. However, China-EU relations are hindered by economic, political, environmental, and cultural issues. It would be difficult to counter the argument that the ASEAN relationship is an indirect way for Europeans to approach the Chinese market. Third, some initiatives were created by the EU to advance its role beyond that of a trading power. With the increasing political and economic roles of Asian countries on the world’s stage, it seems that Europeans do not want to be left behind in developing relationships with these countries. Thus, seventeen years after the Asian financial crisis and four years after the crisis spread throughout the Eurozone, the EU is attempting to take advantage of economic opportunities in Southeast Asia once more. This time, Asian geo-economics are much stronger. The ASEAN economies are growing relatively strong and ASEAN is the only one has a FTA with China. The EU is still an important partner for ASEAN, but the character of those inter-regional relations is likely to change. 4 EU-AUSTRALIA RELATIONS: REVITALIZING HISTORICAL TIES FOR ECONOMIC INTERESTS? Australia is a traditional partner of the EU because it was a British colony. Australia and EU countries also share many political, social, and cultural values. Indeed, the majority – albeit a decreasing majority- of the Australian population are the descendants of European immigrants; furthermore, the country’s political and social institutions are, predominantly, imitations of European institutions.61 Naturally, relations between the EU and Australia are close. However, the two had difficult relations in the past because of two events: the accession of the UK to the European Economic Community (EEC) in 1973 and implementation of the EU Common Agricultural Policy (CAP). As a trading nation that depended mainly on exports of agricultural products to Britain, Australia was badly hurt by the two events. Australia’s trade was threatened with European integration. Traditionally, the Australian economy depended on Europe, particularly the UK. Previously, Australia had sent its high quality wool, butter, meat, and other agricultural products to Britain. Australia already felt vulnerable when the EEC was established in 1958. The feeling became stronger as there were fears that the UK would join the Community. The accreditation of Australia’s Ambassador Sir Edwin McCarthy to the EEC in Brussels in 1962 was designed to closely 60 J. Wilson, Ambassador of the EC Representative to ASEAN and Indonesia, in his speech in ‘the EU-ASEAN Economic and Policy Forum’ in the ASEAN Secretariat in Jakarta, 18 April 2013. 61 Singleton et al. Op. cit. 582 | Asea Uninet Scientific and Plenary Meeting 2016 follow the negotiation for the UK to join the Common Market.62 When the former colonial power eventually acceded to the EEC, Australia felt left behind, as expressed by Peter Doyle from the Department of Foreign Affairs and Trade (DFAT), ‘For many in Australia, the British accession to the EEC in 1973 was quite a traumatic experience because we lost the preferential trade access for our agricultural goods, but we also felt abandoned by mother England.’63 The British accession the European Common Market meant that Australia’s products not only lost their special marketing access to the UK, but they also had to face fierce competition against products from other European countries. When the EEC finalized the negotiations for CAP, Australia was once again affected negatively by European’s policy. Thus, trade in agriculture became the thorny issue in EU- Australia relations during the 1970s, 1980s, and 1990s. Because of its profound impact on Australian economy, CAP became the concern of many stakeholders including the government, business community, scholars, and others. The establishment of a permanent EU delegation in Canberra and the commencement of ministerial consultation in 1981 did not mitigate the acrimonies. Subsequently, Australia convened other countries in Cairns in 1986 to oppose subsidies in agriculture. The Cairns Group is chaired by Australia and calls for the reduction of agricultural subsidies globally. Until recently, trade difficulties have shaped Australia’s perceptions and attitude toward the EU. In the last decade, there have been signs of improved relations between the EU and Australia. The change in the post-Cold War era gave momentum for Australia and the EU to overcome their trade conflicts and move beyond their differences. The CAP reformation in 2003 reflects the EU’s response to criticism from other countries, including Australia. Currently, the EU-28 is Australia’s second largest trade partners for goods and services after China and the biggest source of foreign investments.64 These strong economic connections have taken shape after the EU-Australia Partnership Framework was signed in October 2008. Since 2012, there have also been negotiations for a formal framework of economic agreement between the two entities. However, an FTA between Australia and the EU was not sought from 2010 to 2013 because of challenges related to CAP.65 Nevertheless, diplomatic relations have been more intensive with exchanged visits of high-level officers from the EU and Australia. Indeed, the relations have developed beyond trade. The EC-Australia Agreement on Scientific and Technical Cooperation came into force in 1994, and a newer agreement was reached in 2007. The 18th Ministerial Consultation in 2002 included discussions on immigration and multicultural/indigenous affairs. The discussion expanded to asylum seekers in 2003. In addition, the Security Dialogue has been conducted since 2003. The Agreement on the Security and Classified Information was signed on 13 January 2010, and another agreement between Australia and the European Atomic Energy Community (Euratom) was reached in 2011. This cooperation was extended in the Agreement between the European Union and Australia on the processing and transfer of Passenger Name Record (PNR) data in 2012. The EU and Australia have also cooperated on environmental issues since 2009; in 2011, they discussed the emissions trading system. Human rights issues relating to Aborigines and asylum 62 EU Delegation to Australia and New Zealand, Op. cit., p. 26. Ibid, p. 22. 64 Ibid, p. 34. 65 B. Nelson, ‘EU-Australia Relations: Views from the Coalface‘, Speech given at the Smart, Sustainable and Inclusive: Researching the EU from Australia and New Zealand Conference, conducted at the Australian National University, Canberra, 9 September 2013. Dr. Brendan Nelson was the Australian Ambassador to the EU from 2010 to 2013. 63 Asea Uninet Scientific and Plenary Meeting 2016 | 583 seekers seem to take a backseat to economic interests of the two sides in EU-Australian relations. Additionally, the EU and Australia have given considerable attention to Asia. In the wake of the Asian financial crisis in 1998, ‘Australia-EU Troika Talk on Asia’ began; they continued in 1999, 2000, 2001, and 2003. Australia also joined the ASEM in 2010. This inter-regional institution currently includes 51 Asian and European states, European Commission and ASEAN Secretariat. In ASEM, the EU and Australia try to coordinate their cooperation based on their common values and kinship in dealing with Asian countries. In a discussion in Canberra in 2010, representatives of the EU Delegation and Australian scholars and officers attempted to identify the commonalities in their interests toward Asian countries. The latest development in EU-Australia relations indicates robust and active engagement by both sides. Apparently, the two have managed to overcome their trade conflicts and expand cooperation beyond the traditional field. However, two circumstances significantly influence their current relationship. The first is Australia’s relationship with the U.S. Australia is probably the closest ally of the U.S. in the Asia Pacific region. Their relationship dates back to World War II, when Australia could not depend on Britain’s protection and had to find another powerful security patron. Throughout its history, Australia has always needed a protector.66 Security relations between these two countries developed during the administration of Prime Minister Robert Menzies (1949-1966), but they might have peaked under the leadership of Prime Minister John Howard, who called himself the region’s ‘American sheriff.’ If Australia’s loyalty to the British drove the country to send men to Gallipoli in the World War I, the country’s loyalty to the U.S. resulted in Australians’ involvement in the Vietnam War during the Cold War era and in Iraq and Afghanistan during the post-Cold War era. Currently, Australia is benefitting from the U.S. pivot to the region, where it serves as host to rotating American troops. One may wonder where the EU fits in with regards to Australia- U.S. relations. The second circumstance affecting EU-Australia relations is Australia’s economic interest in Asia. Despite being America’s closest ally in the region, Australia’s economy relies heavily on Asian countries. Indeed, Australia perceives that its future is in Asia; thus, the country depends on its relationships with Asian countries.67 Besides the U.S., two Asian countries influence Australia significantly. The first country is China which is Australia’s largest trade partner; especially for the latter’s mineral exports. Australia’s economic interest in China is paramount, sometimes creating strange relations among Australia, China, and the U.S. in geo-politics and the geo-economy of the region. The second country of influence is Indonesia; it has been viewed as a threat to Australia’s security since the leadership of Prime Minister Menzies. Currently, relations between the two neighboring countries are quite strained after Edward Snowden’s documents revealed that Australia spied on Indonesia’s top officials in 2009. This crisis has caused a breakdown in cooperation regarding the handling of irregular migrants to Australia through Indonesian waters. Indonesia is also an important ASEAN country with whom Australia has negotiated FTA. 66 B. Grant, Op. cit., p. 1. The Government of Australia, “Australia in the Asian Century: White Paper,” Canberra, October 2012. 67 584 | Asea Uninet Scientific and Plenary Meeting 2016 America and Asia are now of great interest to Australia. Against this background, and bitter trade experiences with European countries, relations between the EU and Australia have to find a way forward, 5 REFLECTIONS ON THE EU, ASEAN AND AUSTRALIA Previous sections describe the relations between the EU and ASEAN and those of the EU and Australia. This section analyzes the similarities and differences of those relationships according to obstacles to relations, the EU’s current concentrated approaches, and the EU’s economic role. Southeast Asian countries and Australia experienced colonialism under the domination of European countries. Colonial economic structures were established in these countries for centuries, linking colonies with European motherlands. The structures were based originally on trade relations; however, colonialization fostered trade monopolies and exploitation by European powers. This colonial economic structure gave enormous wealth to the Europeans; consequently, a small, poor country like the Netherlands could become one of richest countries in Europe because of its colony in East India.68 Past trading experiences strengthened the traditional link between Australia and the UK, but most traditional trade connections between European and Southeast Asian countries were shattered in the post-colonial period. Ultimately, linkages between the UK and Australia were damaged by the accession of Britain to the EEC and by the CAP. In the independent era, problems in relations between the EU and Southeast Asian countries stemmed from political issues, whereas problems between the EU and Australia arose mainly because of economic issues. Differences in perceptions and attitudes toward political values and practices as well as toward human rights became obstacles in EUASEAN relations during the 1970s, 1980s, and 1990s. During these periods, the EU and Australia also experienced strained relations but, rather than political issues, it was trade difficulties that damaged the relations. The EU’s current approaches to ASEAN countries and Australia can be perceived as efforts to revitalize traditional economic linkages. Increasing numbers of visits by EU leaders to Southeast Asia and Australia have been noted, along with a more active presence of EU Delegations in the region. Intensive meetings and discussions have been undertaken with government officials (i.e., G to G relations), between EU officers and business communities, with key persons in society, and with scholars. The EU has highlighted taglines to emphasize the “closeness” of relations in its diplomatic approach. For example, the delegation to ASEAN countries issued a brochure entitled ‘EU-ASEAN: Natural Partners.’ 69 Similarly, the EU Delegation to Australia published a special book commemorating 50 years of relations between the two parties. Contents cover ‘investing in the future together’ and ‘working together in the Asian century’. These topics and the corresponding narratives seem to reflect Europeans’ willingness to build more bridges linking the EU and ASEAN countries and the EU and Australia. They portray a friendlier EU to partnering nations. With Australia, the EU emphasizes the closeness and shared values of the two entities; despite the number of countries in the EU, these two parties share many 68 A. Maddison, Contours of the World Economy, 1-2030 AD. New York: Oxford University Press, 2007. 69 EU Delegation, Jakarta, January 2013. Asea Uninet Scientific and Plenary Meeting 2016 | 585 fundamental commonalities. They admire Western culture, values, and institutions; their common values in this regard could be foundational to a cooperative partnership. Past problems associated with trade difficulties could be overcome by creating other markets in developing countries. In addition, cooperation is possible because the two are developed entities, and they generally share economic interests in international institutions such as the IMF and the G20. There were examples in which the EU and Australia worked together with other developed countries in the World Trade Organization (WTO) to fight for trade facilities, TRIPs, and agricultural trade vis-a-vis developing countries. Thus, the EU and Australia could overcome their fierce trade conflict to create a positive sum game in terms of economic relations. However, Australia’s orientation toward Asia and its interests in regional countries may limit its cooperation with the EU. In the EU-AEAN relations, the pictue is more complicated. Despite efforts to construct an ASEAN identity, ASEAN countries differ in economic levels and political values. Regarding economic levels, most are developing countries except for Singapore and Brunei. In terms of political values, the ASEAN is pluralistic, ranging from democratic countries like Indonesia and the Philippines to countries with strong governments (e.g., Singapore, Brunei, and Cambodia) to countries in transition (e.g., Myanmar and Thailand). The EU shares common economic interests with Singapore—which is why their FTA negotiations were conducted quickly—but the two have different political values. With Indonesia, the situation is reversed. ASEAN relations with China are another issue. The proximity of Southeast Asian countries to China, along with their heavy economic dependence on the regional power, may leave little room for relations with the EU; however, this case varies across ASEAN countries. Some ASEAN countries have a natural tendency to find a balance regarding Chinese influence in the region but they have found so in the U.S. pivot to Asia. Thus, an extension of the EU’s role beyond its traditional position as a trading power is questionable. Nevertheless, ASEAN countries and Australia enjoy the considerable influx of European FDIs. As the top investors in ASEAN countries and Australia, EU countries have actually maintained their traditional roles as economic powers in spite of the financial crisis in the Eurozone. In its relations with Australia, the EU has participated in science/education and environmental programs, and it has cooperated in security forums and on asylum/migration issues. Clearly, relations have moved forward beyond the traditional linkage. However, the EU may find that it is more difficult to engage in such issues with the ASEAN entity because of its diverse membership and certain perceptions that environmental issues should be incorporated into European trade strategies. Regarding this last issue, common interests shared by the EU and Australia associated with imposing environmental standards could jeopardize the EU’s relations with Asian countries. 6 CONCLUSION EU-ASEAN and EU-Australia relations were underplayed in the past, but the crisis in the Eurozone and the rapid growth in East Asia have encouraged Europeans to revitalize relations with Australia and Southeast Asian countries. The EU has engaged in intensive diplomacy with these countries; however, its approaches and appeals differ for ASEAN countries and Australia. The EU approaches these partners differently not only because of their unequal status but also because of historical, social, and cultural ties. Countries in the EU have stronger historical connections and closer values with Australia than with ASEAN countries. In summary, the EU seems capable of differentiating its role as an international actor according to its different partners. 586 | Asea Uninet Scientific and Plenary Meeting 2016 There have been movements designed to take relations beyond economic linkages, but such efforts have been more successful in the EU’s relations with Australia rather than with Southeast Asian countries. Australia may find that its interest in Asian countries and other countries in the region is bigger than what could be offered by the EU. The EU’s effort to secure its economic interests and to enhance its role in Asia seem to find that ASEAN and Australia have their own interests that are not necessarily in line with the EU’s. Indeed, the EU came to the region too late; their own economic interests are too paramount and remind Southeast Asian countries of the Europeans’ approach in the 1990s. Although economic interests are natural motives behind international relations, long-term interactions and trusted relations among genuine partners are necessary to secure profitable associations.*** REFERENCES Acharya, A. (2009). Constructing a security community in Southeast Asia: ASEAN and the problem of regional order. London: Routledge. Beeson, M. (2007). Regionalism and Globalization in East Asia: Politics, Security and Economic Development. New York: Palgrave Macmillan. Commission of the European Communities. (1994). Communication from the Commission to the Council, C0M (94) 314 final, Brussels, 13 July. EU Delegation to Australia and New Zealand. (2013). Celebrating 50 Years: EU-Australia, Canberra. Far Eastern Economic Review. (1998). ‘What a Different a Crisis Makes’, Vol. 161, Issue 6, 16 April. Fitriani, E. (2014). Observing ASEM from Southeast Asia. Singapore: ISEAS. Forster, G. (1999). “The European Union in South-East Asia: Continuity and Change in Turbulent Times,” International Affairs, Vol. 75, No. 4, pp. 743-758. Fort, B and Webber, R (eds). (2006). Regional integration in East Asia and Europe: Convergence or divergent? London: Routledge. Grant, B. (1972). The crisis of loyalty: A study of Australian foreign policy, Sydney: Angus and Robertson. Leifer, M. and S. Djiwandono. (1998). ‘Europe and Southeast Asia’ in H. Maull, G. Segal, and J. Wanandi (eds), Europe and the Asia Pacific, London: Routledge. Maddison, A. (2007). Contours of the world economy, 1-2030 AD, New York: Oxford University Press. Osborne, M. (2013). Southeast Asia: An introductory history, 11th Ed, Sydney: Allen & Unwin. Palmujoki, E. (1997). ‘EU-ASEAN Relations: Reconciling Two Different Agendas’, Contemporary Southeast Asia, Vol. 19, No. 3, pp. 269-285. Petersson, M. (2006). ‘Myanmar in EU-ASEAN Relations’, Asia-Europe Journal, Vol. 4, No. 4, pp. 563-581. Richard, G. and C. Kirkpatrick, (1999). ‘Reorienting Inter-Regional Cooperation in the Global Political Economy: Europe’s East Asia Policy’, Journal of Common Market Studies, Vol. 37, No. 4, pp. 687-710. Rosamond, B. (2014). ‘Three Ways of Speaking Europe to the World: Market, Peace, Cosmopolitan Duty and the EU’s Normative Power’, The British Journal of Politics and International Relations, Vol. 16, pp. 133-148. Asea Uninet Scientific and Plenary Meeting 2016 | 587 Ruland, J. (2001). ‘The EU as an Inter-Regional Actor: The Asia-Europe Meeting’ in S. Chirativat. F. Knipping, P. Lassen, and C. Yue, Asia-Europe on the eve of the 21st century, Bangkok: Centre for European Studies, Chulalongkorn University. Singleton, G., Aitkin, D., Jinks, B. and Warhurst, J. (1997). Australian political institutions, 5th Ed, Melbourne: Longman. Thompson, E. (2011). ‘The EU and Southern Cross: The Effects of EU Energy Policy on EU-Australia Energy Trade’, Australian and New Zealand Journal of European Studies, Vol. 3, No. 2, pp. 18-32. The Government of Australia. (2012). Australia in the Asian Century: White Paper, Canberra. Wiessala, G. (2007). ‘Catalysts and Inhibitors—The Role and Meaning of Human Rights in EU-Asia Relations’, CERC Working Papers Series, No. 1, Melbourne: University of Melbourne. Wilson, B. (2013). ‘Regional Policy in the EU Mode of Regionalism: Implications for Asian Integration’, Australian and New Zealand Journal of European Studies, Vol. 4, No. 2, pp. 17-29. Yeo, L. (2003). Asia & Europe: The development and different dimensions of ASEM, London: Routledge, 2003. Talks Nelson, B. ‘EU-Australia Relations: Views from the Coalface ‘, Speech in the ‘Smart, Sustainable and Inclusive: Researching the EU from Australia and New Zealand’, Conference, Australian National University, Canberra, 9 September 2013. Wilson, J. Ambassador of the EC Representative to ASEAN and Indonesia, Speech at the EU-ASEAN Economic and Policy Forum at the ASEAN Secretary, Jakarta, 18 April, 2013. Internet http://ec.europa.eu/trade/policy/countries-and-regions/regions/asean Accessed on 9 January, 2013. http://ec.europa.eu/trade/policy/countries-and-regions/regions/australia Accessed on 9 January 2013. EF20160118. FIRST-GENERATION VS SECOND-GENERATION COLLEGE STUDENTS: THEIR ACADEMIC SELF-EFFICACY AND COLLEGE ADJUSTMENT Tjut Rifameutia tia_h@ui.ac.id Elok D. Malay elok.di.malay@gmail.com Faculty of Psychology, Universitas Indonesia, Lingkar Kampus Raya, Kampus Baru UI, 16424, Depok, West Java, Indonesia Presented at the: ASEA-UNINET International Workshop Bali, 15th – 18th February 2016 Udayana University, Widya Sabha, Campus Bukit Jimbaran Abstract As awareness of the importance of higher education continues to increase, more first-generation college students have enrolled in universities. However, several previous researches found that first generation students have different characteristics from traditional/second-generation students that could affect their adjustment in college. First year college students’ adjustment could be a predictor for their achievement and persistence in study. Among several predictors to affect college students’ adjustment, this study examined the effect of students’ generational status and self-efficacy in their adjustment. This study also investigated the effect of generational status in first-year college students’ self-efficacy. 340 college students from several majors and universities in Jakarta and Depok, Indonesia, participated in this study. College adjustment was measured using an adapted version of Baker and Siryk’s SACQ (Student Adaptation to College Questionnaire). Academic self-efficacy was measured using an adaptation of Majer’s BEST (The Beliefs in Educational Success Test). T-test and One-way ANOVA analysis showed that generational status didn’t have significant effect on first-year college students’ academic self-efficacy and college adjustment. However, first-generation college students had slightly better academic adjustment compared to second-generation college students, especially those with parents who both graduated from higher education. Linear regression analysis showed that academic self-efficacy influenced first year college students’ adjustment in general and in each of its four aspects (academic adjustment, social adjustment, personal-emotional adjustment, and goal commitment-institutional attachment). Students with better self-efficacy showed better college adjustment. Based on these findings, students should be encouraged to pursue their study to higher education regardless of their family educational background. Keywords: college adjustment; academic self-efficacy; generational status; first-year students; college students Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 588 Asea Uninet Scientific and Plenary Meeting 2016 1 | 589 INTRODUCTION The ASEAN Economic Community (AEC) that had been just started in year of 2016 is a window of opportunity and also a challenge for its member countries, including Indonesia. It would give Indonesian more market and employment opportunities. On the other side, AEC also a challenge as Indonesian human resources will compete not only within the country, but also with human resources from other ASEAN countries. To be able to compete, the quality of Indonesia’ human resources must be as good as other countries’. One of indicators of human development index is their participation in higher education, or tertiary level of education, or university (UNDP, 2014). However, until 2011, it was reported (ASEAN Secretariat, 2013) that enrollment to tertiary level of education in Indonesia was 27.1%. This percentage is quite low if we compare it with neighbor countries, like Malaysia, with 40.87% enrollment rate. Realizing this condition, Indonesia government had set target to increase the quality of education and participation in higher education (ASEAN Secretariat, 2013). Indonesia government has even targeted 60% participation in higher education level in 2025 (Rogeleonick, 2014). Considering the importance of higher education in a country’s human development, understanding about college students has also becoming more and more important subject in social science, including Psychology. Motivating students to continue their study to higher education is important, but helping them to persist and achieve in their study until they could graduate is also important. Meta-analysis on 109 previous research (Robbins et.al., 2004) found that persistence until graduate is one of higher education’s success indicators, beside academic achievement. Unfortunately, there are many cases where college students have to drop out from their study even only after their first year or first semester. Wintre and Bowers (2007) stated that almost 30-40% of college students in North America dropping out from their study or failing to graduate. The data about this in Indonesia has not yet available. However, as reported by ASEAN secretariat (2013), even though university enrollment rate in Indonesia was 27.1% in 2011, but in the same year, percentage of adult who attained educational degree until tertiary level of education was only 7.8%. One of factor most often cause students’ withdrawal from college is their lack of adjustment to college environment (Kalsner & Pistole in Toews & Yazedjian, 2007). Atwater and Duffy (2005) defines adjustment as the psychosocial process by which we manage the demands of everyday life, through modifying ourselves or our environment. As student move from studying in high school into university, they would face so many changes. Among them are changes in their learning system, environment, social relationship, and even daily life, especially if they move out from their family houses into independent living (Chemers, Hu, & Garcia, 2001; Al-Khatib, Awamleh, & Samawi, 2012). These changes would give challenges to college students, especially in their first year period. Inability to adjust with these changes could affect college students’ life and their decision to keep continuing their study or not. There are several definitions used in defining college adjustment. One definition used in many research is the one proposed by Baker and Siryk (1984; 1989; in Gerdes & Mallinckrodt, 1994; in Choi, 2002; in Toews & Yazedjian, 2007; in Al-Khatib, et al., 2012). Baker and Siryk (1984; 1989) define adjustment in four areas: academic, social, personalemotional, and goal-commitment/institutional attachment. Academic adjustment is defined as the presence of positive attitude toward setting academic goals, completing academic requirements, and effective efforts to meet academic requirements and environment. Social adjustment is defined as the extent of adjustment between the student and the surrounding environment; students’ ability to cope with social and interpersonal demand in college. Personal and emotional adjustment refers to the student’s ability to achieve self-satisfaction 590 | Asea Uninet Scientific and Plenary Meeting 2016 within different activities; focuses on student’s internal state during adjustment process in college and ability to cope with psychological pressure and somatic problems. Goalcommitment/ institutional attachment refer to student’s commitment degree toward university/college’s educational vision and degree of attachment toward college, also the quality of relationship between student and educational institution (Baker & Siryk, 1984; Baker & Siryk in Choi, 2002). Previous researches support that college students’ adjustment could determine their persistence, their achievement, and even their mental health. College adjustment becomes a strong predictor whether a student would be able to have good achievement and persist in their study until graduate (Gerdes & Mallinckrodt, 1994). College adjustment in first year could also predict whether or not students would be able to graduate from their study, alongside with their GPA, gender, parental support, stress, and depression (Wintre & Bowers, 2007). Ying and Liese (1991) found that academic problems faced by college students strongly related to low psychological adjustment, stress, and how they cope with it. Because of its importance, this study would further investigated about college adjustment of first-year student. Moreover, research about college students’ adjustment in Indonesia are still very limited and unpublished (Siregar, 2011; Mustapa, 2011; Hafiduddin, 2011; Fuad, 2013) There are several variables related to college adjustment (Holmbeck & Wandrei, 1993; Chemers et al., 2001; Poyrazli et.al., 2002; Ying & Han, 2006; Al-Qaisy, 2010; Poyrazli et al., 2010; Hirai et.al., 2015). One of them is parents’ educational background (Toews & Yazeidjan, 2007; Yazedjian, Toews, & Navarro, 2009). Nunez and CuccaroAlamin (in Toews & Yazedjian, 2007) found that college students whose parents had some college experience reported higher levels of adjustment than students whose parents had none. Choy et.al. (in Yazeidjan et.al., 2009) also hypothesized that if parents do not have college experience, they might not be able to provide the support their children need in transition to college. However, the relationship between parents’ educational background and students’ college adjustment is not consistent, only for students from specific races but not with other (Toews and Yazedjian, 2007). Comparison between students whose parents had never studied in college/university with those whose parents have college degree has been going on for years. Several researches (Terenzini, et.al., 1996; Pascarella, et.al., 2004; Pike & Kuh, 2005) using the term “first-generation student” to refer to “a college or university student from a family where no parent or guardian has earned a baccalaureate degree” (Choy in Pascarella et.al., 2004). On the other hand, for students whose parents or guardians earned at least one baccalaureate degree, they use the term “second-generation student” or “traditional student”. This study would use definition used by Pascarella et.al. (2004), that categorized students into three groups to give clearer distinction among college students. First group consisted of first-generation students, whose parents have education no more than high school. Second group, called high second-generation students, consisted of students whose parents had both completed bachelor degree or above. Third group, called moderate second-generation students, consisted of students who have one or both parents had completed at least some college, but no more than one parent who had obtained a bachelor degree or above. Previous research found that first-generation students were disadvantageous compared to second-generation students. First-generation students mentioned to have lower educational aspirations (Terenzini et.al., 1996), credit hours completion and participation in campus activities (Pascarella, et.al., 2004), basic knowledge about postsecondary education, educational degree expectations and plans, and academic preparation in high school (Horn & Nunez, 2000; Hahs-Vaughn, 2004). Terenzini et.al. Asea Uninet Scientific and Plenary Meeting 2016 | 591 (1996) also found that first-generation students had a more difficult transition from secondary school to college than their peers. They were less likely to develop strong relationship with other students or to become involved in campus organizations or clubs. Furthermore, several research (in Pascarella, 2004) concluded that, compared to secondgeneration students, first-generation students were more likely to leave university at the end of first year, less likely to remain enrolled or be on a persistence track to a bachelor degree after three years, and less likely to stay enrolled or attain a bachelor degree after five years. These findings need serious attention from higher education institutions, especially in Indonesia. Attending university and having bachelor degree, in Indonesia, are not that common even until a decade ago (Rogeleonick, 2014). So, it is expected if we assume that many college students nowadays are first-generation students. If the findings from previous research in other countries could be applied in Indonesia, of course higher educational institutions need to provide more assistance for their first-generation students adjusting to their college life. Because of that, this study wanted to investigate whether this generational status also had influence over Indonesian college students’ adjustment. Beside generational status, other factor could be connected to college adjustment and first-generation students is self-efficacy. Chemers et al. (2001) found that academic self-efficacy and optimism have strong correlation with first year students’ performance and adjustment. Poyrazli et.al. (2002) also found that self-efficacy related to sociocultural adjustment of international students. Self-efficacy also proved to be able to predict college students’ academic success/GPA (Majer, 2009). It also predicts their retention in their education (Gore, 2006). Unfortunately, previous research (Hellman, 1996; Aspelmeier et.al., 2012) found that first-generation students had lower self-efficacy or self-esteem compared to their peers. This condition, of course, could be another disadvantage for them. Self-efficacy is defined as a cognitive resource that involves an individual’s confidence or belief in one’s ability to effectively engage in behaviors toward desired goals (Bandura in Majer, 2009). This definition of self-efficacy was also used in latest researches (Hirose et.al., 1999; Chemers et al., 2001; Zajacova et.al., 2005). In educational context, rather than generalized self-efficacy, academic or educational self-efficacy should be measured (Zajacova et.al, 2005). Academic self-efficacy is defined as someone’s selfevaluation about one’s abilities and/or chances to succeed in academic environment (Robbins et al., 2004). This study would use Majer’s (2009) definition of educational selfefficacy, which is a term that reflects general conceptualization of academic self-efficacy, not limited to any specific academic subject. However, the role of self-efficacy on college students is found to be not as firm as its role in lower educational level students (Robbins et al., 2004). Kahn and Nauta (2001, in Robbins et al., 2004) found no significant influence of self-efficacy on college students’ persistence until their second year of study. This result is consistent with the result of experiment conducted by Vancouver et al. (2002, in Robins et al, 2004), that self-efficacy negatively related to college students’ performance. Hirada et al. (1999) also found that even though self-efficacy have role in college students’ adjustment, but not in all majors. In several majors, they found that students with high self-efficacy have more difficulties in adjustment. Because of that, the role of self-efficacy on college adjustment, especially for Indonesia college students, still need to be studied further. This study also investigated whether self-efficacy influence college adjustment and whether generational status also influence college students’ self-efficacy. To sum up, as explained before, this study was aimed to investigate about: 592 | Asea Uninet Scientific and Plenary Meeting 2016 1) 2) 3) 2 Does generational status influence college adjustment of first-year college students? (Do first-and second-generation college students differ in their college adjustment?) Does generational status influence academic self-efficacy of first-year college students? (Do first-and second-generation college students differ in their academic self-efficacy?) Does academic self-efficacy influence college adjustment (overall adjustment, academic adjustment, social adjustment, personal-emotional adjustment, and institutional attachment) of first-year college students? METHOD 2.1 Participant Participants of this study were first-year students from five different majors, from four different universities in Jakarta and Depok, Indonesia. Incidental sampling technique was used for availability and practicality reason (Kumar, 2003). 375 college students were voluntarily participated, but only data from 340 students could be analyzed further. 2.2 2.2.1 Measurement College Adjustment Indonesia language adaptation of Baker & Syrik’s Students Adaptation to College Questionnaire/ SACQ (1989; Baker & Syrik in Waller, 2009) was used to measure college adjustment in this study. Different from original SACQ that consists of 67 item with 9points Likert scale, after being tested twice (N1= 70, N2= 340), SACQ in this research consists of 60 items with 7-point Likert scale. There were four scales in SACQ: academic adjustment (AA) subscale (21 items), social adjustment (SA) subscale (16 items), personal– emotional adjustment (PEA) subscale (15 items), and goal commitment–institutional attachment (GCIA) subscale (14 items). Several items in GCIA subscale overlap with AA and SA subscales. Three items are not included in any subscales, to measure overall adjustment. SACQ was chosen because it has well established validity and reliability (Baker & Syrik, 1986; Baker & Syrik, 1989). SACQ has been used in many researches about college adjustment, in many different culture contexts, and always proved to have good validity and reliability coefficients (Gerdes & Mallinckrodt, 1994; Choi, 2002; Yazeidjan et al., 2009; Al-Khatib, et al., 2012). In this research, SACQ had also proved to have good internal consistency and Cronbach alpha coefficients, for overall (α=0.921 and r-item=0.204 0.607) and per subscale (items in AA had α=0.835 and r-item = 0.223 - 0.538; items in SA had α=0.828 and r-item=0.324 - 0.639; items in PEA had α=0.841 and r-item= 0.262 - 0.595; and items in GCIA had α=0.824 and r-item=0.319 - 0.648). 2.2.2 Academic Self-Efficacy Academic self-efficacy was measured using Indonesia language adaptation Majer’s The Beliefs in Educational Success Test (BEST). The BEST was developed by Majer (2006) based on Bandura’s cognitive-behavioral self-efficacy theory (1997). Majer (2009) explained that items of BEST reflect a range of specific tasks commonly associates with the pursuit of higher education, but do not focus on any one academic subject area. BEST asked its respondent to state their confidence (in range from 0% to 100%) on 10 hypothetical academic situations. Asea Uninet Scientific and Plenary Meeting 2016 | 593 BEST was chosen for this research because it has proved to have good internal consistency and reliability, concurrent validity with General Self-Efficay Scale (GSE), and convergent validity with Pearlin and Schooler’s Self-Mastery Scale (SMS) (Majer, 2009). For this research, BEST was tried out twice for its internal consistency and reliability using Cronbach alpha (N1=70, N2=340). The last result showed that BEST had high reliability (α=0.912) and good internal consistency (r-item = 0.548 - 0.803). 2.2.3 Generational status Participants’ generational status was measured using two questions about their parents’ educational level (one for father’s, another for mother’s). Participants were categorized as first-generation college students if neither of their parents had ever graduated from university, or had maximum high school education. If even only one of their parents had graduated from university (either from vocational or bachelor program), participants were categorized as second-generation college students. To avoid oversimplification of the diversity of parental educational background, this study also specified second-generation students into moderate-second generation (if only one of parents had minimum bachelor degree) and high-second generation (if both parents had minimum bachelor degree). 2.3 Design and Procedure This study was conducted in non-experimental design, for no intervention from researcher involved (Kumar, 2003). Researchers only measured each variable as they are in real-life setting. For analysing the data, several statistical procedures with SPSS 22.0 program were conducted: 1) 2) 3) 3 3.1 T-test, to test the effect of two generational status (first- and secondgeneration students) on CA, AA, PEA, GCIA, and ASE One-way ANOVA, to test the effect of three generational status (first-, moderate second-, and high second- generation students) on CA, AA, PEA, GCIA, and ASE Linear regression, to test the effect of ASE on CA, AA, PEA, and GCIA RESULTS Demographic Data of Participants Most of the participants in this research were females (67.9%) and dominantly were in age of 18 years old (70.0%). They came from five different majors with majority came from Psychology (36.5%). Educational background of participants’ parents varied. Majority of participants’ father’s held bachelor degree (38.2%). Meanwhile, majority of the mother’s educational background was high school graduate (30.6%). However, the number of mother who has bachelor degree was also quite high (27.6%). Overall, there were more second-generation students (71.4%) than first-generation students participated in this study (28.5%), with more students categorized as high second-generation (42.9%) than moderate second-generation students (28.5%). These all are illustrated in Table 1. Table 1. Demographic data of participants (Gender, Age, Major, Parents’ educational background, and Generational Status) Variable Variation f (N) % Gender Male Female 106 231 31.2 67.9 594 | Asea Uninet Scientific and Plenary Meeting 2016 Age Majors Parents’ Educational Background Generational Status 3.2 17 18 19 20 Psychology Economic Pharmacy Educational Science Administration Father Middle School or lower High School Vocational Program Degree Bachelor Degree Master Degree Doctoral Degree Mother Middle School or lower High School Vocational Program Degree Bachelor Degree Master Degree Doctoral Degree First-generation Second-generation Moderate High 40 244 47 9 124 76 52 47 41 40 81 31 130 56 2 51 104 55 94 28 4 97 97 146 11.8 71.8 13.8 2.6 36.5 22.4 15.3 13.8 12.1 11.8 23.8 9.1 38.2 16.5 .6 15.0 30.6 16.2 27.6 8.2 1.2 28.5 28.5 42.9 The Influence of Generational Status on College Adjustment 3.2.1 College Adjustment of First- and Second- Generation College Students Table 2 below illustrates the comparison of college adjustment (CA, AA, SA, PEA, GCIA) between participants who were first- and second-generation students in general. Table 2. College Adjustment of first-generation college students and second-generation college students First-generation students Second-generation students M SD M SD CA 4.5744 0.7295 4.4743 AA 4.4099 0.7929 SA 4.8125 PEA GCIA Dependent Variable t p 0.6836 1.196 0.233 4.2163 0.7488 2.116 0.035 0.7942 4.7657 0.8560 0.465 0.643 3.9932 1.0747 3.9355 1.0172 -0.029 0.977 5.3284 0.8699 5.1999 0.8838 1.225 0.222 Using statistical grouping, SACQ scores could be divided into three categories: low (1.00-3.66), medium (3.67-6.33), and high adjustment (6.34-9.00). Based on this, it could be concluded that, in general, both first- and second- generation students participated in this study had medium college adjustment (CA), academic adjustment (AA), social Asea Uninet Scientific and Plenary Meeting 2016 | 595 adjustment (SA), personal-emotional adjustment (PEA), and institutional attachment (GCIA). There were no significant difference between first- and second- generation college students in their overall college adjustment (t(df=338)=1.196, p>0.05), social adjustment (t(df=338)=0.465, p>0.05), personal and emotional adjustment (t(df=338)=-0.029, p>0.05), and institutional attachment (t(df=338)=1.225, p>0.05). However, first-generation and traditional college students showed significant difference in their academic adjustment (t(df=338)=2.116, p<0.05). First-generation college students showed slightly higher academic adjustment (M=4.4099) than secondgeneration students (M=4.2163). 3.2.2 College Adjustment of First-, Moderate Second-, and High SecondGeneration College Students Table 3 illustrates the comparison of college adjustment (CA, AA, SA, PEA, GCIA) between first-generation, moderate second-generation, and high second-generation college students. Table 3. College Adjustment of first-generation, moderate second-generation, and high second-generation college students Firstgeneration Moderate High Secondgeneration Secondgeneration M SD M SD M SD CA 4.5744 0.730 4.5775 0.697 4.4057 AA 4.4099 0.793 4.3004 0.827 SA 4.8125 0.794 4.8853 PEA 3.9320 GCIA 5.3284 Dependent Variable F p 0.668 2.504 0.083 4.1605 0.689 3.233 0.041 0.796 4.6862 0.887 1.761 0.173 1.075 4.0076 1.091 3.8877 0.966 0.392 0.676 0.870 5.3365 0.745 5.1091 0.956 2.710 0.068 There was no specific group that outstand other groups in their adjustment. Even though there were slight differences scores among first-, moderate second-, and high secondgeneration students, the differences were not significant. The only significant difference happened in academic adjustment aspect (F(2,337)=3.233, p<0.05). Using Tukey-HSD Post-hoc test, it was proven that first-generation students had significantly higher academic adjustment than high second-generation students (Mdiffer=0.24945, p<0.05). Meanwhile, even though there was slight difference in academic adjustment score between firstgeneration and moderate second-generation students (Mdiffer=0.10947 p>0.05) or between moderate second- and high second-generation students, the difference were not significant (Mdiffer=0.13997 p>0.05). 3.3 3.3.1 The Influence of Generational Status on Academic Self-Efficacy Academic Self-Efficacy of First- and Second-Generation College Students 596 | Asea Uninet Scientific and Plenary Meeting 2016 Using statistical grouping, academic self-efficacy (ASE) could be divided into three grouping categories: low (0-33.30), medium (33.31-66.70), and high (66.71-100). Based on these categories, as illustrated in Table 4 below, it could be concluded that participants in this study, both first- and second-generation students, generally had a high academic self-efficacy. Table 4 also shows that, even though first-generation students had a slightly higher academic self-efficacy than second-generation students, the difference was not significant (t (df=338)=0.573, p>0.05). Table 4. Academic Self-Efficacy of first-generation college students and secondgeneration college students Dependent variable ASE 3.3.2 First-generation students Second-generation students M SD M SD 80.7485 11.7939 79.9831 10.8408 t P 0.573 0.567 Academic Self-Efficacy of First-, Moderate Second-, and High SecondGeneration College Students In table 5 below, it is shown that academic self-efficacy were also not differ significantly among college students when they were categorized as first-, moderate second-, and high second-generation students (F (df=2, 337)=0.205, p>0.05). This result strengthening previous result that generational status had no significant effect on academic self-efficacy. Table 5. Academic Self-Efficacy of first-generation, moderate second-generation, and high second-generation college students Dependent FirstSecondSecond-high F p Variable generation moderate generation generation ASE 3.4 M SD M 80.749 11.79 80.235 SD M SD 11.47 79.816 10.44 0.205 0.815 The Influence of Academic Self-Efficacy on College Adjustment Table 6 illustrates the result of linear regression analysis of academic self-efficacy (ASE)’s effect on college adjustment (CA), academic adjustment (AA), social adjustment (SA), personal-emotional adjustment (PEA), and institutional attachment (GCIA). Table 6. The effect of academic self-efficacy on college adjustment (CA), social adjustment (SA), and its dimensions (AA,SA, PEA, GCIA) Dependent variable R R2 F df (N) p β p Total CA 0.426 0.181 74.803 1 (338) 0.000 0.027 0.000 AA 0.447 0.200 84.292 0.000 0.031 0.000 SA 0.400 0.160 64.256 0.000 0.030 0.000 PEA 0.193 0.037 13.123 0.000 0.018 0.000 GCIA 0.332 0.110 41.737 0.000 0.026 0.000 Asea Uninet Scientific and Plenary Meeting 2016 | 597 As shown in Table 6, academic self-efficacy significantly predicted college adjustment scores (β=0.027, p <0.01). It contributed significantly to variance in college adjustment scores, for 18.1% (R2=0.181, F(1,338)=74.803, p<0.01). Academic selfefficacy also explained a significant proportion of variance in academic adjustment scores (R2=0.200, F(1,338)=84.292, p<0.01), social adjustment scores (R2=0.160, F(1,338)=64.256, p<0.01), personal-emotional adjustment scores (R2=0.037, F(1,338)=13.123, p<0.01), and institutional attachment scores (R2=0.110, F(1,338)=41.737, p<0.01). These results showed that academic self-efficacy significantly influenced college students’ adjustment, with highest influence on academic adjustment and lowest influence on personal-emotional adjustment. 4 CONCLUSION Based on the findings in this study, it could be concluded that: 1) 2) 3) 5 5.1 Generational status had no influence on students’ college adjustment, social adjustment, personal-emotional adjustment, and institutional attachment. However, generational status did have influence on their academic adjustment. Generational status had no influence on first-year college students’ academic self-efficacy. Academic self-efficacy had influence on first-year college students’ college adjustment, academic adjustment, social adjustment, personalemotional adjustment, and institutional attachment. DISCUSSION Generational Status and College Adjustment This study supports the findings of York-Anderson & Bowman (1991) that both groups of students (first- and second-generation students) showed no difference in their commitment to achieve their educational goals. On the other hand, this study does not support the findings of several previous researches (Terenzini et.al. 1996; Hahs-Vaughn, 2004; Pascarella et.al., 2004; Toews & Yazeidjan, 2007). Social capital point of view (Coleman in Toews & Yazeidjan, 2007; Pascarella et.al., 2004) believe that parents’ educational background could affect college students’ adjustment as it is their social capital. While students have at least one parent had studied at college/university, they will have more information about college life from them, so they could be more prepared. However, in recent days, college life information can be accessed from so many resources, such as universities’ website, people’s experience (testimonial statements from their social media/blogs, etc). Therefore, first-generation students could have as good adjustment as their peers from second-generation, even at their first-year of study. Besides the advancement of technology and information sharing, Indonesian family culture could also be considered in explaining this study result. Unlike students in western countries, such as USA (Choi, 2002), who usually move out from their house when they are starting their college year, many college students in Indonesia are still living together with their families. Some of first-generation students who participated in this study were interviewed deeper. The result showed that even though these students had no parents who had ever studied in university, still some of them had older sibling, or uncle/aunty, or 598 | Asea Uninet Scientific and Plenary Meeting 2016 relatives who had university educational background. This condition enabled them to discuss on higher education, including their major interest and further university. Other factor that should be considered in explaining this study result is the level of parents’ involvement in their children’s life, or the quality of parental relationship. Yazedjian et.al. (2009) found that students with higher adjustment were students who reported to have closer relationship or attachment with their parents. Rather than parents’ educational background, it could be their involvement in their children’s education that has more effect. Another factor that could explain the result of this study is the program that universities provide for their new-coming students regarding college life. All universities whose students participated in this study have official orientation program for their newcoming students. Some of them also have orientation program conducted by their senior students to help them in gaining more information that they would be needed in their college life. This study result could be an indicator that those induction programs has been succeed for first-year students college adjustment. This study findings also support previous finding by Khanh (2002). Even though first-generation college students felt less prepared for college, worried more on financial aid, and less knowing about the social environment at the university than the other students, Khanh (2002) found that first-generation college students did not differ from the other students in making decisions related to college, knowing about the academic programs prior to enrollment, making friends, enjoying being a student, and feeling accepted at their universities. However, this study found that first-generation students had higher academic adjustment than second-generation students. Being the first in their family to receive higher education could motivate them to achieve even more in their study. As Khanh (2002) found out, reasons of first-generation students pursuing their higher education mostly were to gain respect/status, to bring honor to their family, and to help their family financially after completing their college. These kind of motivations, that not only involving their individual interest, but also their families, may contribute even stronger motivation to adjust and to achieve in first-generation students. Khanh (2002) also pointed out that first-generation students felt that they had to put more time into studying than other students because they had more fear to fail in college than their peers whose parents had at least a bachelor degree. This could lead them to have higher academic adjustment. 5.2 Generational Status and Academic Self-Efficacy In contrast with previous research (Hellman, 1996; Aspelmeier et.al., 2012) that found firstgeneration students had lower self-efficacy or self-esteem than their peers, first-and second-generation college students participated in this study showed no difference in their academic self-efficacy. As mentioned earlier, academic self-efficacy is someone’s self-evaluation about one’s abilities and/or chances to succeed in academic environment (Robbins et al., 2004). Every university participated in this study has an entry exam to ensure the standard of academic potency their new-coming students. This could be the reason that first-generation students in this study had no inferior feeling regarding their abilities compared to their peers. Moreover, this study was conducted in first-semester of their first-year of study, before participants had their study evaluation result. So, their evaluation of themselves was still largely influenced by their past achievement and may not be objectively related to their academic performance in university yet. Besides, participants in this study were chosen based on their own willingness to participate. In this form of situation, there is possibility that only highly motivated students or those with high self-efficacy were participated. Asea Uninet Scientific and Plenary Meeting 2016 | 599 Motivation and self-efficacy are, indeed, interrelated with each other (Lai, 2014). So, despite of the generational status, participants’ level of academic self-efficacy has never been different originally. 600 | Asea Uninet Scientific and Plenary Meeting 2016 5.3 Academic Self-Efficacy and College Adjustment Consistent with previous researches about self-efficacy effect on adjustment (Chemers et al., 2001; Poyrazli, et al., 2002; Lai, 2014) this study also proved that academic selfefficacy was related to first year students’ college adjustment, both in overall and in each of college adjustment aspects. As explained by Bandura (in Zajacova et al., 2005), selfefficacy would increase students’ motivation and persistence to master challenging academic tasks and foster the efficient use of acquired knowledge and skills. Majer (2009) also found that educational self-efficacy had significant correlation with optimism and selfmastery. These explained the result of this study. When students have high academic selfefficacy, they would be motivated to do any efforts needed to adjust with their college life. They would also persist in their efforts to adjust because they optimist that they have the ability to succeed in their academic life. However, even though academic self-efficacy could explain college adjustment and its components (academic adjustment, social adjustment, personal-emotional adjustment, and institutional attachment), its contribution was not too big (the biggest was 20% on AA). It means that there are other factors that need to be understood as they give bigger contribution on first-year college students’ adjustment. Internal variables, like personality (Holmbeck & Wandrei, 1993; Hirai et.al., 2015), interest (Allen & Robbins, 2008; 2010), self-regulated learning skills possessed, etc. also have been linked to college adjustment. External variables, like social support (Friedlander et.al., 2007) or culture/collectivism-individualism (Choi, 2002) have also been investigated to affect college students’ adjustment. Therefore, involving more predictor variables in the next research in order to understand college students’ adjustment even better. 6 IMPLICATION Based on this study findings, higher education institutions and other institutions related to higher education should focus more on providing assistance and resources for their students and potential future students (high school students). So, despite of their family background (first-generation or not), they should be well-informed about college life. This will help them to have better adjustment in their transition from high school to university. Intervention program to increase students’ academic self-efficacy, for example by conducting training or providing counselling, could also be done to help students adjustment. However, as in numerous studies regarding college students, the main limitation of our research is the sample selection bias, as participants in this study didn’t get chosen randomly. Thus, the non-existence of variable investigated in this study could be affected by other factors that were not measured, such as students’ motivation level, achievement in previous study, personality, social support they received, etc. Because of that, for future research, using random sampling and making sure that all kinds of students were involved in study need to be done in order to get a more representative portrait of college students. Other limitation in this study is the number of participant. Even though college students enrollment in Indonesia is not high compared to more developed countries (only between 20-30% from all students graduate from high school), but as one of most populated countries in the world, college students population in Indonesia is a big population (around one million according to Indonesia Ministry of Education and Culture, 2012). Further research should involve more participants in order to increase the representativeness of the study findings. Research on college adjustment, especially for first-year students, should also conducted more, especially in Indonesia and ASEAN countries, as our students may have Asea Uninet Scientific and Plenary Meeting 2016 | 601 different characteristics from those in American or European countries. Not only involving more participants, further study need also investigate more variables that could explain college adjustment, so that a better understanding on this subject could be achieved. At the end, hopefully this understanding would help not only higher education institutions, but also government, in increasing the quality of human resources. REFERENCES Allen, J. & Robbins, S.B. (2008). Prediction of college major persistence based on vocational interests, academic preparation, and first-year academic performance. Research in Higher Education, Vol. 49, No. 1, p62-79 Allen, J. & Robbins, S.B. (2010). Effects of interest-major congruence, motivation, and academic performance on timely degree attainment. Journal of Counselling Psychology, Vol. 57, No. 1, p23-35 Al-Khatib, B.A., Awamleh, H.S., & Samawi, F.S. (2012). Student’s Adjustment to College Life at Albalqa Applied University. American International Journal of Contemporary Research, Vol. 2, No. 11, p7-16. Al-Qaisy, L.M. (2010). Adjusment of college freshmen: the importance of gender and the place of residence. International Journal of Psychological Studies, Vol.2, No.1, p142-150. ASEAN Secretariat. (2013). ASEAN state of education report 2013. http://www.asean.org, retrieved on Dec 12th, 2015. Aspelmeier, J.E., Love M.M., McGill, L.A., Elliot, A.N., & Pierce, T.W. (2012). Selfesteem, locus of control, college adjustment, and GPA among first-and continuinggeneration students: a moderator model of generational status. Research in Higher Education, Vol.53, p755-781. Atwater, E., & Duffy, K.G. (2005). Psychology for living: Adjustment, growth, behavior today. New Jersey: Prentice Hall. Baker, R.W. & Siryk, B. (1984). Measuring adjustment to college. Journal of Counselling Psychology, Vol. 31, No. 2, p179-189. Baker, R.W., Siryk, B. (1986). Exploratory intervention with a scale measuring adjustment to college. Journal of Counseling Psychology, Vol. 33, No. 1, p31-38. Chemers, M.M., Hu, L., & Garcia, B.F. (2001). Academic self-efficacy and first-year college student performance and adjustment. Journal of Educational Psychology, Vol. 93, No. 1, p55-64. Choi, K. (2002). Psychological separation-individuation and adjustment to college among Korean American students: the roles of collectivism and individualism. Journal of Counseling Psychology, Vol.49, No. 4, p468-475. Friedlander, L.J., Reid, G. J., Shupak, N., Cribbie, R. (2007). Social support, self-esteem, and stress as predictors of adjustment to university among first-year undergraduates. Journal of College Student Development, Vol. 48, No. 3, p259274 Gerdes, H. & Mallinckrodt, B. (1994). Emotional, social, and academic adjustment of college students: a longitudinal study of retention. Journal of Counselling and Development, Jan 1994, Vol. 72-3,p281-288. Hafidudin, U. A. (2011). Perbedaan college adjustment dan self-esteem mahasiswa universitas Indonesia tahun pertama yang tinggal di rumah, asrama, dan kos. Undergraduate thesis. Depok: Indonesia University (unpublished article). 602 | Asea Uninet Scientific and Plenary Meeting 2016 Hahs-Vaughn, D. (2004). The impact of parents’ education level on college students: An analysis using the beginning post-secondary students longitudinal study. Journal of College Student Development, Vol.45, No.5, p483-500. Hirai, R., Frazier, P., & Syed, M. (2015). Psychological and sociocultural adjustment of first-year international students: trajectories and predictors. Journal of Counseling Psychology, Vol. 62, No. 3, p438-452. Holmbeck, G.N. & Wandrei, M.L. (1993). Individual and relational predictors of adjustment in first-year college students. Journal of Counseling Psychology, Vol. 40, No. 1, p73-78. Indonesia Ministry of Education and Culture. (2012). Indonesia educational statistics in brief 2011/2012. http://kemdikbud.go.id, retrieved at Sept 30th, 2015 Khanh, V.T. (2002). First-generation college students at a four-year university: Background characteristics, reasons for pursuing higher education, and first-year experiences. College Student Journal, Vol. 36, No.1, p3-19. Keels, M. (2013). Getting them enrolled is only half the battle: college success as a function of race or ethnicity, gender, and class. American Journal of Orthopsychiatry Vol. 83, No. 2,3, p310–322. Lai, C.S. (2014). College freshmen’s self-efficacy, effort regulation, perceived stress and their adaptation to college. Asian Journal of Humanities and Social Sciences Vol. 2, No. 2, p107-117. Majer, M. (2009). Self-efficacy and academic success among ethnically diverse firstgeneration community college students. Journal of Diversity in Higher Education, Vol.2, No. 4, p243-250. Mustapa, D. (2015). Hubungan antara keberfungsian keluarga dan penyesuaian diri sosial pada mahasiswa baru di Universitas Indonesia. Undergraduate thesis. Depok: Indonesia University (unpublished article) Pascarella, E.T., Pierson, C.T., Wolniak, G.C., & Terenzini, P.T. (2004). First-generation college students: Additional evidence in college experiences and outcomes. Journal of Higher Education, Vol. 75, No.3, p249-284 Pike, G.R. & Kuh, G.D. (2005). First-and second-generation college students: A comparison of their engagement and intellectual development. Journal of Higher Education, Vol. 76, No.3, p276-300 Poyrazli, S., Arbona, C., Nora, A., McPherson, R., & Pisecco, S. (2002). Relation between assertiveness, academic self-efficacy, and psychological adjustment among international graduate students. Journal of College Student Development, 43, p632-642. Rogeleonick, A. (2014, Jan). Target 2015, angka partisipasi kasar perguruan tinggi 35 persen.Kementerian Pendidikan dan Kebudayaan Republik Indonesia. http://www.kemdikbud.go.id/kemdikbud/berita/2083. Retrieved on Sept 10th, 2015. Robbins, S.B., Lauver, K., Le, H., Davis, D., Langley, R., & Carlstrom, A. (2004). Do psychosocial and study skill factors predict college outcomes? A meta-analysis. Psychological bulletin, Vol. 130, No.2, p261-268 Siregar, S.M.W. (2011). Gambaran School well-being dan college adjustment pada mahasiswa strata satu proram regular angkatan 2010 fakultas psikologi universitas Indonesia. Undergraduate thesis. Depok: UI. (unpublished article) Terenzini, P.T, Springer, L., Yaeger, P.M., Pascarella, E.T., & Nora, A. (1996). Firstgeneration college students: Characteristics, experiences, and cognitive development. Research in Higher Education, Vol. 37, No. 1, p1-22. Asea Uninet Scientific and Plenary Meeting 2016 | 603 Toews, M.& Yazedjian, A. (2007). College adjustment among freshmen: predictors for White and Hispanic males and females. College Student Journal, Vol. 41, No.4, p891-900 UNDP (United Nation Development Program). (2014). Sustaining human progress: reducing vulnerabilities and building resiliences. Human Development 2014. http://hdr.undp.org. retrieved on Sept 22nd, 2015. Waller, T.O. (2009). A mixed method approach for assessing the adjustment of incoming first-year engineering students in a summer bridge program. Dissertation. Virginia Polytechnic Institute and State University. http://proquest.com. Retrieved on Sept 10th, 2015. Wintre, M.G. & Bowers, C.D. (2007). Predictors of persistence to graduation: extending a model and data on the transition to university model. Canadian Journal of Behavioural Science Vol. 39/No.3, p220-234 Yazeidjan, A., Toews, M., & Navarro, A. (2009). Exploring parental factors, adjustment, and academic achievement among White and Hispanic college students. Journal of College Students Development, Vol. 50, No. 4, p458-467 York-Anderson, D.C. & Bowman, S.L. (1991). Assessing the college knowledge of firstgeneration and second-generation college students. Journal of College Students Development, Vol. 32, p116-122 Zajacova, A., Lynch, S.M., & Espenshade, T.J. (2005). Self-efficacy, stress, and academic success in college. Research in Higher Education, Vol. 46, No. 6, p677-706. RISKS IN REAL ESTATE VALUATION OF STATE BANKS IN VIETNAM Minh Ngoc, Nguyen minhngoc@neu.edu.vn National Economic University, Tran Dai Nghia street, Hanoi, Vietnam Abstract The article aims to analyze and summarize the risks in the process of real estate professional valuation of the valuers operating in the banking sector of Vietnam. Through the empirical researches, and based on the requirements of technical procedures of real estate valuation, the article points out many inefficiencies of the majority of the current valuers in their daily business operations. The content of this article also investigates many issues such as legal risk; market risk, and professional ethics in the process of real estate valuation. KEYWORDS: real estate valuation, risk in valuation, professional ethics 1 INTRODUCTION For the State banks, properties are the right assets, among others, to be mortgaged. The proportion of mortgage loans related with properties in banks is always higher than 80% among all kinds of loans. So, the right valuation of property assets, conforming to given lending rules and regulation, is of the core essential for many State banks. The reality of previous years has just showed the important role of assets valuation (including properties) for the effectiveness and profitability of banking operations. The proper valuation even determines the existence or not of the bank (or whether it should be acquired by others). In context of current instable property market of Vietnam, the deep understanding of the professional work of assets valuers in banking sector is not enough. This is only a prerequisite condition of the good valuation activity. To assure the quality of valuers’ tasks and the safety of banking activity as a consequence, the valuers should profoundly comprehend the features, the specific characteristics of each property market. The comprehension and forecasting of all risks related with property assets valuation in particular and the understanding of overall property market in general is a sufficient condition for good valuation activity. The content of this article will deal with the main types of risks in valuation activity. The article will not touch closely to each of the risk area but it will primarily assess the overall situation in order to contribute to the enhancement of the awareness of the assets valuers in State banks. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 604 Asea Uninet Scientific and Plenary Meeting 2016 2 2.1 | 605 LEGAL RISK OF PROPERTY The right to use the land and assets related to it Amongst the most commonly accepted by State banks assets as a guarantee, one should mention land usage right and assets related to land. As of a second range, there are machineries, technical equipments, transport means, goods and valuable papers etc. Land is a special kind of asset, belonging to the nation, and managed by State. Each person, each family, each organization, and each local community has just only the right to land usage, not to possess it. That’s why the property mortgage is, in reality, the mortgage of land and the assets related. Since that, the asset mortgage to be accepted by State banks, which is a property, depends heavily on the character of property in each particular case. The risks, that might be encountered in reality by state banks in the process of acceptation the mortgage of land usage right and assets related to the land, are: a) The right to land usage: In case of the land user has the land usage certificate (“certificate of the land usage right” issued to a concrete person), the mortgage issued, based on those given assets, usually does not encounters any serious trouble. The determination of the money value of the property (called also the assets valuation) is based on the certificate of the land usage right. However, in case of some types of the assets such as land for rent with annual payment, the law and other particular related rules state that the land user has no right to mortgage the right to use this land, but has the right to mortgage the assets related to it (build, constructed on it). In reality, today commercial and State banks only determine the money value of the assets related to land for the mortgage purpose, in order to conform to the law. However, because the law states clearly that the land for rent with annual payment can be mortgaged based on the assets related to it, this will cause many troubles and risks for banks in case of accepting those assets in a mortgage purpose. The risks that might be encountered by banks while accepting those assets as subjects of mortgage are [4]: The land law states clearly: Each organization or each person (called shortly as the land user) who rents the land with annual payment will has no right dedicated to the land user. Therefore, when the State reclaims the land for other purposes (i.e. public construction projects) the land user will be compensated only according strictly to the price of renting the land. The reality shows that, lands for rent (with annual payment) in industrial zones, economic zones, high-tech zones are relatively stable in terms of risk of reclaiming. The rest of lands (in other positions) usually are already planned to be used by government in other purpose, so the risk of reclaiming and instability as result is too high. The planning policy may be totally changed according to different periods of country’s socio-economic development or adjusted to the need of the governing political body. Hence, the acceptance of assets related with the lands for rent in this case as subjects of mortgage often associated with many dangers, because the mortgage loan is contracted for a long term and that might bring about serious risks in the process of dealing (transferring, liquidating) with mortgage assets. In order to put the limit to the risk, commercial banks often value the assets related to lands quite cautiously and offer customers loans within shorter terms of payment than usually, or should the banks fix the price according to the framework of compensation prices proposed by State [1, page 24]. b) Assets related to the land: The registration of the right to possess assets related with land in general and with land for rent with annual payment in particular encounters many difficulties, accompanied with complicated and prolonged procedures. Most of the users of land for rent with annual payment only apply for construction permission and carry out first stage of the procedure to register the right to possess assets related with land. Afterwards, they start procedures 606 | Asea Uninet Scientific and Plenary Meeting 2016 for banking mortgage loans. Under the legal aspect, the land users are not yet granted the certificate of the right to possess assets related with lands for rent. That means those assets are to be formed in the future. Therefore, the acceptance of assets mortgage depends on the rules of the law relating to the mortgage of assets that are to be formed in the future. In some provinces, the State organs tend to approve to notarize mortgage contracts of the assets that are to be formed in the future [3, page 14]. However, in some other provinces the mortgage of the assets to be formed in the future sees many difficulties, and some notary organs refuse to register mortgages based on the assets related to the lands for rent with annual payment. In case of assets valuation, which are related with lands, and it is unable to notarize the mortgage contract, there are a lot of risks posed for commercial banks if they have to deal with those assets to reclaim the debts late on. Assets mortgage contracts often are proclaimed by court as invalid and it is impossible to resolve the mortgaged assets. Normally, State banks will have to find out the possibility to notarize the registered contracts of mortgaged assets related to lands for rent with annual payment in provinces where they (lands) are located. 2.2 The complexity of law and the possibility to apply it Legal risks of the assets are associated with the complexity of the law and the possibility to apply it to the valuation activity of State banks. For example, how to accept the mortgage of the right to use the agricultural lands? Currently, the law rules that most parts of the agricultural lands (lands for the purpose of raising aquatic product, salt making, rice field, trees and forest cultivation) are approved to be mortgaged. However, for each type of the above mentioned lands, the law issued some regulations concerning on what basis to mortgage, for example: 1) 2) Agricultural lands designated for rice cultivation are subjects to be mortgaged. However, the law also states clearly about their concession possibility: “Households, private persons not directly engaged in agricultural production can not be conceded, as a gift or else, the right to use the lands designated for rice cultivation”. Hence, the lands usage right concession, where the lands are designated for rice cultivation, is restricted in terms of subject of concession. The reality today is that not many commercial banks know about it thoroughly and that might leads to certain risks taking place in the process of assets liquidation to reclaim the debts [3, page 24]. Currently, the land assets valuation by State banks is carried out according to the market price (hardly ever using State price framework to calculate the value of the secured assets). This should be done cautiously because in reality the law also states clearly that, in some special cases, the value of mortgaged assets must be calculated using state price framework. For example, the value of agricultural lands usage right, in case of the subjects such as households and private persons to whom the State assigns the lands without any fee of usage, is determined by local authority, not deducting the value of land usage right calculated for the period of usage. Therefore, in the above mentioned case, besides the necessity to determine the agricultural land usage right, State banks should pay attention to the fact that whether this kind of agricultural land is a subject of State assignment with or without collecting the usage fee? It is very hard to find out if in the certificate of land usage right no such information is given. Acting against this rule, that is to determine the price not according to the State price framework, will certainly lead to major risks in assets liquidation in case of reclaiming (The assets mortgage contracts will be proclaimed invalid by court). Asea Uninet Scientific and Plenary Meeting 2016 3) In reality, there is quite a big gap between the price of market transaction and the price within the State price framework. Therefore, the lack of understanding, and as a consequence acting and applying unskillfully the State’s rules and regulations in determining the assets’ value will pose a great risk for the banking sector. Due to the lack of information and experiences with property market as well, determining the price (value) of agricultural lands is the Achilles’ heel of all bank’s professional valuers. State banks, in practice, have been applying rules of the law concerning the case of agricultural lands without collecting usage fee as follow [2, page 54]:   2.3 | 607 In some State banks there is a precise appraisal procedure in place, with concrete instructions for mortgage employees in order to guarantee the conformation to the rules of the law and to assure that mortgage loans are available for customers in case that the part of agricultural land assigned by State without collecting usage fee is next to the part of non-agricultural land. Then, the price of the first part of land (agricultural land) is determined by State price framework, the difference in value between the market price and State framework price will be counted into second part of land (nonagricultural land). In case of all parts of land are agricultural and assigned by State without collecting usage fee, the State banks will conform to the rule which states that the value must be determined by State price framework to avoid potential risks. The awareness of the valuer The awareness of the valuer here should be understood by the awareness of the risks in mortgage assets valuation. The risks, that mostly occur, relate to the subjective psychology, the lack of knowledge and practical experiences in the process of applying of the banking appraisal procedure, and the understanding related rules of the law.   2.4 Awareness of appraiser/valuer about the legal risk: Valuers may figure out the legal risk but are not capable to assess it properly or to put forward suitable proposal that might lead to serious consequences (i.e. the case of agricultural land valuation; land with disputes but without any evidence) Land which is used in wrong purpose but still available for mortgage (this often occurs with projects constructed on land for rent, land with non-agricultural purpose). Meanwhile, land which is used in wrong purpose according to the law will be reclaimed. Legal knowledge is needed to determine the land is used in wrong purpose or not (i.e. land assigned by State is a land for living purpose but if is used to raise fishes, will it be treated as a land used in wrong purpose?). Today’s reality shows that, in practice of valuation, valuers may observe, figure out, find out that the land user use it in right purpose or not. Hence, the awareness of valuer in the process of valuation is one of the important factors to assess and eliminate the risk in property assets mortgage activity. The change of legal state Determining the value of assets (property) is carried out for the purpose of mortgaging a long term loan. Hence, the risk in valuation may occur in case of sudden change of the legal state of property. 608 | Asea Uninet Scientific and Plenary Meeting 2016 1) 2) Risk resulting from the fact that property belongs to the zone of city planning: This is a greatest risk, and in reality, a risk that commercial banks mostly encounter (according to previous valuation the land/property didn’t belong to the zone of city planning, but next time of valuation shows that the land/property is in that “prohibited” zone). In the process of practical observation, the valuer can gather all informations about the risk of belonging to the “prohibited” zone of the property appraised. Perhaps, due to subjective psychology, one might think that the plan will not come into realization or otherwise we have a plenty of time to wait until the customer’s mortgage loan expires. In this case, the risk appears for State banks if the State wants to reclaim land ahead of time. In case of property is a land for rent with annual payment, to precisely catch the idea of this issue, one should learn more about the value/price of this type of land. Practically, the law does not allow to mortgage or concede the land for rent with annual payment. However, due to the disparity between the State-determined rent price changing periodically and the real price of market concession (the seller and buyer practically are still making concessions through forms of co-investment to create a new legal entity or to concede assets related with land for rent with annual payment). In this case, land renting contracts are valid in market transactions. Hence, several State banks have cleverly apply this land rent right mortgage in practice and calculate the value of land rent right into the assets strictly related with land (for example, the value of land for rent is determined by land rent right value added by value of assets strictly related with land; in there, the value of land rent right is determined by disparity between the market price of non-agricultural land and the amount of money the land user has to pay if changing from form of land renting to land assignment). This formula one time has become a method to create a big advantage for banks in the process of determining the value of assets related strictly with the land for rent with annual payment. However, at this moment, most commercial banks are in trouble to redetermine the value of those given above assets. The reasons are as follow [3, page 23-25]:   At the moment when State banks set up a method to calculate the “F” (the amount of money that the land user has to pay if he or she want to change from the form of land renting to a form of land assigning with collecting usage fee) the the value of “F” will be calculated just with the State framework price in case of land assignment with collecting usage fee deducting the land rent fee paid in advance. Currently, the State rules that in case the land for rent user wants to change from form of renting to a form of land assignment with collecting usage fee, the amount of money to be transferred to the State’s treasury to change the purpose of usage should be determined according to market price, the question is how to determine a market price at a given moment? In reality, many banks are unable to answer this question. Those above reasons make the valuation of land rent right previously considered as no-risk operation, now to bring about many potential risks. 3 THE LIQUIDITY RISK OF PROPERTY To take a property under mortgage, the most important thing for valuer is to answer the question about the market value of the property. What is the level of price of property for the State banks to be accepted to guarantee themselves maximum safety? In reality, determination of the value of mortgaged property depends largely on business strategy and goal. Thus, it depends heavily on the level of accepted risk of each State banks individually Asea Uninet Scientific and Plenary Meeting 2016 | 609 (taste of risk) for each kind of property. However, in terms of valuation rules, one might determine value of property in current moment but cannot know exactly its value in the future. To guarantee decent safety, valuer should be aware of certain fundamental risks to properly valuate the property assets: 3.1 Liquidity risk originating from macroeconomic policy In current stage, the government is carrying out restrictive money policy to curb the inflation and stabilize the macro-economy. That leads to the situation that the capital flows for property projects in the period of 2010-2013 is scarce. This situation may cause some of the risks in terms of liquidity for the property projects such as [1; page 6]:   While the property projects are being developed but the macro policy puts forward some limits in terms of credit rate for the undesired business braches (including real estate sector) not to exceed 16% of all loans of financial sector (banks and credit institutions). Thus, banks no longer lend money to investors. In case of not strong enough financial capacity of investors, there are no more money in place for them to develop projects; In case if the projects are delayed the investors’ business plan as well as customers’ payment will be badly impacted. This way, the real estate projects will be inside a no-go ring, leading to the risk of increment of bad loans on the banks’ side. Investors will pay more due to the lagging cash flows. Customers will have less chance to receive their houses on time. Previously, the liquidity risks of real estate projects are quite serious. Changes in macro policy for the production activities also lead to the changes in lands’ prices. For example, we should mention some production villages that specialize in traditional well-known textile products such as pillows, quilts, blanket… Most of the dwellers are living on such productions and their level of income is higher than level of income of people in the neighbor villages. So, the need to expand the production spaces is on the rise. Thus, lands’ prices at those areas may reach at some moments the level that exceeds many times of the level of closest areas. Together with economic development, the environmental pollution is more and more seriously. To the end of the year 2009, on the demand of Central People’s Committee, those villages and some other closest areas should be replanned. Accordingly, all production and business activities are moved to a new zone with new conditions for development. Since then, the demand for lands in old areas for the production extension purposes will no longer exist, leading to a sharp fall in lands’ prices. Due to these reasons, the fact that the city is replanning some of its areas for economic development purposes will lead to many changes in property demand’s side. Therefore, property’ liquidity will also be impacted negatively. One should mention several communes which have in their plans to build cementery as a typical example of property price’s turnaround. At the moment when the planning for cementery building is not heard of, lands’ price is quite high comparing to people’s average income, mainly due to cash flows of investors (rather speculators) from capital city. However, when this planning’s information was delivered to public, investors barter away due to psychological fears that properties will possibly be inside the planned zone causing properties’ price to fall sharply as well as their liquidity. 3.2 Market risk The economic crisis has lead to a state that property market is deeply frozen, concretely some parts of the property market in rural areas or even in the cities. Lands and properties’ 610 | Asea Uninet Scientific and Plenary Meeting 2016 prices in largest cities and the areas surrounding have been downed nearly 50%. This will certainly lead to the need to include the liquidity of property in the future to the current property valuation. Besides the reality that the whole market is frozen, the valuers should have more information and profound understanding related to each segment of the general market. Based on the experience of previous years, we have seen the irregular up and down of different segments of the market, leading to different liquidity of property in different periods. a) Risk related with assets (in process of usage, political security…) In reality, the consideration that a given property is easy or difficult to sell depends on many factors, among them the basic features of property are decisive factors determining its sell ability:    How is the size of property? If the size is too big, we should be careful. What purpose the property is used for, and whether this purpose is the right test and the most reasonable one? In case of property selling, who might be a potential buyer? How many people afford to buy this property? Is this property in shape in terms of form and location? Is this property close to cementery or any dangerous place? b) Risk of natural disaster   4 4.1 Is the property prone to flood and natural disaster or lying outside the dike? The valuers should have proper warnings and propositions. To limit the potential risks, in case of property is flammable (high building office, restaurants or fuel stations) the valuers should put forward proper warnings. ETHICAL RISK Ethics of customer In case of capital needs for the production and business activities, each organization and individual will look for mobilization channels to respond to them (needs), those channels include banking credits. In market economy, customers are quite diverse in terms of power of purchase, ability to pay, and belonging to different parts of the economy and society. There are many customers with good business ethics, but some of them are lacking in it. In the documents filed for application for banking and other financial institutions’ credits the guaranteed assets are important parts besides other factors such as: credit records, financial factors, variants of production and business plan… The work of valuers normally is to contact and examin customers in field of guaranteed assets, so it is hard to fully assess their credit records. Thus, in case of encountering customers with bad business ethics, the risk in terms of guaranteed assets appears. There are several property risks originating from customers [1, page 4-6]:  Customers intentionally cheat banking officers, including credit staff and valuers. For example, the position of a land piece shown in the certificate of land usage right has been hidden or misinterpreted in favor of the land user/owner. This will lead to many risks related with property price valuation. The valuer will give out a better price than the real value of property according to the certificate of land usage right. That will pose a risk for commercial banks. If customers still are doing business well and are capable to pay the debt on time then nothing happens. Asea Uninet Scientific and Plenary Meeting 2016     4.2 | 611 However, in case of customers’ bankruptcy, the banks have to liquidate their property assets to reclaim money including principal and interest. The chance to recollect all debts is quite low because the position of property has been improperly revised up. Customers are also subjects of cheating by property sellers, leading to instructing the valuers with wrong position: similarly to above mentioned case, when customers are property potential buyers in areas without specified street address, they might be wrongly instructed (not according to the information shown in the certificate) by sellers. That’s why customers themselves also unintentionally are not aware and as a result show wrongly to the valuers. In reality, two given situations are quite common and almost all commercial banks encounter similar problems, especially in suburban areas, alongside the city neighborhood where there are no specified clearly address in terms of the number and the name of street. Risk when customers lend or rent their certificates. This is a common phenomenon in the outskirt of largest cities. There are two forms of this practice: the owner, together with customer, applies for banking credit or the owner rents his or her certificate to the customer. In both those situation, the property owners normally are not aware of all their responsibility when signing mortgage contract with commercial banks (this may be done through empowerment contracts), in case of financial trouble and as a result banks have to liquidate their assets, customers will understand the seriousness of issue, then it is usually too late. From banks’ side, the chance to liquidate assets will be complicated and much more difficult. From the valuers’ side, encountering situation like this, they should issue warnings for the all, including business unit and credit approval authority to work out measures to counter the risk related with complexity in terms of ownership and overlapped relations of guaranteed assets. Risk associated with incomplete information about guaranteed assets for the valuers: The certificate has a lot of information on it related with the banking property mortgage, normally the valuer receives only a copy from customer (through credit officer), thus, if information related with property is not complete, this will negatively impact the result of valuation. For example, in the certificate there is a note that part of the land is inside the planned clearance area, in the copy delivered to the valuer, for some reasons, this planned part is not exposed, leading to a risk posed for banks in terms of guaranteed assets. Risk in terms of position of planned lands for construction projects, position of apartment buildings: in context of current gloomy property market, there are many cheating affairs related to the position of apartment buildings, position of planned lands for construction projects. The fact that customers wrongly instruct the valuers about the positions of projects will lead to an incomplete valuation of factors related with property, such as: clearing the ground, progress of projects … thence the property valuation will not be carried out precisely, leading to many risks for banks. The righteousness of other organizations There is quite a lot of enterprises taking part in the property market and offer valuation services. Besides enterprises that have created themselves a solid trademark in the market, there still exist many enterprises which operate shortsightedly, running after the current needs of customers. For this reason, using their services, especially the results of their valuation in form of market reports which have been carried out in a non-professional way, will lead to many potential risks. On the other hand, there are a lot of foreign companies 612 | Asea Uninet Scientific and Plenary Meeting 2016 just specializing in market property valuation services. Not all of them, in different stage of operation, will deliver valuation service of high quality. Some of them put out to the market their valuation services that have been well customized to the domestic valuation quality. In the context of severe competition in the property market, and real estate sector, companies, those domestic as well as international ones are striving to guarantee customers maximum level of satisfaction in order to win service contracts as much as possible. 5 CONCLUSIONS The analyses and reviews above mentioned concerned the main risks related to the assets valuation activity that exist in all State banks in Vietnam. The content of this article still does not mention other risks related to the assets valuation activities which (identified risks) are results of the subjective perception of the valuers such as the procedures and methods for valuation. However, we can surely affirm that the risks, whether their nature is subjective or objective, will impact greatly on the results of valuation activities. The risks forecast and management is a prerequisite factor to guarantee the effectiveness of the property assets valuation process in Vietnam’s State banks. The article is useful for foreign investors with intention to invest in Vietnam’s property market and real estate sector. Specific information and knowledge given here touch the characteristic features of the market/sector and will certainly help investors to delve into the changing reality of them in order to make proper investment decisions and effectively manage their businesses. REFERENCES Nguyen Minh Ngoc (2012). Education material concerning properties valuation of Vietnam International Bank. Hanoi. Lecturing materials for propertyes valuation (2008). Faculty of Real estate and resource economics, National Economic University. Hanoi. Vu Van Thanh, Tran Van Thang. (2012). Material for properties valuation, Hanoi. Land law (2013). Law for real estate business (2014). Decree 181/2004/ND-CP PERSONAL TRAITS OF LEADER IN SELECTED ENTERPRISES IN VIETNAM Luong Thu HA haluongthu@yahoo.com National Economics University, Vietnam Abstract Certain achievements has been attained in Vietnam after 30 years of innovation. These results have been a significant contribution of enterprises with different types of ownership. Along with the process of renovation and equitization of state-owned enterprises, the private sector is increasingly important and contributes more to economic grow specifically and development of the country generally. The leaders play an important role and have a significant affect on the success of enterprises. This study was conducted to indicate the personal traits of leaders that help them achieve success in business; help them create a personal imprint and help us to realize them in the business community. Devetailed with some previous studies, this study showed that courage and determination, vision, passion and curiosity, leadership style are factors that help the leaders succeed. In addition, The aspiration to enrich legitimately is a very important factor to help leaders overcome difficulties and failures. Social responsibility and national spirit are factors help their achievements in business become great and lasting. And this is also the separateconclusion of this research. Keywords: Trait, leader’s trait, leadership. 1 INTRODUCTION AND LITERATURE REVIEW Qualities of leadership were widely interpreted as the personal qualities / traits of leaders, to distinguish a leader with different leaders. The personal qualities / traits can be positive or negative. In business and management, the personal qualities/traits of leaders could affect outcomes, effective leadership. Research on leaders' qualities, Sankar (2003) said that "vision, goals, selfconcept, strategies, work ethic, perception, code of ethics, behavior and the search for excellence" help leaders succeed in their work. Similarly, some studies have shown the link between effective work with a number of personal traits such as courage, integrity, passion, compassion, optimism, kindness, humanity, purpose, sympathy (Bright, Cameron and Cazal, 2006). Rooted in psychology, besides The Big Five Traits Theory suggested by Judge, Bono, Illies and Gerhardt (2002), Peterson and Seligman (2004) presented 6 virtues with 24 traits that help individuals, leaders success, satisfy with work: Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 613 614 | Asea Uninet Scientific and Plenary Meeting 2016 Wisdom, Courage, Humanity, Transcendence, Temperance and Justice. Based on this category, Noel Balliett Thun (2009) developed the scale and measured their impact to leadership performance. This category is more consistent with business and management. Personal qualities of leaders influenced by many factors including biological factors, natural and other elements from external impacts such as cultural norms, events happened in life... (McCrae and Costa, 1999; McCrae, 2004). Previously, Triandis (1989) also pointed out that differences in cultural context (the complex, individualism - Exercise and power distance) also influence the personality and behavior of each individual. In Vietnam, business leaders formed lately, were not highly appreciated and created conditions for development in a very long period. Along with economical innovation and management thinking, businessman class has been growing and taking increasing important roles to the country's global integration. However, overall assessment, after nearly 30 years of innovation, businessman class is fundamentally weak in terms of knowledge, ability and managerial experience (Tran Thi Van Hoa, 2011). On the other hand, according to publication from the General Department of Statistics, in the last 5 years the number of business bankruptcies continued to increase from 43,000 in 2010 to more than 53,900 in 2011; 54,200 in 2012; 60,700 in 2013 and more than 67,800 to the end of December 2014. This figure tends to growing up because of the capacity and the quality of entrepreneurs, business leaders. Therefore, the research on leader’s trait and the influence of these factors on leadership performance is a significant issue of theory and practice in conditions Vietnam. 2 RESEARCH METHOD Research objects: This study focused on the personal qualities of leaders, which only refers to the positive qualities. The leaders in the enterprise is understood that people have an important role to the business strategy and the success of the enterprise. The leaders may take different positions (President / Vice President, member of the Board) or managers (General / Deputy Director General), but the success of the enterprise is always associated with their name and image. Research method: Use multiple-case analysis. Sampling method: Cases are selected by the influence of the corporate/company, business sector, business scale; the leaders’ personal influence to business and the community, leaders’ gender, profession, awards and so on. Collecting information method: The author collected secondary information through interviews in newspapers / magazines / talk show / leader’s autobiographical books. Time for gathering information: Almost information was published in period 2010-2015. Asea Uninet Scientific and Plenary Meeting 2016 | 615 3 CASE ANALYSIS The author selected five cases according to listed criteria. Here is the basic information about these cases and leaders that were chosen. Criteria Trung Nguyen Establish 1996 Industry Coffee; Franchising; Pho 24 Vinamilk Vingroup Hau Giang Pharmacy 2003 1976 1983 1974 Food store chain Dairy industry Tourist and resort; real Pharmacy Modern distribution and retail services; Tourism 60 countries 7 countries Current status Working Sold Founder Dang Le Nguyen VU Ly Quy TRUNG Year of birth 1971 1966 Position President and CEO President Scope 3.1 estate; e-business 16 countries Working Vietnam Vietnam Working Working Formerly Stateowned enterprise 1953 Pham Nhat VUONG 1968 Formerly Stateowned enterprise 1951 President and CEO President CEO Case 1: Dang Le Nguyen VU – Trung Nguyen Coffee Dang Le Nguyen Vu was born and grow up in a poor family, living by cultivating coffee in Nha Trang, Khanh Hoa. Facing with so many difficulties during the youth, having enthusiastic zest for coffee, he never tires of his burning passion to his staffs, to the coffee growers to get ready for Vietnam coffee beans themselves world class. Aspirations of legitimate enrichment: Living by farming, his family was so poor that when his father falls seriously ill, he could not borrow 200 USD for treatment. Dang Le Nguyen Vu, 16 year-old son, has vowed: "One day I would change the life of our family". On 3rd year in Tay Nguyen Medical University, realizing the health sector would not help him to meet his dreams and ambitions, he decided to quit school and took a car to Ho Chi Minh City to look for opportunities. On the way back to the Highlands to complete the study on the advice of his uncle, Dang Le Nguyen Vu still simmering with a business idea. He wanted to produce and export a finest coffee to international market. Energy and determination: Dang Le Nguyen Vu is a persistent and determined person. He and three friends began by pooling money to buy a coffee roaster. Initial difficulties, the roaster was clear up but Dang Le Nguyen Vu still kept continue, rode a bicycle to borrow coffee bean. He always maintains the stand that when doing anything, we need a clear purpose, overcome our own pride to have success. After that, they had a new partner in Long Xuyen but the cooperation quickly crumbled to lose the entire capital. Resorting to the money of a friend after selling his motorbike, he could continue his work. 616 | Asea Uninet Scientific and Plenary Meeting 2016 The more adversity he experienced, the more courage and determination he has to help him build a strong brand and strong corporation as Trung Nguyen today. Passion and enthusiasm: Dang Le Nguyen Vu was referred to a man full of enthusiasm and vitality. His coffee passion and daring ideas do not go away but increase and burn intensely. He is so crazy when talking about coffee. From an idea of creating a Vietnamese coffee brand name, he was determined to build a modern coffee processing manufactory right at the coffee capital. And to promote the taste of coffee, coffee culture and bold ideas of a "Coffee Capital", "Coffee Sanctuary", he turned a large land (1,8ha) to become Trung Nguyen Coffee Village as a miniature model from which to build an unique "Coffee City" in the world. Leadership style – The ability to inspire: Dang Le Nguyen Vu is very good in communicating and inspiring his employees. Since the business was just above idea, he passed the flame of passion to his close friend. Through many difficulties and failures, by passion and ability to convince, bringing confidence to everyone, he always received enthusiastic support. Dang Le Nguyen Vu is not only being a manager but also like a flame transmitter for his staff. He and his more than 3,000 employees en masse went down the streets in order to advertise their products and promoting Vietnamese brand names, including many other agricultural products they that do not produce. He said: " When together, nothing is impossible". Social responsibility and national spirit: With Dang Le Nguyen Vu, enriching itself is not enough. In his heart always had a burning desire to enrich the country, raising the position of Vietnamese. Dang Le Nguyen Vu finds themselves partially responsible for promoting the cultural values of Vietnam, not only hero in combat but also persistent in integrating into the regional and global economy. He said: "We need to encourage the younger generation motivations to compete, hunger of affecting the world and global vision. I have faith in young people, you have full conditions and qualities, if you nurture the desire together and have the right direction, you will be mighty people to make a mighty nation." 3.2 Case 2: Ly Quy TRUNG – Pho 24 Ly Qui Trung was born in 1966 in Saigon (Ho Chi Minh City). Flunked college and worked as a waiter at First Hotel, Ly Quy Trung had an opportunity coming to Sydney to study English in 4 months under the sponsor of an Australian businessman. Then he graduated and received Bachelor of Hotel and Restaurant Management at University of Western Sydney in 1993. He kept continue to study for Masters degree in Tourism in Griffith University in 1994, obtained a Doctorate of Business Administration in Kennedy Western University (USA) in 2003. Six years later, he became the first Asian and the youngest person being appointed Honorary Professor at Griffith University. Returning to Vietnam, through much work, until 2003, Ly Quy Trung made a very daring business decision of establishment Pho 24 chain stores - brand that made his name later. The will, courage, determination: Talking about the time working as an waiter, Ly Quy Trung said, "I have overcome myself to adapt for this early job and always been grateful that itself has taught me stoop down to appreciate all I achieved then. And I no longer lest any job in the future''. With Pho 24, the difficulties appeared at the beginning, such as several times higher price than normal or competing with big competitors such as KFC, McDonald's. However, the belief in the boldness and novelty of one inherently traditional food has helped him succeed beyond expectations. He said: "… We offer standard values and commitment to what we provide." Pho 24 has achieved tremendous success then. Asea Uninet Scientific and Plenary Meeting 2016 | 617 Aspiration bring Vietnam products to reach the world: At that time, Ly Qui Trung just thought that our country should have something special or outstanding that needs being promoted as particular point of Vietnam. "Vietnam needs a new image, including glorious past and bright future", he shared. Therefore, our traditional noodle has been chosen by this talented entrepreneur. He once said: "When Pho 24 opened three stores but I declared to go international - this may be true or false, can come true or not, but it is important that I dare to grow. And now I am trying "to fight" to develop Pho 24 become No1 world brand for noodle.” Pho 24 is not only a passion but also the love and motivation of Ly Quy Trung. Behind that love is the aspiration to bring traditional cuisine of Vietnam reach out regionally and internationally. Curiosity and love of learning: One of most clearly expressed traits through the life of Ly Quy Trung is curiosity or love of learning whether in any circumstances. During studying time in Australia, he dit not only determine to pursue and finish official courses, but also spent much time to participate in social activities, meeting abroad friends as well as native speakers to learn different cultures. After graduating, he continued to study while his friends were looking for a stable job. His learning process is a clear justification for Ly Quy Trung’s curiosity and love of learning. Leadership style Dynamic and creative leader: Before Ly Quy Trung, nobody thought to build up for Pho - the most popular food of Vietnam - a separate and modern image. Recognizing this market gap, a bowl of Pho with 24 selected spices from 3 regions has brought an unexpected success. Not only stick with Pho 24, he also participated in other business project such as Hub cultural – a network of over 25,000 professionals, executives worldwide will creating an open space for people to exchange and share experiences, realize the business idea... Domineering and strict manager: Ly Qui Trung is somewhat arbitrary manager, and he does not deny it: "At work, especially with the business model built by myself, I like hearing but must decide". He always frankly criticized the staff’s errors. Even when he was not the owner of Pho 24, once entering the store to eat he still kept strict attitude: "Stormed into the store and patted on the staff’s shoulder then suddenly I remembered that I was no longer the boss anymore, so embarrassedly I changed the contents of reminds and complains via comments and general inquiries. " Simple and close man in real life: "Every day I dress casual with An Phuoc shirt and trousers, a Vietnam brand name. I use clothing bought by my wife and my cell phone for a long time. I like durable product and hesitate to change habits in personal consumption. I love antiques such as going by Volkswagen, then change just because of my wife’s objection". Being domineering and strict manager, he still has the humor and gratitude. He conceived: "If you don’t have moral and justice you cannot retain staff. If you are not transparent, the staff will know that you cannot go very far, customers will also know and leave". 3.3 Case 3: Mai Kieu LIEN – Vinamilk Mai Kieu Lien was born in 1953, graduated Meat and Milk Processing Technology and Economic Management at Economics University of Leningrad. Return Vietnam, first working as an engineer, Mai Kieu Lien was appointed and working as manufacturing team leader, then Deputy Technical Director, Deputy General Director for Economics and then General Director of Vinamilk since 1992. She has demonstrated her leadership ability, took Vinamilk not only becoming the leading enterprises in Vietnam but also in the list of the leading dairy companies in the world. 618 | Asea Uninet Scientific and Plenary Meeting 2016 Leadership style – Assertiveness: CNBC called Vinamilk CEO Mai Kieu Lien is "Dairy Queen" and "Margaret Thatcher of Vietnam". Mai Kieu Lien refused this beautiful name, and stressed: "I do not dare compare myself with Mrs. Thatcher, but also to confirm that Vinamilk would not develop as today without the right and drastic decisions." As assertive and radical thinking women, Mai Kieu Lien made timely decisions as early investment in material area (early 1990), conducted restructuring Vinamilk (2003); listed on the stock market (2006), decided to invest and stop investing in beer, coffee (20052010) and so on. Sharing the difficulties and advantages of female leader in a large company, Lien said: "Individual woman’s strength is meticulosity so that I myself work with very well detailed plan and always foresight for all risks can come. However, with me, much of the success I reached today also be one part ... venturesome". Being assertive but not domineering, Mai Kieu Lien expressed: "There are 5-6 executive managers working under me ... We form a unity, sharing and authorized team to implement the correct strategy ... discuss and listen to the opinions of each other ... very democratic but once a decision has made there is no comment, just taking it into action". Leadership style – Staff unification: According to Mai Kieu Lien, the mark of a leader is the ability to turn a team into a unified bloc together towards a common goal, finding and creating new paths, nurturing and using talents. "If people are not ready or well-prepared for work, I train and direct them to do, not abandon them. Most importantly, I get people united as a team to promote the strength of the collectives", Mai Kieu Lien said. After nearly 40 years working and over 20 years as CEO of Vinamilk, Mai Kieu Lien appreciates most “Vinamilk Culture”, that everyone sees Vinamilk as the second family, shares things in work and life, helps each other overcome difficulties... Vision: The success of Vinamilk "Female General" not only base on assertiveness but also thanks to the strategic vision. "Female General" of Vinamilk has determined: to stay ahead in investing modern equipment and developing raw materials area to create the best product. She said: "I think no business can be successful immediately, but need to have a process to strive for the development. I think success in management need applying the international model in developed countries. Following them, we should take a shortcut to develop, take advantage on these technologies, wisely and properly applied to your business. Then I guess that will be a success". Social responsibility: The CEO always puts product quality issues to the forefront, she asserts the mission of the business as follows: "Vinamilk achievement today is result of … focusing on three core issues including quality, price and service. We never allow compromise with quality issues - because it is the survival issue of the brand”. With the message "Vinamilk - sustainable development, environmental friendly and responsible towards society", Vinamilk has been actively implementing solutions such as: efficiency and savings resource use; use of environmental friendly packaging and implementing Biogas system for cattle farms; maintaining social activities and charity, creating opportunities for all children in Vietnam drinking milk every day, physical improvement for poor children; Vinamilk scholarship fund "Nurturing young talent Vietnam", Vu A Dinh scholarship fund and so on. Courage, mistakes recognition: Nearly 20 years taking the responsibility as the captain, Mai Kieu Lien obtained many successes also failures. After privatization in 2003 and listed on the stock market in 2006, over 5 years, the market capitalization of Vinamilk was from 530 millions USD to 2 billions USD, nearly 4 times higher. This achievement makes Vinamilk oriented becoming leading food and beverage cooperation with Vinamilk brand. However, cooperation venture with SABMiller producing Zorok brewing and coffee factory are unexpected. Vinamilk had transferred two projects to preserve capital. Even with main products, Vinamilk itself did not always completely success. This leader said, Asea Uninet Scientific and Plenary Meeting 2016 | 619 there are approximately 10 products that were not well received despite careful preparation. "One of the reasons may be the selection of trying users, that was not typical and narrow in scope", the CEO recalled. Passion: Mai Kieu Lien is looked like a “female warrior" who never stops. At age of 62, with the successes with Vinamilk, Mai Kieu Lien absolutely has reasons to stop. However, with a woman having name honored as one of the most powerful businesswomen in Asia for 4 times, enthusiasm and dedication seem not lessen. At the youth, she once wanted to change her future job to become a teacher or a doctor. However, receiving her father that milk industry would help improving the situation of malnutrition for Vietnamese children, she determinated to complete the course; stick to then become the CEO of Vietnam Dairy Products Company (Vinamilk) since 1992. In 1997, denying the opportunity to become Deputy Minister of Industry, she stayed and build Vinamilk becoming a leading dairy company in Vietnam. In 2013, Mai Kieu Lien officially became President and CEO of Vinamilk. She desired to list Vinamilk in top 50 largest dairy company in 2017 with $ 3 billion in revenue. An objective that Vinamilk can achieve only with the growth of over 20% per year since. 3.4 Case 4: Pham Nhat VUONG – VinGroup Pham Nhat Vuong was born and raised in Hanoi. After graduating high school, he was selected to study in Moscow (Russia) at the sector of Geology. After graduating, he moved to Ukraine then founded Technocom LLC producing noodle and other fast foods. In the early 2000s, Pham Nhat Vuong invested in homeland and become both founder and member of Board of Director of Vinpearl Land (VPL) and Vincom JSC (VIC). Aspirations of legitimate enrichment From a desire to help families and improve the status of Vietnamese in a foreign country: "Then, my dream is not big, I just want to help my family," he recalled when seeing his parent facing with numerous difficulties to earn for living. In the new land, he tried to work for living with dignity and necessarily glorifying the Vietnamese. Then the idea of producing instant noodles to low income people flashed into his mind and soon after gave the birth of Mivina brand, put Vietnamese brand out to the world, helped Pham Nhat Vuong satisfied his aspirations of Vietnamese empowerment. In addition, he also recorded the mark with many works: Times Village; largest sheltered water park in Ukraine named Jungle; Bilingual-language Primary School named Spring... To a desire to build and enrich the country: After success in Europe, Pham Nhat Vuong has whole heartedly steep in investment in the homeland, engaged in tourism market and real estate with the two strategic Brand including Vinpearl and Vincom. These two brands have quickly succeeded, resulting with the birth of VinGroup in Jan 2012. It can be seen that the aspiration enrichment for himself is not only satisfy Pham Nhat Vuong but also have ultimate goals including build up home country, affirm Vietnam stature and create beautiful products for life. Vision and responsiveness: In 2008, Pham Nhat Vuong started investing in resort, commercial center, hospital and schools in important areas of Vietnam. And Nha Trang is the first choice because of perfect place and not yet much concern of investors. Subsequently, he opened Vincom Ba Trieu, doubling the size and building cross-sea cable (3.2 km length) to Vinpearl, building Vincom Village with hundreds of luxury villas; launched Royal City and Time City Mega Mall and numerous other major projects. In early 2015, Pham Nhat Vuong also had a surprised decision by encroaching into e-commerce. Besides creating a new shopping channel, new company will also cover all payments and transactions for e-commerce activities of Vingroup and partners. 620 | Asea Uninet Scientific and Plenary Meeting 2016 Leadership style – Talents selection and reward: Managing people is an art to bring success, and billionaire Pham Nhat Vuong did a great job of that. He deserves rewards for the staffs, who work really efficiently, and always reminds them the slogan "Speed, creativity and effectiveness in everything you do, in all your actions". Choosing the real talents for the company shows his wisdom of using people. A typical example is the former CEO of Vingroup Le Thi Thu Thuy, a financial expert with an international reputation. Energy and determination: "CEO does not only know how to "tunneling" but also keep persistence until finding the treasure." Starting with empty hands, he graduated on those days when the Soviet Union collapsed. He and friends decided to take an adventure to new land, Ukraine. As discussed, Pham Nhat Vuong and his friends’ simple secret of success is perseverance, persistence and always moving forward. He was also said being “crazy” or "throwing money down turn" with investing decision in Hon Tre Island and build up Vinpearland because of difficulties in traveling. As a result, Vinpearl Cable Car (3.2 km length) connecting Nha Trang and Vinpearland resort on Hon Tre Island became the world's longest sea-cross cable. Besides, he has been working on finding and studying successful models in Asia and around the world to implement projects in Vietnam. Social responsibility: Pham Nhat Vuong is not only a brilliant businessman but also a filial child and devoted for the development of the motherland. Since then, the scholarship named Pham Duong, Phu Luu Kinder garden, Intermediate vocational school named Pham Duong... were established to give the youth opportunities to have their own career. His kindness for community has also expressed directly through the Kind Heart Foundation - where he and his family, as well as officials and staffs of Vingroup have raised significant funds to help disabilities. Not satisfied with these achievement, he said: "If it is possible even taking a lot of money, I still feel happy. I want to leave something for the next generation because money nonetheless could not carry after death". Since then, a long series of works along the country with record construction speed marked by Pham Nhat Vuong has contributed significant change for the urban face of Vietnam, brought new living space for the Vietnamese and prove the enormous social value that he brings to our country. 3.5 Case 5: Pham Thi Viet NGA – Hau Giang Pharmacy Pham Thi Viet Nga was born in 1951 in Chau Thanh district, Can Tho province in the family that has three generations contributed to revolution. At 14, she joined the Resistance, delivering medicines and nurturing military. Graduated from University of Medicine and Pharmacy in Ho Chi Minh City in 1980, she worked for Can Tho Medical Equipment Company. She was assigned to Director of Hau Giang Pharmacy manufactory in 1988. She has been CEO of Hau Giang Pharmacy JSC (DHG) since Oct 2004. In 2015, Pham Thi Viet Nga received the Hero of the renovation period award, and also be honored as one of the 50 most powerful businesswomen in Asia by Forbes. Vision: Pham Thi Viet Nga is self considered to be a women with a very hard head. Her decision to import machinery for producing capsules let the DHG become the first domestic pharmaceutical company that can produce capsules. In 2004, despite the favorable growing of DHG, she determined to implement the privatization. "The biggest advantage of privatization is that I can be more proactive in planning mechanisms and policies for employees, encouraging innovative spirit, dedication of the staff " she shared. After privatization, DHG was listed in 2006 and always in the list of the best companies on the stock market. Asea Uninet Scientific and Plenary Meeting 2016 | 621 Curiosity and love of learning: Recognizing herself with resistance spirit but lack of knowledge of administration, she said: "... I do not know about assets, liabilities, and ownership equity when read an balance sheet, unaware of business administration... At that time, I feeling that only by pharmacists in hand I cannot operate and manage a manufacturing company". At the age of 20, she took a backpack walking along Truong Son mountain to the North for high school. Overcoming many difficulties at university when both learning and nursing her baby; keeping further education for MBA, accomplishing PhD of Economics at the age of 40 despite difficulties in foreign language make us admire her love of learning. Enthusiasm and passion: Meeting Vietnamese businesswoman Pham Thi Viet Nga in real life, very few person have thought that the idyllic woman was one of the 50 most powerful businesswomen in Asia. The woman over age 60 is still agile, still go to work every day from 3:30 in the morning, walk over 1 hour to reach the office, and had regularly 5 rounds in swim pool... She seems to have a wealth of energy resource to do everything she desire. Apparently, Pham Thi Viet Nga commanded all the spirit of resistance, brought manners of a soldier in business: in all actions, they were "comrades", always live and sacrifice for aspiration of a better life. Energy, courage, determination: The early days of incorporation, the branding is one of the leading problems facing that women. In 1992, despite being pregnant with her second child, she still actively carried products of DHG to each trade fair to introduce. And she always consoled herself: never quit. When her baby was one month old, she returned to Hanoi to extend markets. She and her staff did not hesitate to go to each drugstore introducing new product with commitment: "Drop drugs without taking money. Once sold, we return". Most nights, she always encouraged them not to leave work in Hanoi to back home. Realizing the importance of increasing market, she herself had to go to each needy families in each province, including the Central Highlands, the Central and the North to give gifts to the children and introduce products more than 10 years ago, she recalled. With quality and marketing efforts, the products of DHG have been consumers’ choice not only in Vietnam but also in Ukraine, Laos, Cambodia, Moldova, Mongolia, Korea... since 1995. Leadership style: Pham Thi Viet Nga said: "Competitive advantages of DHG is customer caring based on sincere affection and closeness". On holidays, it is easily caught the CEO president and her employees together bring gifts to customers, whether they are just small drugstores. After Hurricane No.6 causing great damage in Danang in 2006, she directly called to each customer asking about losses and transferred 60 million VND and 500 sacks to help them only two days later. For staff, she has developed corporate culture in mind and built a staff doing business with kindness and sincerity. It could be distinctive competitive advantage of DHG. And she said: "For me, the greatest asset of DHG is team". Throughout her working life, she treated her colleagues with the heart of a revolutionist: compromise, live for others, dare to sacrifice, commit and ready to share. Pham Thi Viet Nga has trained, cared, developed and retained good staff, made them stick with the "machine" that she contributed wholeheartedly. Social responsibility: On average, each year, the company spend more than 2 billion VND (100,000 USD) for aiding missions. According to her, care for the poor and people in need is not only the CSR missions but also an effective education way for workers in companies of community spirit. There are many annual programs such as: "Free medical examination and medicines", "Journey for poor patients"; "Trade fair for family", establishing fresh blood bank with blood donation from employees, visiting and giving gifts to the orphanage camp, scholarships for students in universities, supporting the flood 622 | Asea Uninet Scientific and Plenary Meeting 2016 victims , giving gifts for victims of Agent Orange / children in mountainous and remote areas... 1. Research’s result Traits Dang Le Nguyen VU Aspirations of legitimate enrichment - Desire to enrich himself and his family Courage and determinati on Leadership style - Energy and determinati on - The ability to inspire - Passion and enthusiasm Social - Social responsibilit responsibilit y y and national spirit Ly Quy TRUNG - The will, courage, determinati on - Dynamic and creative leader Domineerin g and strict manager - Simple and close man in life Passion and enthusiasm Curiosity and love of learning Vision Mai Kieu LIEN Pham Nhat VUONG - Courage, mistakes recognition - Desire to help families and improve the status of Vietnamese - Energy and determinatio n Assertivene ss - Staff unification - Talents selection and reward - Passion - Aspiration bring Vietnam products reach the world - Social responsibili ty Responsibilit y to motherland - Desire to build and enrich the country - Curiosity and love of learning - Vision - Vision and responsivene ss Pham Thi Viet NGA - Energy, courage, determinati on - Sincere affection and closeness - Treat the colleagues with the heart of a revolutionis t Enthusiasm and passion - Social responsibilit y - Curiosity and love of learning - Vision It would be unnatural if using a single term to name the personality traits of the leaders in these situations. However, to facilitate the research and find out the correct conclusion, the author have tried to remove the superficial elements to look deeper into the inner traits of leaders. These following traits are noted: Asea Uninet Scientific and Plenary Meeting 2016 | 623 Social responsibility and national spirit: These are the significant traits in all 5 case studies. Leaders in every situation, whether in any moment are clearly reflected dedication and willingness to work not only for themselves. This could be a natural trait and indispensable spirit of a great leader. That spirit may be to build a brand in order to promote the image and enhance Vietnam to international areas (Dang Le Nguyen Vu, Ly Quy Trung) or to contribute to build a better Vietnam (Pham Nhat Vuong) or contribute to improve Vietnamese physical ability and health (Mai Kieu Lien and Pham Thi Viet Nga). Courage and determination: Courage and determination are very essential for the leaders. No business is smoothly from the beginning and always has to face with unexpected issues. Courage helps leaders make decisions at the time of survival or at the important turning point of the business in the future. On the other hand, leaders with courage is also admit their mistakes leading to failure in the business. Passion: Passion helps leaders hold the flame of enthusiasm at work even when facing troubles or failures. It could be a passion for the product, for the dream to create a consumption style, for creating a culture for the product and its space (Dang Le Nguyen Vu). It could be a passion for the business, for the company that he sticks with, for things he does every day. The leaders are always energetic and charismatic to his associates to make memorable milestone at major turning point of the enterprise. Vision: The vision of the leaders presents in the decisions leading to the amazing development of the company later. For Pham Nhat Vuong, vision associated with the bold decisions that are even considered to be somewhat crazy, unrealistic. However its accuracy over time have demonstrated great vision of the Vingroup’s founder. With the other leaders, vision can be expressed through the decisions relating to change the form of ownership, change the organizational structure of the company; technological innovation; developing material areas (Pham Thi Viet Nga, Mai Kieu Lien). Curiosity and love of learning: some leaders expressed the desire to learn and very powerful curiosity. They love and pursue studying. However, there is the fact that many of the leaders come up from poverty situations and not have a chance for formal education. That does not affect their curiosity. The successes achieved as a result of perseverance and self-knowledge that they accumulate in life, from colleagues, from employees, even from their own failures. Aspiration of legitimate enrichment: aspirations of enrichment to overcome difficult circumstances, to help the family are a very strong motivation to help the leaders overcome the difficulties and failures to achieve success. In this study, we can see it very clearly through the life and career of Dang Le Nguyen Vu and Pham Nhat Vuong. Also, not only the desire to enrich himself and his family, they desire to change and improve the status of Vietnamese people in general (Dang Le Nguyen Vu), the Vietnamese people on foreign land in particular (Pham Nhat Vuong) and change the image of Vietnam in the eyes of international friends. Leadership style: these are factors distinguish different leaders, images they want to show with employees, customers, partners and the public. As leaders, they can be inspirational, and down the road with staff in actions (Dang Le Nguyen Vu), creative leaders, strict manager but very simple man in real life ( Ly Quy Trung); very assertive but kind to employees to build a unified bloc (Mai Kieu Lien); very close, sincere and always treat employees with the spirit of the revolutionist (Pham Thi Viet Nga); or wise in selecting talented people and reward (Pham Nhat Vuong). 624 | Asea Uninet Scientific and Plenary Meeting 2016 4 CONCLUSION Overall, each trait has a certain importance to every leader in this research and Vietnam, in particular, and in other different context, in general. It will be impossible if trying to list and prove all the personal traits that a successful leader should have. This study desire to offer a perspective on the personal trait of a successful leader in a transforming economy. It may gives good reference in the selecting, training and capacity developing leaders in business. REFERENCES (IN ENGLISH) Sankar Y. (2003), “Character not charisma is the critical measure of leadership excellence”, Journal of Leadership and Organizational Studies 9 (4), 45-55. Bright D. S., Cameron K. S., Caza A. (2006), “The applying and buffering effects of virtuousness in downsized organization”, Journal of Business Ethics 64 (3), 249269. Judge T. A. , Erez A., Bono J. E., Thoresen C. J. (2002), “Discriminant and incremental validity of four personality traits: Are measures of seft-esteem, neuroticism, locus of control, and generalized seft-efficacy indicators of a common core construct?”, Journal of Personnality and Social Psychology, 83, 693-710. Peterson C., Seligman M. (2004), Character strengths and virtues: A handbook and classification, Washington DC, APA Press. Thun N. B. (PhD Thesis, 2009), “Character Strengths in Leadership”, Doctor of Philosophyin Business Administration, The Departement of Management, Saint Mary’s University, Halifax, Nova Scotia, Canada. Strohhecker J., GroBler A. (2013), “Do personnal traits influence inventory management performance? - The case of intelligence, personality, interest and knowledge”, Int. J. Production Economics 142 (2013), 37-50. Jonason P. K., Slomski S., Partyka J. (2012), “The dark Triad at work: How toxic employee get their way”, Personal and Individual Difference 52 (2012), 449-453. Furnham A., Trickey G., Hyde G. (2012), “Bright aspects to dark side traits: Dark side traits associated with work success”, Personal and Individual Difference 52 (2012), 908-913. Judge T. A., Piccolo R. F., Kosalka T. (2009), “The bright and dark sides of leader trait: A review and theoretical extension of the leader trait paradigm”, The Leadership Quarterly 20 (2009), 855-875 McCrae R. R., Costa Jr. P. T. (1999), A Five-factor theory of personality, Handbook of Personality: Theory and Research (2nd edition), New York: Guilford, 1999, 139153. REFERENCE (IN VIETNAMESE) Vision and Mission of Trung Nguyen, Website: http://vietnammarcom.edu.vn http://vietnammarcom.edu.vn/tabID/637/default.aspx?ArticleID=6931&CategoryID=30 “King of cofffe” Dang Le Nguyen Vu – Childhood in poor, Website: http://soha.vn http://soha.vn/kinh-doanh/ong-vua-ca-phe-dang-le-nguyen-vu-tuoi-tho-be-ngo-cham-lon20130624172128297.htm Dang Le Nguyen Vu – An Sucessful Entrepreneur in Innovation Period, Website: http://ganketkhatvongtre.vn Asea Uninet Scientific and Plenary Meeting 2016 | 625 http://ganketkhatvongtre.vn/dang-le-nguyen-vu-mot-doanh-nhan-thanh-dat-thoi-ky-doimoi Trung Nguyen Coffee – Dream from poor village, Website: http://khatvongtuoitre.com http://khatvongtuoitre.com/index.php?option=com_content&task=view&id=20&Itemid= 11 World museum of coffee at ... Trung Nguyen, Website: http://giacaphe.com http://giacaphe.com/8653/bao-tang-ca-phe-the-gioi-o-tay-nguyen/ The desire to enhance Vietnamese coffee, Website: http://vccinews.vn http://vccinews.vn/news/3141/.html Dang Le Nguyen Vu: Starbucks just "giant no identity", Website: http://giaoduc.net.vn http://giaoduc.net.vn/Kinh-te/Nguoi-Viet-hang-Viet/Dang-Le-Nguyen-Vu-Starbucks-chila-nguoi-khong-lo-khong-ban-sac-post105801.gd Coffee with "King of Coffee" Dang Le Nguyen Vu, Website: http://giaoduc.net.vn http://giaoduc.net.vn/Kinh-te/Nguoi-Viet-hang-Viet/Ca-phe-voi-Vua-ca-phe-Dang-LeNguyen-Vu-post85636.gd "When together, nothing is impossible", Website: http://www.trungnguyen.com.vn http://www.trungnguyen.com.vn/tin-tuc/trung-nguyen-va-cong-dong/ong-dang-lenguyen-vu-chu-tich-cong-ty-cp-tap-doan-trung-nguyen-khi-cung-nhau-khong-gila-khong-the/ Dang Le Nguyen Vu – “Vietnamese King of Coffee”, Website: http://story.careerlink.vn http://story.careerlink.vn/dang-le-nguyen-vu-ong-vua-ca-phe-viet/ Ly Quy Trung - The owner of Pho 24 brand name, Website: http://kynanggiaotiep.vn http://kynanggiaotiep.vn/tin-tuc/139/kngt---ly-quy-trung---ong-chu-cua-thuong-hieu-pho24.html#.U1Z6wPl_uAV Ly Quy Trung, Inportant thing in trade is success - not diploma, Website: http://giaoduc.net.vn http://giaoduc.net.vn/Kinh-te/Nguoi-Viet-hang-Viet/Vua-Pho-24-Thuong-truong-chi-cothanh-bai-khong-quan-trong-bang-cap-post82392.gd No longer is King of Pho 24, What does Ly Quy Trung do?, Website: http://giaoduc.net.vn http://giaoduc.net.vn/Kinh-te/CEO/Khong-con-la-Vua-pho-24-doanh-nhan-Ly-QuiTrung-lam-gi-post123596.gd Ly Quy Trung and long story of Pho 24, Website: http://nguoigiaunhatvietnamlaai.blogspot.com http://nguoigiaunhatvietnamlaai.blogspot.com/2014/02/tieu-su-ong-ly-qui-trung-va-cauchuyen-dai-cua-pho-24.html The success from failure, Website: http://www.toikhacbiet.vn http://www.toikhacbiet.vn/ly-quy-trung-thanh-cong-tu-nhung-that-bai The sky is not only blue - Memoirs of Ly Quy Trung Pham Nhat Vuong – First USD billionaire of Vietnam, Website: http://nguoigiaunhatvietnamlaai.blogspot.com http://www.nguoigiaunhatvietnamlaai.blogspot.com/2013/08/tieu-su-ong-pham-nhatvuong-ty-phu-do-la-dau-tien-cua-viet-nam.html Portrait of first dollar billionaires of Vietnam on Forbes, Website: http://giaothongvantai.com.vn http://giaothongvantai.com.vn/doanh-nghiep-doanh-nhan/guong-mat-doanhnhan/201306/chan-dung-ty-phu-dola-dau-tien-cua-viet-nam-tren-forbes-314869/ Pham Nhat Vuong: “Money nonetheless could not carry after death”, Website: http://kinhdoanh.vnexpress.net 626 | Asea Uninet Scientific and Plenary Meeting 2016 http://kinhdoanh.vnexpress.net/tin-tuc/doanh-nghiep/ong-pham-nhat-vuong-tien-changthe-mang-theo-khi-da-chet-2726697.html Vietnamses brandname in Kharkov, Website: http://www1.laodong.com.vn http://www1.laodong.com.vn/pls/bld/display$.htnoidung(70,142243) Happiness is enrichement to homeland, Website: http://www.cand.com.vn http://www.cand.com.vn/vi-VN/kinhte/2008/1/84549.cand Vietnamese in Kharkov: Boasting the words "Vietnam", Website: http://vietbao.vn http://vietbao.vn/Kinh-te/Nguoi-Viet-o-Kharkov-Tu-hao-hai-tieng-VietNam/20536899/87/ Technocom and stories to find a brand Vietnam, Website: http://www.sggp.org.vn http://www.sggp.org.vn/kinhte/2007/4/94772/ Hiding Billionaire of Vietnam, Website: http://www.bbc.co.uk/vietnamese/vietnam/2012/10/121025_vingroup_phamnhatvuong.sh tml Leader replacement in Vingroup, joined the e-commerce market, Website: http://www.baomoi.com http://www.baomoi.com/Vingroup-thay-sep-gia-nhap-thi-truong-thuong-mai-dientu/45/13071010.epi CEO of Vingroup become Young Global Leaders of the WEF, Website: http://dantri.com.vn http://dantri.com.vn/the-gioi/ceo-cua-vingroup-tro-thanh-nha-lanh-dao-tre-toan-cau-cuawef-706896.htm Time in poor of the billionaire Vietnam, Website: http://seatimes.com.vn http://seatimes.com.vn/Thuo-co-han-cua-cac-ty-phu-Viet-0186949.html What can we learn from Pham Nhat Vuong to become a billionaire?, Website: http://landexpress.vn http://landexpress.vn/vi/news/Doi-song-tieu-dung/Can-hoc-Pham-Nhat-Vuong-nhung-gide-tro-thanh-ty-phu-928/#.U0LZLfl_uAU The power of dairy queen Mai Kieu Lien, Website: http://www.tienphong.vn http://www.tienphong.vn/Kinh-Te/quyen-luc-cua-nu-hoang-sua-mai-kieu-lien613782.tpo Ms. Mai Kieu Lien, President and CEO of Vinamilk - Female warrior never stops, Website: http://congluan.vn http://congluan.vn/ba-mai-kieu-lien-chu-tich-hdqt-kiem-tong-giam-doc-cong-ty-cp-suaviet-nam-vinamilk-nu-chien-binh-khong-bao-gio-ngung-nghi Ms. Mai Kieu Lien, General Director of Vinamilk - As creative as great success, Website: http://www.baomoi.com http://www.baomoi.com/Ba-Mai-Kieu-Lien-Tong-giam-doc-Cong-ty-co-phan-Sua-VietNam-Vinamilk-Cang-sang-tao-cang-thanh-cong-lon/c/8014088.epi The power and pressure, Website: http://nhipcaudautu.vn http://nhipcaudautu.vn/lanh-dao/ceo-viet/quyen-luc-va-suc-ep-3254190/#ixzz3odwlvrNY Vinamilk: development but not forget social responsibility, Website: http://tinnhanhchungkhoan.vn http://tinnhanhchungkhoan.vn/doanh-nghiep/vinamilk-phat-trien-nhung-khong-quentrach-nhiem-xa-hoi-42857.html Female entrepreneurs exploring Vietnam dairy industry, Website: http://www.tienphong.vn http://www.tienphong.vn/Kinh-Te/nu-doanh-nhan-khai-pha-nganh-sua-viet-919867.tpo Entrepreneur Vietnam Pham Thi Nga – I’m a proletarian at DHG, Website: http://cafef.vn Asea Uninet Scientific and Plenary Meeting 2016 | 627 http://cafef.vn/doanh-nghiep/doanh-nhan-pham-thi-viet-nga-toi-vo-san-tai-duoc-haugiang-201410082144069178.chn Entrepreneur Vietnam Pham Thi Nga - Female warrior, Website: http://vov.vn http://vov.vn/kinh-te/doanh-nhan-pham-thi-viet-nga-nu-tuong-khong-tuoi-382984.vov Pham Thi Vietnam Russia - One of the Vietnamese women entrepreneurs on Forbes, Website: http://www.dhgpharma.com.vn http://www.dhgpharma.com.vn/dhg/tin-tuc/98-ba-pham-thi-viet-nga-mot-trong-nhungnu-doanh-nhan-viet-len-forbes.html Pham Thi Viet Nga - Woman of the new era, Website: http://www.dhgpharma.com.vn http://www.dhgpharma.com.vn/dhg/nhan-vat/242-ts-ds-pham-thi-viet-nga-nguoi-phu-nucua-thoi-dai-moi.html Life of a female CEO, Website: http://vietbao.vn http://vietbao.vn/The-gioi-tre/Cuoc-doi-mot-nu-tong-giam-doc/45185294/275/ President DHG - Success from humanity and winsdom, Website: http://ceoclubvietnam.com http://ceoclubvietnam.com/chu-tich-duoc-hau-giang-thanh-cong-tu-hai-chu-tam-va-tri/ IMPACT OF CORPORATE GOVERNANCE ON FIRM PERFORMANCE EVIDENCE IN VIETNAM Dao Thanh Tung tungdt@neu.edu.vn Department of International Relations, Faculty of Business Management The National Economics University Abstract This paper investigates the current practice of corporate governance and evaluates its effectiveness in the nascent equitised companies of Vietnam. I identify a comprehensive set of governance mechanisms for Vietnam’s equitised companies and constructs relevant measures for them. I then create a rating index, known as the V-index, to reflect the overall level of governance practice in Vietnam’s equitised companies. The paper finds that better governed companies according to our index are associated with better company’s performance. The result indicates that good corporate governance matters in Vietnam, however, its impact remains modest. The paper also provides implications for both Vietnamese policy makers. Keywords: Corporate governance, firm performance, Vietnam 1 INTRODUCTION Corporate governance is of much interest for both professionals and academics, particularly following a collapse of many large companies in the U.S. and U.K such as Worldcom, Enrol, and Arthur Andersen... In Asia, it is widely believed that weak corporate governance is one of the main reasons for economic crisis in 1997. In Vietnam, CG is now becoming hot topic in the top government official discussion, particularly since the government commits to accelerate the state sector reform. Indeed, reforming the State-Owned Enterprise (SOE) sector has been a key element of the economic renovation process in Vietnam since 1986. A recent program is the so-called ‘equitization’ (broadly similar to privatisation, entailing partial divesture of state ownership) of the SOEs. One of the underlying objectives of the reform of Vietnamese SOEs is to introduce financial transparency and other characteristics of good governance principles, so as to improve performance of state sector and attract foreign investment. Another important perspective would be to regard CG as a catalyst for long-term change, in which more transparent business and financial practices would have an opportunity to take root and gradually change the mindset of the Vietnamese, help them become more capable of dealing with foreign investors and a global economy. Taking these perspectives, the paper focuses attention on two related aspects of CG in relation to the management of the equitized companies. First, the paper will appraise the current state of corporate governance practice in Vietnam’s equitised companies. Second, the paper analyses the relationship between corporate governance practice and firm performance to see whether CG works in Vietnam. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 628 Asea Uninet Scientific and Plenary Meeting 2016 | 629 The paper relies mostly on the primary data - survey conducted with the senior managers of the equitised companies. Multiple regression analysis is used to analyse the relationship between CG and firm performance. The paper structures into three parts following the Introduction. Part 1 briefly reviews CG literature: definition of CG, the relationship between CG and firm performance and CG policies in Vietnam. Part 2 presents the research methodology and actual practices of CG in the equitised companies. Section 3 examines the relationship between CG and performance of the Vietnam’s equitised companies. A discussion on implications for policy makers concludes the paper The literature review is structured into two main sections. Section one reviews overall ideas of what corporate governance is (defined and described). As an integral part of this research it is useful to refer to literature on the relationship between CG and firm performance. In section two, I focus my discussion on the Vietnamese corporate governance system. 2 LITERATURE REVIEW 2.1 2.1.1 A review of corporate governance Emergence and meanings of corporate governance In the last decades, technological advance and expansion of market increased the scale and complexity of enterprise, forcing business firm to seek more effective form of economic organization (Parker, 1995). Traditional firm that is wholly owned by a single entrepreneur or family owner appears to be insufficient for need of increasing capital. In response to that, companies that have various owners become central role. Berle and Means (1967) cited by Clarke (2004) are among the first who identify a new form of organization which ownership is separated from control. They claim that as the business enterprise grew in size and that its managers became more professional, the management of the enterprise became separated from its ownership. The owners who own finance do not manage and delegate their right to manager, who principally should work in the interests and under control of shareholders (Clarke, 2004). This raises a great concern as to how to ensure that managers act in the interest of supplier of finance. Fama and Jensen (1983) postulate that corporate governance originates from the separation between ownership and control. The aim of corporate governance is to align interests among various participants of companies and thus improve corporate performance. There are many definitions of corporate governance. An open-ended definition of OECD (2004) holds that “Corporate governance is a system by which companies are directed and controlled”. A narrow definition is provided by Shleifer and Vishney (1996) who claim that “Corporate governance is an institutional arrangement by which suppliers of finance to corporations ensure a proper return on their investment”. A broader definition includes stakeholders in the company “CG involves the issue of the relationship between the stakeholders in the company and those who manage its affairs”. Monks and Minow (1996) define corporate governance as “the relationship among various participants in determining the direction and performance of corporation”. According to Hart (1995) corporate governance occurs in an organization whenever there are two conditions. First, there is an interest conflict involving members of organization. Second, this conflict can not be dealt with through contract. These conflicts may arise between: directors and managers, shareholders and managers/directors… Ramsay (1997) proposes a number of mechanisms that can be used to minimize the above mentioned conflicts. They include inside mechanism such as board composition 630 | Asea Uninet Scientific and Plenary Meeting 2016 (proportion of outside/independent directors), board structure (dual role of management and direction or separation between them, establishment of auditing committee and compensation committee), role of auditors in ensuring information disclosure, ownership concentration, role of institutional investors such as pension fund, trust fund…in effectively monitoring corporations; information disclosure and transparency such as quarterly and yearly financial reports, compensation for appropriate care and diligence of directors and managers such as salary and management ownership and outside mechanisms included takeover, management market. 2.1.2 Literature on impact of CG on firm performance Literature on the influence of CG on performance can be divided into to two streams. The first line of research includes a huge number of studies investigating a single CG variable on performance such as structure of the board, board composition, CEO compensation, board and CEO ownership structure, the existence of committee including audit committee, compensation committee and their influence on firm performance (Kumar & Zattoni, 2013; Afzalur; 2013; Abdullah, 2005; Nelson, 2005; Malhotra & Poteau & Fritz, 2013; Thomsen, 2004; Stephen & Brian, 2004; Evans & Evans & Loh, 2002; Dehaene & Vuyst & Ooghe, 2001, Judge & Naoumova & Koutzevol, 2003). The other research stream comprises studies that examine some CG characteristics and their influence on the performance (Coles & William & Sen, 2001; Akimova & Gerhard, 2004, Diacon & Sullivan, 2005; Haniffa & Hudaib, 2006; Beurer & Guenster & Otten, 2003, Tian & Lau, 2001). Relatively few researches investigate comprehensive CG characteristics and their influence on firm performance. Among them is study by Gompers & Ishii & Metrick (2003) which created a CG index including 24 factors to study if the shareholder rights influence the equity prices in the U.S firms. The study found that firms with stronger shareholder rights have better operating performance. Brown and & Caylor (2005) created Gov-Score based on 51 factors underlying Gov-Score and showed that Gov-Score influences firm valuation in U.S firms. Different from highly developed economy like U.S., Vietnam is in transitional process to reform its economy where well structured legal systems, rigorous legal enforcement and well functioning financial markets are still missing. Furthermore, Vietnam also has distinct feature that is “develop market economy under socialist guidance”. Therefore, Vietnam presents a bit of puzzle to the researchers as to how CG works in the formally dominated socialist ideology and how effective is CG practice in Vietnam. The purpose of this study is to develop a V-index of CG to evaluate current CG practice in Vietnam and the relationship between a V-index and firm performance in Vietnam’s equitised companies. 2.2 Corporate governance in Vietnam Corporate governance is still alien to Vietnam. According to Freeman and Nguyen (2004), the concept of CG is not yet established in Vietnam. In fact, the Vietnamese equivalent term of CG “Quan tri cong ty” which is broadly similar to “Administration” is confusing and has yet to take hold as a popular term In Vietnam, corporate governance principles have been incorporated into corporate law systems. The Vietnamese government issues a number of laws and regulations pertaining to equitized and listed companies. Current regulations concerning corporate governance for equitized companies and listed companies can be found in the Corporate Law (2005), Degree 64 CP (2002) of the government on equitization of the SOEs, and Degree 144 CP (2003) of the government on stocks and the stock market. As it can be seen in the following regulations, CG model in Vietnam is broadly similar to German CG model Asea Uninet Scientific and Plenary Meeting 2016 | 631 in that it has two tier board: Board of Directors and Supervisory Board and Board. These regulations can be briefly described as follows:     Shareholders’ meeting is the highest decision maker of equitized or listed companies. Shareholders’ meeting votes for (or against) member of the Board of Directors and Board of Supervisors (in case the company has more than 10 shareholders). The board of directors should not have more than 11 members. There is no regulation on how many managers or outside shareholders should be on Board. The Board of Directors appointed the CEO and other important management positions of the companies. The CEO can be a member of Board of Governors. If the company has more than 10 shareholders, it must have Board of Supervisors. The Board of Supervisors should have from 3 to 5 members, of which at least one member has a background in accounting. Members of the Board of Directors, CEOs, chief accountant, and their related people can not be members of the Board of Supervisors. The Board of Supervisors is not required to have outside members (not currently employees of the company). At the policy level, there is a strong effort in designing CG policies that enhance monitoring the management and transparency. The policies give shareholders some mechanisms to control the Board of Directors. They can vote for the Board of Directors, Board of Supervisors, and major strategic decisions of the companies. However, whether the arrangements work in practice is interesting to investigate. The proposed research will throw light on how equitised companies implement CG policies of the government in practice. 3 METHODOLOGY To understand the reality of CG practice in Vietnam’s equitised companies, the research used questionnaires as the main data collection method. The questionnaire was distributed to 700 equitized companies across seven main industries: Hotel and Restaurant; Food and Beverage; Textiles and Clothes; Chemicals; Construction; Processing Industry; Distribution and Trade. I sent one questionnaire for each company and the result represents practice of CG in that company. One hundred and eighty nine companies’ board members and senior managers participated in the research and returned the questionnaires (response rate of 26%). However six questionnaires were taken out of the analysis because of a number of the unanswered questions. Finally, 183 questionnaires were actually used for data analysis. The survey asked the respondents about their experience and the fact that CG is being implemented and practiced in their firms through four categories of CG: 1) shareholder rights, 2) information disclosure, 3) roles of board of directors and 4) roles of stakeholders. The following section throws lights on how the equitised companies implement CG in practice. 632 | Asea Uninet Scientific and Plenary Meeting 2016 3.1 DESCRIPTIVE RESULTS Much of the following section contains simple frequency results, depicting the proportion of the firms in the sample that responded one way or another to a series of questions. Profile of the 183 firms surveyed Of the 183 firms, 49% were located in Hanoi, 30% in Ho Chi Minh and 21% in Hai Phong. The characteristics of the 183 responding equitized companies are outlined in Table 1. Table 1 shows that 15.34% of sample companies were in Construction and const. materials industry, 11.36% were in Chemicals and Plastics, 14.2% were in Distribution and Trade, 15.91% were in Manufactures, 17.05% were in Hotel and Restaurant and Service, 14.77% were in Processing and 11.36% were in Textiles and Clothes. Table 1. Number of questionnaires returned by industry Industry 1 Construction and const. Materials 2 Chemicals and Plastics 3 Distribution and Trade 4 Manufactures 5 Hotel and Restaurant 6 Processing Industry 7 Textiles and clothes Grand total Number % 28 15.30 21 11.48 26 14.21 29 15.84 31 16.94 27 14.75 21 11.48 183 100 Table 2. Ownership structure of surveyed companies Descriptive Statistics Minimum Maximum Mean Std. Deviation State_ownership .00 80.00 40.49 14.78706 Mgmt_ownership 2.52 29.00 9.54 3.96534 Employee_ownership 2.80 54.05 32.72 8.76478 Foreign_ownership 1.00 25.57 1.44 4.60271 Bank_ownership .00 4.84 0.03 . Other domestic_investors 1.00 60.74 15.77 10.40591 Valid N (listwise) It can be seen from the Table 2 that state is still a controlling shareholder of the equitized companies (40.5%), employees are second largest shareholders (holding 32% of total shares), management owns an average of 9.5 % of total share. According to newest regulation (Degree 144 CP, 2003), foreign investors can buy up to 49% of the shares in Asea Uninet Scientific and Plenary Meeting 2016 | 633 equitized companies. In practice, however, the portion of shares sold to foreign investors is about 1.44%. Banks hold extremely small number of shares in the equitised companies (only 0.03%). As the result, the state and employees are often the controlling shareholders of the equitized companies. Survey findings on CG practice The following sections briefly summarized the main findings of the survey on CG practice that are reflected through four categories: 1) shareholders’ right, 2) information disclosure, 3) role of board of directors and 4) stakeholders’ rights. The surveyed firms did relatively well in giving adequate time for shareholders to ask questions and place issues at shareholders’ meeting, allowing appointed person to vote on their behalf, approving issuance of new shares, company’s business plans and major company restructuring. Minority shareholders, however, had difficulties in calling for shareholders’ meeting and receiving company’s information. Related party transactions were rarely discussed in the shareholders’ meeting. The sample firms performed relatively poor in disclosing such information as financial reports, significant changes in ownership, policy on risk management and remuneration of management and external auditors. In most equitised companies, the role of CEOs and chairman of the board is largely intermingled. Independent directors and foreign investors rarely have positions on the board of directors. All companies under review have supervisory board to monitor and control the performance of the management. However, they appeared to be poor in evaluating management performance and providing support to directors. Only listed companies and companies that have a large proportion of state share had their reports audited by internal and external auditors. Detailed analysis of the questionnaire result is presented in the following sections. Shareholder rights As an investor of the company, shareholders have such rights to oversee their capital as attend the general meeting, access financial reports in timely and accurate manner, approve strategic development plan, appoint candidates to the board of directors as well as vote for or against members of the board, etc. My survey revealed that all equitized companies issued different classes of share: common shares and preferred shares which have a preference in respect of receipt of the profits of the firm but have no voting right. In general, the surveyed companies did relatively well in enabling their shareholders to approve annual financial reports (100% of the surveyed companies), dividend (99.5%), any issuance of new shares (83.6%), and major company reorganization (65%); to have enough time at the shareholder meeting (70%) and to vote for members of the board of directors (75%). However, 44% of the companies did not provide adequate information on agenda items of the shareholder meeting. The rights of small shareholders were not adequately protected in the equitised companies. According to the Corporate Law (2005), only shareholders holding more than 10% of total common shares in 6 consecutive months can nominate candidates for the board of directors and call for shareholder meeting. Given the high ownership concentration, this threshold prevented small shareholders from participating in important decisions of the company. Also, related party transactions are rarely discussed at the shareholder meeting (in only 10% of the surveyed firms, were related party transactions discussed at shareholder meeting). 634 | Asea Uninet Scientific and Plenary Meeting 2016 Information disclosure and transparency The Corporate Law (2005) regulates that annual reports must provide information on ownership structures, resume of directors, policy on risk of management, governance structures and strategic plans. In fact, disclosure practice in the surveyed companies seems to be relatively good for such information as resume of directors, governance structure, and ownership structure, directors’ selling or buying shares in the company. Most equitized companies disclosed this information both in the company’s chapter and in annual reports. However, disclosure of information on fees paid to external auditors, advisors and other related party; policy on risk management, significant change of ownership and remuneration of management is less common. 75 % and 35 % of the companies did not disclose policies on risk management and fees paid to external auditors and advisors respectively. Disclosure of financial information, however, is rather poor among the equitised companies. Just 18% and 10% of the surveyed firms disclosed quarterly and semi-annual reports to the shareholders respectively. All of them are listed companies. The poor disclosure practice resulted from relatively relaxing regulation on disclosure for unlisted equitised companies. Indeed, the regulation only requires listed companies to disclose quarterly, semi-annual reports and any significant changes that influence company’s performance to the public. There are no such regulations for other equitised companies. Thus, in fact, while listed companies have to meet relatively high standard of information disclosure, other equitised companies are not required to do so. It is the main reason that in Vietnam many equitised companies do not want to have their shares listed on the Stock Exchange because they have to meet higher standard of information disclosure. The accuracy of the disclosed information is another concern for the shareholder when only 62% of the surveyed firms claimed that their disclosed information accurately reflected actual performance of their companies. The use of company websites for information is also rare in the equitized companies. Only 8% of the surveyed companies had a website to provide shareholders with important information about the company. Board composition and structure Boards of directors in the equitized companies had an average of 7 members. Due to limited number of shares owned by foreign investors, only 1 out of 183 companies had foreigner on the board of directors. Only 3.8% of the board of directors had independent directors. The positions of the board of directors and CEO largely intermingled. 80% of surveyed companies said that their CEO also served as member of the board. In all 183 equitized companies, the directors of the equitized companies are directors of the former SOEs. Board meeting frequency and attendance Board of directors tends to held board meeting quarterly. 52.5% of the board of directors gathered 3- 4 meeting per year. 85% of the meeting had attendant rate of over 90% of board members. However, board meeting only took 1-2 hours (accounting for over 85 % of board meetings). Function and effectiveness of the board Asea Uninet Scientific and Plenary Meeting 2016 | 635 In practice, the board of directors in the equitized companies implemented relatively well their responsibility in: 1) ensuring proper disclosure and active communication with shareholders and stakeholders, 2) monitoring the effectiveness of the company’s governance practices, 3) reviewing executive and director remuneration. The responses of “Agree” and “Strongly agree” to these questions accounted for 90 %, 68% and 66% of the total surveyed companies respectively. The board of directors also provided an independent overview and assessment of management performance in 57 % of the surveyed firms. Just over 65% of the board normally reviewed executive and director remuneration and 63% of the board claimed that they conducted an independent overview and assessment of management performance. However, the boards did not play active roles in selecting and dismissing CEO (only 39% of surveyed companies practiced this role), overseeing potential conflicts of interest including related-party transactions (38% of the companies) and ensuring integrity of the company’s financial report (40% of the companies). Although one of the main roles of the board is to set long-term strategies, only 28% of the board fulfilled this role in practice. General support, compensation for board of directors Nearly 76% of the equitized firms provided their directors with education and training opportunities. Regarding the compensation for the board of directors, only 37% of the firms had financial incentives that encourage good board of directors. In the cases that did have the financial incentives, almost 98% included stock option of the company. Role of stakeholders Stakeholders are defined as any person that has interest being influenced by performance of company such as banks, policy makers, employees…According to my survey the equitized companies had relatively good policies to ensure stakeholder’s interest. Over 88% of the equitized companies promoted transparency and accuracy in all communication to employees. And in over 90% of equitized companies, stakeholders were able to free communicate their concerns about illegal or unethical practices to the board. These results reflected the socialist orientation ideology in reforming Vietnamese economy. The above chapter presents the actual practice of CG in Vietnam’s equitized companies. The next chapter analyses second objectives of the research: whether CG works in Vietnam or how effective is it in newly equitized companies? 4 RELATIONSHIP BETWEEN CORPORATE PRACTICE AND FIRM PEFORMANCE GOVERNANCE Scoring data on CG practice In order to investigate the relationship between CG practice and firm performance, collected survey data on CG practice was scored and then given weight. The paper uses OECD Principles of CG as criteria to score CG practice in the equitised companies. The OECD Principles of CG is used as evaluation standard because it also takes into account the characteristics of developing countries and is widely used as benchmark for a number of countries including Vietnam. 636 | Asea Uninet Scientific and Plenary Meeting 2016 Since corporate governance practice in Vietnam is only in formative stage, practices that are popular in Western countries are likely to be alien to Vietnamese equitized companies. Therefore, it is imperative to give different weights to criteria measuring CG practice depending on their importance in Vietnamese context. It should be admitted that scoring data is subjective, depending on researcher’s views and their own understanding about the context within which their research problems are being investigated. However my survey includes many questions on various elements of corporate governance and aggregate scores are based on large number of questions, so the problem of subjectivity in scoring might be mitigated. Weight was given to each item so that they add up to 100 points for each category. To gain the aggregate score for each category such as shareholder’s rights, the score for Effective participation in decision-making (EP) and election of directors and other rights of shareholders (OR) are simply averaged. Total scoring of each category was used to conduct quantitative analysis and relationship between CG score and firm performance. Variables Independent variables Corporate governance practices were measured by four variables namely 1) total score of shareholder’s right, 2) total score of disclosure practice, 3) total score of role of boards of directors and 4) total score of stakeholder’s right. Control variables To control the influence of government ownership, firm size and industry performance. I employed three control variables, namely 1) government ownership, 2) firm size, 3) industry performance to control their effect on performance. Dependent variables There are two kinds of measure of firm performance identified in the literature: financial measures and non financial measures. Non-financial indicators include such measures as level customer, stakeholder satisfaction. Commonly used financial measures are return on assets (ROA), return on equity (ROE), earnings per share (EPS) and Tobin’s Q. In my research I followed common approach and used two financial measures, namely Return on Assets (ROA) and Return on Equity (ROE) as these are common measures used in the literatures. Moreover, the data is available in financial reports of the companies that I can access to induce me to use ROE and ROA in my research. ROE and ROA were collected between 2012 and 2014. Table 6 describes variables in more detail. Data analysis Mathematically, the regression model can be expressed as follows: ROE = α + β ln(Xi) + β ln(CONi) + εi (1) ROA = α + β ln(Xi) + β ln(CONi) + εi where Xi are governance variables CONi are control variables (2) Asea Uninet Scientific and Plenary Meeting 2016 | 637 Result The results of regression are reported in Table 1.2a and 1.2b. I used step-wise method in the regression Table 1.2a: Impact of CG practice on ROE Independent variables Dependent variable ROE N Total score of shareholders’ right Total score of information disclosure Total score of role of the board of directors Total score of stakeholders’ right 183 5.475** .000 6.544** .000 8.209** .000 Constant 1.908 .058 -0.182 .0856 3.188* .002 0.608 .544 .187 Adj. R Sq. 0.351 State ownership Industry performance Firm size * p < 0.05 ** p< 0.01 It can be seen from the results above that the variables ln_BoD, ln_DI, ln_SR and Industry are significantly related to firm performance when measured by ROE. The role of the board of directors had a positive impact on ROE (t = 8.209, p<0.05), information disclosure practice was significantly related to ROE (t = 6.544, p<0.05), shareholders’ right and industry performance had significant influence on ROE (t=5.475 and t = 3.188 respectively) Test the relationship between ROA and CG practice Table 1.2b: Impact of CG practice on ROA Independent variables Dependent variable ROA N Total score of shareholders’ right Total score of information disclosure 183 1.664 .098 1.589 638 | Asea Uninet Scientific and Plenary Meeting 2016 Total score of role of the board of directors Total score of stakeholders’ right .114 1.177 .241 Constant 3.132* .002 -5.456** .000 -1.560 .121 -2.714a .007 .082 Adj. R Sq. 0.179 State ownership Industry performance Firm size a : p < 0.1 * p < 0.05 ** p< 0.01 The result shows that government ownership is negatively related to firm performance which measured by ROA (t=-5.456, p<0.05). That is the more shares government retained in the equitized companies, the more ineffective the companies operated. Also, firm size is negatively related to firm performance as the hypothesis suggested (t = -2.714, p<0.01). Stakeholder’s right had positive impact on firm performance (t = 3.132, p<0.05). The regression result showed that corporate governance practice has an influence on performance of the Vietnam’s equitised companies. The companies practicing better corporate governance have achieved higher firm performance. However the power of the impact is relatively small. It can be seen from the result that R-square in the Table 1.2a and Table 1.2b are only 35.1% and 17.9% respectively. That is 35.1% of the variability in ROE can be explained by role of board of directors, practice of information disclosure, shareholders’ rights and industry performance. And 17.9% of variability in ROA can be explained by the role of stakeholders, state ownership and stakeholders’ right. The rather small R-square revealed that current CG practice did not have a very strong impact on performance of the Vietnam’s equitised companies. It is understandable because of the fact that equitisation and CG practice are only in formative stage. Moreover, CG practice, which is in many ways, indirectly influences company’s performance. 5 CONCLUSION The paper throws light on corporate governance practice in the equitised companies. At the policy level, Vietnam appears to move toward modern CG in the developed countries. However, CG practice at the firm level falls short of enforcement intent. Investigating the relation between CG and firm performance is of great importance to practitioners, academics and policy makers. In this paper, I undertake a comprehensive analysis of governance practice and develop comprehensive measures of CG and relate these measures to performance. Using the multiple regression analysis, the paper finds that better corporate governance practice positively related to firm performance. However the impact of CG is rather small. This result reflects truly the actual situation in Vietnam where Asea Uninet Scientific and Plenary Meeting 2016 | 639 CG practice is still in its infancy, so their impacts remain modest. Another explanation for small impact of CG on firm performance is CG is indirectly influence on performance. The more direct impact may be lie at management decisions such as marketing strategies, role of asset management cost, imposition of a hard budget constraint, etc. (Lewis, 2006). The result also shows the negative impact of government ownership on the performance of equitised companies. A policy implication of the paper is that the corporate governance reform efforts should be continued to enforce a high level of disclosure and transparency and encourage effective changes in companies’ strategies. The current arrangements in most equitized companies do not support these requirements. One of the main reasons is that the government is still dominant shareholder in the equitised companies. Thus, after being equitised many equitised companies are operating in broadly the same as they did before equitisation. In order to improve CG practice and performance, the government should increase proportion of shares being sold to outside. The role of strategic shareholders (i.e. outside, institutional and foreign shareholders) is, therefore, critical in this respect. Only owned large enough shares in the equitised companies, do institutional investors have incentives to have strong voice in discussing strategic development of the companies. With strong voices of strategic shareholders it is likely that new, innovative and entrepreneurial management teams will develop or be appointed. With new, innovative management teams, it is likely that the companies will be able to come up with effective changes in their strategies. REFERENCES Abdullah N. S. (2004) ‘Board composition, CEO duality and performance among Malaysian listed companies’, Corporate governance, 4(4): 115-32 Afzalur R. ‘Corporate governance, Executive Pay and Firm performance: Evidence from Bangladesh’, International Journal of Management, 31(1): 556-75 Akimova I. & S. Gerhard (2004) ‘Ownership, corporate governance and enterprise performance: Empirical results for Ukraine’, International Advances in Economics, 10 (1): 28-42 Bauer R. & N. Guenster & R. Otten (2003) ‘Empirical evidence on corporate governance in Europe: The effect on stock returns, firm value and performance’, Journal of Asset Management, 5(2):91-104 Brown D. L. & M. L. Caylor (2005) ‘Corporate governance and firm valuation’, Working Paper. Clarke T. (2004) ‘Theories of corporate governance: the philosophical foundations of corporate governance’, Routledge, London. Coles J. W. & V. B. McWilliams & N. Sen (2001) ‘An examination of the relationship of governance mechanisms to performance’, Journal of Management, 27: 23-50 Dehaene A. & V. D. Vuyst & H. Ooghe (2001) ‘Corporate performance and board structure in Belgian companies’, Long Range Planning, 34: 383-98 Diacon, S. and N. O'Sullivan (2005), "Board Composition and Performance in UK Life Insurance Companies", British Journal of Management, 14(2): 115-30. Evans & Evans & Lof (2002) ‘Corporate governance and declining firm performance’, International Journal of Business Studies, 10(1): 1-18 Fama F. E. & Jensen C. M (1983) ‘Separation of ownership and control’, Journal of Law and Economics, 2(3) Gompers P. & J. Ishii & A. Metrick (2003) ‘Corporate governance and equity prices’, The Quarterly Journal of Economics, February 2003 640 | Asea Uninet Scientific and Plenary Meeting 2016 Haniffa R. & M Hudaib (2006) ‘Corporate governance structure and performance of Malaysian listed companies’, Journal of Business Finance & Accounting, 2006 Hart, O. (1995) ‘Corporate governance: Some theory and implications’, Economic Journal, 105(430): 678. Judge W. Q & I. Naoumova & N. Koutzevol (2003) ‘Corporate governance and firm performance in Russia: an empirical study’, Journal of World Business, 38: 38596 Kumar P.& A. Zattoni (2013) ‘Corporate Governance, Board of Directors, and Firm Performance’, Corporate Governance: An International Review, 21(4): 311-13 Lewis M. K (2005) ‘Islamic Corporate Governance’, Review of Islamic Economics, 9(1) Lewis. M. K. & B. Chiu (2006) ‘Reforming State owned enterprises in China’, Edward Elgar, Cheltenham, ISBN 1 84376 7589. Malhotra D. K& R. Poteau & J. Fritz (2013) ‘Does corporate governance impact performance ?’, An analysis of DOW thirty stock’, International Journal of Business and Economics Perspectives, 8(1): 62-75 Monk R. & Minow N. (1996) ‘Watching the watchers: corporate governance for the 21st century’ Nelson J. (2005) ‘Corporate governance practices, CEO characteristics and firm performance’, Journal of Corporate Finance, 11:197-228 OECD (1995) ‘Financial markets and corporate governance’, Financial Market Trends, 62: 13-35 OECD (2004) ‘OECD principles of corporate governance’, OECD Issue. Parker D. (1995) ‘Privatization and the internal environment’, International Journal of Public Sector Management’, 8(2): 44-62. Ramsay H. (1997) ‘Corporate governance and the role of directors’, Melbourn University Issue. Shleifer A. & Vishney W. R. (1996) ‘A survey of corporate governance’, Journal of Finance, 52(2): 737 Stephen F. & H. Brian (2005) ‘Does corporate governance matter to Canadian investors?’, Canadian Investment Review, 17(3): 19-24 Thomsen S. (2004) ‘Corporate values and corporate governance’, Corporate Governance, 4(4) Tian J. J & C. M. Lau (2001) ‘Board composition, leadership structure and performance in Chinese shareholding companies’, Asia Pacific Journal of Management, 18: 24563 THE BILATERAL REAL EXCHANGE RATE AND THE CHINESE FOREIGN DIRECT INVESTMENT IN THE LAO PDR Houmlack Mingboubpha houmlack@yahoo.com Economic Division, Department of General Research, Office of Party Central Committee, Lao PDR Sengsathit Vichitlasy jockker59@gmail.com Department of Personnel, Government’s Office; Lao PDR Abstract The unit root test based NLS approach applied with two objective to observe any impacts of real exchange rate and quantify its coefficient on the Chinese foreign direct investment whether the Eurozone debt crisis in 2013 could trap the Chinese foreign direct investment in the Lao PDR, the empirical results reveal significant positive correlation of real exchange rate and real GDP with the Chinese FDI; nevertheless, the coefficient of real GDP and its significant level are absolutely greater than the coefficient as well as the significant level of the real exchange rate. Both two significant independent variables denote that if the local currency appreciates by 1percent, the Chinese foreign direct investment could rise by 0.5 percent. Whereas the increase of real GDP by 1 percent might be resulted in 2.5 percent increase of the Chinese foreign direct investment in the Lao PDR; On the one hand, the dummy2013 is positive but insignificant which show that the Chinese economy is likely to stand firm enough against external shocks like global economic downturn or Euro-zone debt crisis occurred in 2013. In brief, the real exchange rate is more statistically respectable than real GDP rate to determine the Chinese foreign direct investment. In order that both the Lao PDR and PR China to move ahead amidst the regional and international integration, the key policy implication could be drawn throughout this study is that resulting from financial and technological abundance of the PR China and bilateral firm concretized ties, both Lao PDR and PR China would prosper together in the near future. Keywords: Bilateral, Exchange Rate, Investment, Lao PDR, PR China 1 INTRODUCTION 2016 The flow of the foreign direct investment (FDI) initially rose and dramatically expanded around the world since 1970s. The fluctuation of the FDI inflow over time could be either looming or opportunistic for the host countries; and such fluctuation might not be theoretically explained (Chen et al, 2005). The FDI postulated as the tool to acquire the capital inflow, technological advancement, and marketing and managerial skills (Cheng Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 641 642 | Asea Uninet Scientific and Plenary Meeting 2016 and Kwan, 2000). Indeed, one of characteristics of globalization in the past decades has been the growth of the foreign direct investment which to some extent exceeded the growth of trade (Freenstra, 1998). In case of the Lao People’s Democratic Republic (Lao PDR), it might have undergone the period of FDI boom after the unlocked door policy in 1986 transforming itself from the centrally planned economy to the market driven economy. From the latest data, the Chinese FDI has topped the first rank in the Lao PDR, worth 5.48 billion US$ or 832 projects so far and outplayed Thailand and Vietnam respectively.70 For the bilateral exchange rate, it was 29.46 Kips per 1 Yuan in 1986 to 1,204 Kips71 per 1 Yuan on 19th December 2015 (BCEL, 2015). All in all, this study aims to fulfill two objectives: to quantify and prove the correlation between the real exchange rate and FDI and observe any possible impact of the EU debt crisis in 2013 on the Chinese FDI in the Lao PDR. For the literature based studies related to the real exchange and the foreign direct investment, there are four groups of studies found. The first group studies found that the currency depreciation72 could lead to the FDI increase such as Froot and Stein (1991); Klein and Rosengren (1992); Dawenter (1995); Blonigen (1997); Bayoumi and Lipworth (1997); McCorriston and Sheldon (1998);73 Gast (2005); Tokunbo and Lloyd (2009); and Aristotelous and Founta (2012). Second group studies, they attest that the currency appreciation74 may result in the FDI rise such as Campa (1993); Tcha (1997); Blonigen (1997); Tomlin (2000); Xing (2002); Aristotelous and Fountas (2012); Alba et al (2005). For insignificant result studies, they are the studies by Tomlin (2000); Dorantes and Pozo (2001), and Herger et al (2008). And mixed result studies, the studies by Cushman (1985); Goldberg and Klein (1997); Ihrig and McIntyre (1996); Nikolina and Panagiotis (2000); Goldberg and Kolstad (1994); Faeth (2005); and Chowdhury and Wheeler (2008). In addition to the four group studies, there is one paper written by the Phillips and Esfahani (2008) whose paper is the literature focused study. 2 METHODOLOGY AND UNIT ROOT TEST Based on the review of the findings from the literature, those previously conducted studies exclude dummy variables to identify the impact of global shocks such as the EU debt crisis in 2013. Furthermore, the dependent variable and independent variables converted from real values: real Chinese FDI, real GDP and the real exchange rate between the Chinese Yuan and the Lao Kip. To apply the real variables, there are a few rational behind the selection of these three independent variables in relation to one dependent variable. For opting for the real FDI as the dependent variable, several studies have applied the FDI proportion to the GDP or GNP and fewer papers have rested on the FDI nominal series. In terms of making decision to include the real GDP and real exchange rate in the equation, it is due that only the real exchange rate has been applied or included in the equation because the authors needed to study or know about the impact of the exchange rate on the FDI; nonetheless, only a few papers have included the real GDP or GDP as the independent 70 Department of Investment Promotion, Ministry of Planning and Investment (2015) The Lao currency unit 72 The sign of the real exchange rate is negative 73 Cited in Phillips and Esfahani (2008) 74 The sign of the real exchange rate is positive 71 Asea Uninet Scientific and Plenary Meeting 2016 | 643 variable. More interestingly, applying the dummy variable in this paper is the most important part since no studies so far have included the dummy variable. In short, resulting from the reasons mentioned, the real GDP, real exchange rate, dummy variable and the real FDI are chosen for the empirical regression. Mathematically, the mathematical form of the model is the following: RFDICN=f(RGDPLAO, RXRATECNLAO, DUMMY2013) (1) Where the notation of each variable refers to:     RFDICN: The real Chinese direct investment in the Lao PDR from 1991 to 2015 equal to the nominal series deflated by the local consumer price indices; RGDPLAO: Real GDP of the Lao PDR as the nominal series divided by the GDP deflator; RXRATECNLAO: Bilateral Real Exchange Rate between the Chinese Yuan and the Lao Kip from 1991 to 2015 equal to the nominal exchange rate*US CPI/Lao CPI with the 2010 base year; DUMMY2013: Dummy variable of 2013 equal to 1 and 0 for other years while transforming the above mathematical function into the logarithm regression equation: 𝐿𝑜𝑔(𝑅𝐹𝐷𝐼𝐶𝑁 ) = 𝛽0 + 𝛽1 𝐿𝑜𝑔(𝑅𝐺𝐷𝑃𝐿𝐴𝑂 ) + 𝛽2 𝐿𝑜𝑔 (𝑅𝑋𝑅𝐴𝑇𝐸𝐶𝑁𝐿𝐴𝑂 ) + 𝛽3 𝐷𝑈𝑀𝑀𝑌2013 + 𝜀4 (2) Note: 1. 𝜀4 𝑑𝑒𝑛𝑜𝑡𝑒𝑠 𝑡ℎ𝑒 𝑒𝑟𝑟𝑜𝑟 𝑡𝑒𝑟𝑚 2. Most time series data derive from the ADB country database In addition to the main research test, this study also contains the unit root test to track whether the variables applied in this study are free of the unit root problem by comparing the testing results from both Augmented Dicky Fuller Test (ADF test approach) and Phillip - Perron Test (PP test approach) so that the bias or over rejection is taken into account. Applying the unit root test is strongly believed to be statistically appropriate since the time series data is applied in the regression analysis in this study which is dissimilar to the data test used by Froot and Stein (1991) as they applied the Heteroskedasticity test due to the panel data applied in their study. 3 3.1 UNIT ROOT TEST, EMPIRICAL FINDGINS AND DISCUSSION Unit Root Test Result and Empirical Findings Apart from the empirical findings below, this study includes the unit root test of the variables used the regression. As the results of unit test shown, at the level tests for both ADF approach and PP test approach, only two variables in the ADF test are to some extent significant leading to the rejection of the unit root problem. While the variables in the PP test are all insignificant. Expectedly, the test results at the first difference show the high 644 | Asea Uninet Scientific and Plenary Meeting 2016 significance even at 1 percent for all variables in the equation. For the full picture of the unit root result, see the two tables below. Table 1: The Augmented Dicky Fuller Test (ADF Test) No. Variable Level Test First Difference Test Number of Lags Include in Equation Method 1 2 3 RFDI RGDP EXRATE -1.989* 2.816** -1.061 -6.683*** -4.448*** -3.522*** 5 5 5 Trend and Intercept Schwarz info criteria Source: Authors’ Calculation Table 2: The Phillips- Perron Test (PP Test) No. Variable 1 2 3 Level Test RFDI -1.817 RGDP 0.5844 EXRATE -1.0615 First Difference Test Number of Include in Lags Equation Method -6.683*** -4.4489*** -4.5542*** 5 5 5 AR Spectral OLS Trend and Intercept Source: Authors’ Calculation As the findings can be shown below, if other independent variables are fixed,75 the Chinese foreign direct investment in the Lao PDR is likely to hit a low since the constant coefficient is significantly negative. This first remarkable finding shows that in case that the economic growth and exchange rate of the Lao PDR are less taken into account or if those two variables; for instance, the real exchange rate and the real GDP do not outperform, the Chinese foreign investment in the Lao PDR appears even worsened based on this empirical finding found in this study. While for both real GDP and real exchange rate, they significantly positive with such a real foreign direct investment; indeed, the rise of GDP of 1 percent could lead to increase of the Chinese foreign direct investment in the Lao PDR by 2.5 percent with 1 percent significant level, comparing with the real exchange rate that could push the Chinese foreign direct investment by 0.5 percent increase with the significant level at 10 percent. Fortunately, the dummy of the year 2013 although it holds the positive sign, it is insignificant to shed the light on the Chinese foreign direct investment in the Lao PDR. In short, most of independent variables appear to be respectable to explain their relationship with the Chinese foreign direct investment in the Lao PDR. 75 In another perspective is that if the GDP and exchange rates are not taken into account in terms of the macroeconomic policy making process, the foreign direct investment from the PR China might be no longer attractive Asea Uninet Scientific and Plenary Meeting 2016 | 645 The regression result of this study is shown below. 𝐿𝑜𝑔(𝑅𝐹𝐷𝐼𝐶𝑁 ) = −39.20 + 2.50𝐿𝑜𝑔(𝑅𝐺𝐷𝑃𝐿𝐴𝑂 ) + 0.50𝐿𝑜𝑔(𝑅𝑋𝑅𝐴𝑇𝐸𝐶𝑁𝐿𝐴𝑂 ) + 1.44𝐷𝑈𝑀𝑀𝑌2013 T-test (-4.04)***76 (2.49)*** (1.72)*77 (1.29) 𝐴𝑑𝑗𝑢𝑠𝑡𝑒𝑑 𝑅2 = 78 Dubbin Watson=1.21 Source: Authors’ Findings 3.2 Discussion of Empirical Findings The conceptual framework first applied by Cushman (1985), Froot and Stein (1991) and Dawenter (1995) seems to be workable in this study. While this study contains the most important difference by applying the dummy variable into that framework in order to observe more various impacts in addition to the real exchange rate or real GDP. The insignificance of the dummy variable firmly demonstrates the strong and firm economy of the PR China under the condition that global shocks may not crack the Chinese foreign direct investment overseas or to some extent in the Lao PDR. In other words, this unaffected impact could be resulted from the abundant financial resources, technological sufficiency and lucrative business acumen of the Chinese investors. Another rationale could be the strong and firm bilateral economic cooperation between the Lao PDR and PR China as the Chinese economy grows, the economies of the neighbors would rather grow. Another possible discussion could be taken into account is that the real exchange rate would be less grounded than the real GDP in respect of determining the FDI attraction in the Lao PDR in the past history because the findings illustrate both coefficient and significant level of the real exchange rate are obviously smaller than those of the real GDP. In fact, this finding may be correspondent with present reality of the economic development that if the economic growth or economic performance is upward trend, it is usually a factor to lure the foreign direct investment into the country. In principle, it can be said that the economic growth tends to become one of the most significant factors to attract or increase the FDI inflow into the Lao PDR. The last inference from this study could be the finding backdrop comparing with those findings in the literature. The positive correlation between the real exchange rate and foreign direct investment found in this study should contribute to the literature in which the group of authors who came up with the similar findings; for example, Campa (1993); Tcha (1997); Blonigen (1997); Tomlin (2000); Xing (2002); Aristotelous 76 (***) represents significant level at 1% 77 (*) denotes significant level at 10% 646 | Asea Uninet Scientific and Plenary Meeting 2016 and Fountas (2012); and Alba et al (2005) who attest that the currency appreciation could be resulted in the increase of the foreign direct investment. This result might be the same as the results conducted by Froot and Stein (1991) that the bilateral exchange might be the suitable measure of the relative wealth of the foreign direct investors. At the same time, sign of the correlation between the real exchange rate and FDI tends to be positive in case of using the bilateral exchange rate between the US and Canada. In overall, inclusion of the dummy variable and comparative understanding of the role of real exchange rate and real GDP would distinguish this study differently from other studies existing in the literature. Another finding discussion could be extracted from this study is the comparison of sizes of the coefficients of the real GDP and the real exchange rate against those coefficients found by the other authors from the literature. As a matter of fact, the results of the comparative sizes of the coefficients are the following: Table 3: The Partial Comparison among the Coefficients of the Real Exchange Rate and Real GDP78 Found in the Literature Studies with the Coefficients Found in This study No. 1 2 3 4 5 6 7 8 9 10 11 12 78 Real GDP Coefficients Real Exchange Rate Coefficients -2.1149 (Min) +1.9292 (Max) +0.236 -0.349 (Min) +0.0871 (Max) +0.219 (Min) +2.292 (Max) -0.09 (Min) +3.00 -123,108 (Min) -174,526 (Max) +2.834 +0.01 (Min) +6.5 (Max) +10.24 (Min) +11.67 (Max) +0.595 (Min) +9.764 (Max) -1.73 (Min) +13.3 (Max) +1.905 -0.962 (Min) +0.869 (Max) -1.07 (Min) +0.02 (Max) -6.59 (Min) +95.94 (Max) -514.50 (Max) +5.672 (Max) - 381.03 (Min) +5.625 (Min) +2.50 +0.50 - -0.0948 (Max) -0.0006 (Min) -51.23 (Max) -0.09 (Min) Author(s) Cushman (1985) Blonigen (1997) Na and Lightfoot (2006) Goldberg and Kolstad (1994) Aristotelous and Founta (2012) Gast (2005) Chowdhury and Wheeler (2008) Faeth (2005) Tcha (1997) Mingboubpha and Vichitlasy (2016) Froot and Stein (1991) Nikolina and Panagiotis (2000) the dependent variable is mostly the real foreign direct investment in the regular functional form and the logarithm functional form Asea Uninet Scientific and Plenary Meeting 2016 | 647 Note: Most of studies or authors applied the panel data that could result in double values or two opposite signs of the coefficients for both real exchange rate and real GDP Source: Authors’ Summary from the Literature Review The results of coefficients comparison can be seen from the table 1 above; the coefficient of the real GDP and the coefficient of the real exchange rate found in this study are somehow differently lower than those coefficients found the authors in the literature review. For the coefficients of the real GDP found so far, the highest coefficient is +11.67 by Aristotelous and Founta (2012) and the lowest coefficient is -514.50 by Tcha (1997) while that of the study is +2.50. After summarizing the signs of the real exchange rates in relation to the real foreign direct investment, most signs appear to be positive including +0.50 found in this study. Among sizes of the real exchange rate coefficients, +95.94 found by Faeth (2005) is classified as the highest coefficient and the lowest one is -174,526 by Aristotelous and Founta (2012). All in all, the coefficients found in this study are different from those previously found by several authors in terms of the sizes and bilateral positive relationship unlike the most findings that contain the mixed results. 4 CONCLUSION AND POLICY IMPLICATION 4.1 Conclusion Applying the original conceptual framework of Cushman (1985); Froot and Stein (1991); and Dewenter (1995) tend to be empirically applicable to draw the impact of the real exchange rate on the Chinese direct investment in the Lao PDR. Among three independent variables (real GDP, real bilateral exchange rate, and dummy2013), the real exchange rate is positively significant level at 10 percent with the coefficient of 0.5 percent comparing with 1 percent significant level and almost 2.5 percent of the real GDP coefficient. While the dummy2013 is supposed to observe the impact of the most recent European debt crisis that used to happen in the 2013; in fact, it is positive but insignificant. This study is different from the studies found in the literature in terms of the inclusion of the dummy variable and to some extent this study focuses on the real values of the variables applied in the OLS approach, partial comparison of the impact of the real GDP and real exchange rate coefficients which found in this study and the previous studies, and inclusion of the unit root test. Moreover, the findings of this study as well as variables appear to be respectable in terms of statistically significant levels. In short, the positive rise of the real exchange rate on the other hand could result in the increase of the Chinese direct investment in the Lao PDR just lags behind the role of the real GDP of the Lao PDR which is more statistically positive with the Chinese direct investment. 4.2 4.2.1 Policy Implication Policy Implication for the Lao PDR The findings found in this study might be the weight scale that let the policy makers realize that either appreciation or depreciation of the local currency is only the historic driver for the foreign direct investment as to some extent this belief was worthy or effective for 3 decades ago in the United States, Japan or developed countries. At the present time, there could be other dynamic factors considered to attract or increase the foreign direct 648 | Asea Uninet Scientific and Plenary Meeting 2016 investment; in particular, the Chinese direct investment in the Lao People’s Democratic Republic such as GDP growth, income per capita, political stability, rule of law, infrastructure, and regional as well as international integration. 4.2.2 Future Bilateral Economic Cooperation Perspective The PR China so far has strongly prospered in terms of its financial and technological abundance. In addition to those two factors both Lao People’s Democratic Republic and People’s Republic of China always become the friendly neighbors in all seasons. It is possible that both countries would share the beneficial cooperation in the future under the condition that the Lao People’s Democratic Republic tends to be in need of financial resources and import of the modernly productive technology to steer its socioeconomic development plan. Due to the global market driven economy, sooner or later the natural resources might be depleted and the human resources must be more developed to deal with that resource depletion because the factor of the human resources necessitate the spontaneous growth and pragmatic development. As a result, the People’s Republic of China could be the one giant economy that would face such a depleted dilemma; at this moment ahead, the People’s Republic of China had better nod to shoulder with the Lao People’s Democratic Republic so that the production base of the People’s Republic of China will last further under the condition that the People’s Republic of China itself is still one of world production bases. For the Lao People’s Democratic Republic to lean on the durable wall and move ahead, it would rather select the most potential sectors to be focused and grammatically developed. In other words, this selection means that the Lao People’s Democratic Republic should realize its potential factors and more than that the Lao People’s Democratic Republic also should know what kinds of stimulating factors can be brought into the country in order to boost the good and service production and finally to spur the growth. To conclude, both Lao People’s Democratic Republic and People’s Republic of China remain interdependent in respect of the natural resources and human resource development cooperation not only in the past history but also the dynamic bilateral future cooperation. REFERENCES Alba, J; Wang, P; and Park, D. (2005). Impact of exchange rates on foreign direct investment and interdependence of FDI over time. URL at http://ntz.fas.nus-edu.sg . Aristotelous, K and Fountas, S. (2012). What is the impact of currency unions on FDI inflows? evience from Eurozone countries. South eastern europe journla of economics , Vol.2(2012):87-98. Bayoumi, T and Lipworth, G. (1997). Japanese foreign direct investment and regional trade. IMF working paper. wp/97/103 . BCEL. (2015, December 18th). Exchange Rate. Retrieved December 19th, 2015, from BCEL Laos: http://bcel.com.la/bcel/exchange-rate.html Blonigen, B. (1997). Firm specific assets and the link between exchange rate and foreign direct investment. University of Oregon . Campa, J. (1993). Entry by foreign firms in the US under exchange rate certainty. Review of economics , Vol.75:614-622. Chen, K; Rau, H and Lin, C. (2005). Impact of exchange rate movement on FDI: market oriented versus cost oriented. National Chengchi University . Asea Uninet Scientific and Plenary Meeting 2016 | 649 Cheng, L and Kwan, Y. (2000). What are determinants of the location of foreign direct investment? the chinese experience. Journal of international economics , Vol. 51(379-400). Cushman, D. (1985). Exchange rate risk: expectations and level of direct investment. Review of economics and statistics , Vol.67(2): 297-308. Dawenter, K. (1995). Do exchange rates drive foreign direct investment? Journal of business , Vol.68(3):405-433. Department of Investment Promotion. (2015). Summary of Foreign Investent in the Lao PDR. Ministry of Planning and Investment . Dorantes, A and Pozo, S. (2001). Foreign exchange rates and foreign direct investment in the US. International trade journal , Vol.15:323-343. Faeth, I. (2005). Determinants of FDI in Australia: which theory can explain it best? Department of economics research paper. University of Melbourne , Paper No.946. Freenstra, R. (1998). Integration of trade and disintegration of production in the global economy. Journal of economic perspectives , Vol.12:31-50. Froot, K and Stein, J. (1991). Exchange rates and foreign direct investment: an imperfect capital markets approach. Quarterly journal of economics , Vol. 106(4): 11911217. Gast, M. (2005). Determinants of foreign direct investment of OECD countries from 19912000. URL at http://geb.uni-giessen.de . Goldberg, L and Klein, M. (1997). FDI, Trade, and Real Exchange Rate Linkages in South East Asia and Latin America. Working Paper No.6344 , National Bureau of Economic Research. Cambridge University Press. Goldberg, L and Kolstad, C. (1994). Foreign direct investment exchange rate variability and demand uncertainty. International economic review , Vol.36:855-873. Herger, N; Kotsogiannis, C and McCorriston, S. (2008). Cross border acquisitions in the global food sector. European review of agricultural economics , Vol.35(4):563587. Ihrig, J and McIntyre, K. (1996). Foreign direct investment and the real exchange rate: the business cycle link. Eastern economics association conference. University of Virginia . Klein, M and Rosengren, E. (1992). The real exchange rate and foreign direct investment in the US: relative wealth vs relative wage effects. NBER working paper series. No. 4192. National Bureau of Economic Research . McCorriston, S and Sheldon, I. (1998). Cross border aquisitions and foreign direct investment in the US food industry. American journal of economics , Vol.80:10661072. Na, L and Lightfoot, W. (2006). Determinants of foreign direct investment at the regional level in China. Journal of technology management. , Vol.1(3):262-278. Nikolina, K and Panagiotis L. (2000). Foreign direct investment and real exchange rate interlinkages. Open economic review , Vol.11:135-148. Phillips, S and Esfahani, A. (2008). Exchange rates and foreign direct investment: theoretical models and empirical evidence. Australian journal of agricultural and resource economics , Vol.52(4):505-525. Tcha, M. (1997). A note on Australia's inward and outward DFI. Department of economics. Discussion paper No.97 , University of Western Australia. Tokunbo, O and Lloyd, A. (2009). Foreign direct investment and exchange rate votality in Nigeria. International journal of applied economterics and quantitative studies , Vol.6(2). 650 | Asea Uninet Scientific and Plenary Meeting 2016 Tomlin, K. (2000). Effects of models speculation on FDI models: an appreciation of count data models. Southern economic journal , Vol.67:460-468. Xing, Y. (2002). The impact of real exchange rates on Japanese direct investment in China's manufacturing: an empirical assessment. International University of Japan Research Paper . THROUGH A GENDER LENS: THE BANGSAMORO POLITICAL PARTIES IN MINDANAO, PHILIPPINES Rosalie Arcala Hall rahall@upv.edu.ph University of the Philippines Visayas Abstract Peace agreements signed between the Philippine government and two Bangsamoro separatist groups—Moro National Liberation Front (MNLF) and the Moro Islamic Liberation Front (MILF) included provisions for institutional designs intended to enhance women’s participation in formal political processes. The proposed Bangsamoro Basic Law features reserved sectoral representation for women and provides for the formation of regional political parties to compete within the single-member district and proportional representation schemes. Because political parties are integral for armed groups’ transition to democratic politics, how they are organised as platforms for gender inclusiveness is key. The paper compares the participation of MNLF and MILF women in the formation of affiliated regional parties- the Bangsamoro Women United Party (BWUP) and the United Bangsamoro Justice Party (UBJP). The paper explores the women’s articulations about their role as party activists and prospective candidates, and compatibility/tensions with cultural interpretations of gender roles. Fifteen in-depth interviews of select female local incumbents, party activists, national party-list representatives and male party leaders, and 2 focus group discussions with key political party members were conducted in Mindanao from June- September 2014. UBJP has a more concrete party structure and features a more formal link with its principal, the MILF. Both parties have a clear women’s agenda, women’s representation within the party structure and contingent nomination procedure based on cultural assumptions and principals’ directives. Keywords: political party, gender, women, Bangsamoro, Mindanao 1 INTRODUCTION The peace processes between the national government and the armed Islamic movements (Moro National Liberation Front or MNLF, and Moro Islamic Liberation Front or MILF) have produced tremendous yields in terms of spaces for articulation of Bangsamoro women’s agenda and their agency. The power-sharing component of the Comprehensive Agreement on the Bangsamoro (CAB) and the projected new institutional design under the proposed Bangsamoro Basic Law (BBL) is set to fundamentally alter the political dynamics Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 651 652 | Asea Uninet Scientific and Plenary Meeting 2016 of the Bangsamoro region. With a ministerial/parliamentary form of government, a mixed set of representation and a reserved sectoral seat for women, new incentive structures are being created to regional party formation, which are also theorised to facilitate MILF’s transition from an armed group to a democratic political player. The regional parties are envisioned to provide more substantive vehicles for political participation by MILF and MNLF women, particularly those outside of powerful clans that have dominated local politics in the area. The electoral rules in the Philippines has direct consequences on the way political parties are organized and mobilised. All national and local seats are filled in through a winner-take-all/first-past-the-post (FPTP) system where candidates with the most number of votes is declared winner. Beginning 1998, 20% (about 52 seats) of the House seats are filled in through a party list (PL) system wherein the party that obtains at least 2% of the total votes cast gets 1 seat and up to 3 seats with a vote share higher than 2%. Philippine political parties evolved not so much as interest-aggregating bodies in line with the Western template, but as pragmatic coalitions of key leaders with their respective clientilistic networks (Teehankee, 2006: 260). They are primarily vehicles for Presidential candidacy linked to local brokers able to deliver votes in exchange for (post-election) access to resources and power. The Autonomous Region for Muslim Mindanao (ARMM) created in 1988 has parallel rules (FPTP) in filling up seats for the governorship and the Regional Legislative Assembly. Before the synchronised elections in 2013, ARMM elections were de-synchronized from national and local elections allowing the party of the incumbent President to interfere in ARMM elections by favouring administration party candidates (Co et al., 2013: 99). The predominance of political clans colour the operationalisation of “partisan politics” in the ARMM. The datu system (followers owed allegiance to clan leader (datu) for their ability to mediate and reconcile disputes) evolved as a way for the central government to coop clans that are then used to neutralise uncooperative ones or to suppress a rebellion/insurgency (Lingao, 2013: 18; BrechtDrouart, 2015: 90). Under democratic electoral rules, the clan leaders’ asset is their followers, the locked-in-electorate they are able to mobilise or de-mobilize by use of fraud, intimidation and outright violence (Sidel, 2014: 18; Co, 2013: 69 citing Rivera 2011). The clan leader also directly influences electoral outcomes in areas he controls by dictating who runs for office (preselecting candidates who invariably run unopposed) and by using his private army to pressure local COMELEC officials and election inspectors to fudge the results (Ilagan, 2013). Since the democratic transition in 1986, the proportion of women running for office has been steadily increasing. Veneracion-Rallonza (2008: 227) noted an upward trend from 9% to 16% in terms of legislative seats; and from 10% to 16% in terms of provincial and local seats from 1988 to 2004. But while the number is increasing nationally, the record for ARMM remains well-below the average— roughly 10% of total (Co, 2013: 128 and 129). The reasons cited for comparatively lower proportion of women (to men) running for office are: (1) socially-defined roles for women to be supportive of leader-husbands by entertaining constituencies and doing charity work; (2) multiple burden of women- domestic, work, civic— which make entry into politics unattractive; and (3) political parties not exerting effort to recruit women in their slates as candidates (COMELEC exec: Political Asea Uninet Scientific and Plenary Meeting 2016 | 653 parties should field more women candidates, 25 November 2015). Majority of women inflect in elected office are drawn from the elite and from political families or clans that have an established following in their locality (Aguilar, 1993: 148 and 151; Report on the Status of Women in Urban Local Government, n.d., 10). In the 2013 Mindanao elections election, many women came from family dynasties Arguillas (2013). The usual trajectory for women’s entry into politics are: (1) they take over in locales with an established patronage-base by male clan members (e.g. father, husband, brother, uncle); (2) they are substitute candidate (in case of untimely demise of the male clan member with patronage-base) or “transition” candidate when male clan member is termed out (Veneracion-Rallonza, 2008: 242; Co et al., 2013: 128). Party affiliation is seen as an add-on, not a substitute to the money and other resources provided by the family (Veneracion-Rallonza, 2008: 245). In the context of ARMM, women exercise agency in running for office but within the ambit of their family affiliation and by the strong imperative for clans to keep political power within the family. Among Maguindanao clans, women members are “chosen” to run based on pragmatic considerations mentioned above; but very rarely for executive posts like mayor. Where clans occupy multiple elective positions concurrently, women clan members are chosen as presumptive candidate (Lingao 2013: 13). This paper describes the involvement of MNLF and MILF women in party formation and party-building (membership recruitment, chapter formation, nomination procedures and constituency building) within the Bangsamoro Women United Party (BWUP) and the United Bangsamoro Justice Party (UBJP), in the contexts of the incentive structure provided by new electoral rules under the proposed (agreed version) of the Bangsamoro Basic Law and the realities of clan domination in ARMM and local elections. The paper compares the perspectives of women party activists, male MNLF/MILF leaders and incumbent Moro women officials about women’s role in electoral politics and its compatibility/tensions with cultural interpretations of gender-based relations. 2 METHOD The research entailed fifteen (15) in-depth interviews of Muslim female incumbent regional legislators, national party-list representatives and male leaders of the MILF and MNLF. Two focus group discussions with key members of the Bangsamoro Women United Party (BWUP) and the United Bangsamoro Justice Party (UBJP) were conducted in Cotabato, Zamboanga and Isabela cities (Mindanao, Philippines) from June- September 2015. The key informants and FGD participants were selected and referred to by Asia Foundation (TAF), which commissioned the study. The FGD and interview guide questions covered: 1) membership recruitment; (2) financing and personnel resource mobilisation; (3) candidate nomination procedure; and (4) party activities along dimensions— public education (informing the general public about the reserved seats and other electoral laws and the necessity of women’s electoral participation); interest aggregation (building constituency for a gender agenda) and coalition-building (seeking connections and mutually beneficial relationships with civil society organisations and other political parties). The women-party activists’ and incumbents’ perspectives about women’s role in electoral politics, its compatibility/tensions with cultural interpretations of 654 | Asea Uninet Scientific and Plenary Meeting 2016 gender-based relations and comparability with views by male MILF and MNLF leaders are presented for analysis. 3 FINDINGS The electoral rules (FPTP, single-member district representation in the Regional Assembly) under the ARMM is the default rules-of-the-game for current party formations, but the Bangsamoro Women United Party (BWUP) and the United Bangsamoro Justice Party (UBJP) have the Bangsamoro Parliament under the proposed Bangsamoro Basic Law in their horizon, with as yet to be determined operational guidelines. The Bangsamoro Parliament features a mixed system of representation; the 60 parliament seats is to be distributed 50%-40%-10% (party list, district-based and sectoral seats, respectively) between competing regional parties, whose base is geographically-confined to the Bangsamoro core territory. At the time of writing, UBJP was able to file an application for accreditation as a regional political party with the Commission on Elections (COMELEC) within the May 2015 deadline while BWUP has not been able to do so. There are 40-50 core members and associates of BWUP, all of whom are women and majority of whom belong to the Moro National Liberation Front Women’s Committee including their de facto leader Bainon Karon. Apart from the core members (who are by demographics older women), the group also has young female recruits who are the children and/or grandchildren of MNLF women pre1996 (Bainon Karon, comments during focus group discussion, 02 June 2015). The BWUP is organisationally configured as an all-women party at this point, with membership recruitment only available to women but they also try to invite MILF women to join. The core members of BWUP are also women leaders of the Mindanawon Federation of Multi-Purpose Cooperatives, a civil society network that grew out of the many development projects following the 1996 Final Agreement between the government and the MNLF (Teng Ambolodto, personal communications, 02 June 2015).This network comprises the BWUP’s supposed constituency and volunteer backbone; they hope to tap these women leaders in populating the district chapters and doing precinct coordination work to identify at least 30% pro-party voters from each precinct. BWUP operations to date are focused on building organisational capacity. They have participated in trainings and workshops on political party building, funded by The Asia Foundation. The party’s operations are divided between Central Mindanao and island provinces (Sulu-Basilan-Tawi Tawi) members. Admittedly, the BWUP women experience great difficulty in mobilising across this geographical dispersion (Nawira Rasdi, personal communications, 21 August 2015). Rather than structured meetings, small group gatherings or socials are done whenever members come into town or visit. By contrast, the Central Mindanao chapter meets more regularly and is able to attract a larger number of women attendees at any given time. BWUP has no operational fund at this point; much of their expenses (for meeting meals, travel, communication etc.) are self-financed by member-volunteers. UBJP has a more concrete organization with committees (planning, education, documentation and publication, finance, disciplinary) and chapters (province, municipality/town/district, precinct) throughout the Bangsamoro core territory and Asea Uninet Scientific and Plenary Meeting 2016 | 655 Palawan. There are identified area coordinators per chapter & at least in the case of Basilan province and Isabela City, a complete set of officers paralleling the committees set up at the party’s central office (Ahkmad Al-Hamid, personal communications, 22 August 2015). UBJP claims at least 105,000 registered volunteers they hope to tap to meet the target COMELEC requirement of 100 members per municipality. For members, the UBJP is more inclusive in that it targets both males and females; MILF and non-MILF affiliated; Muslims, Christians and indigenous people. Chapter officers are also tasked to: secure a voters’ registration list from the local COMELEC office and to write a letter/introduce themselves to local COMELC officers. The bulk of the women who do volunteer work for UBJP come from the MILF Social Welfare Committee. UBJP sees MILF Social Welfare Committee members as important assets particularly in the voter registration drive. UBJP has a Deputy Vice President (1 of 4) for Women, who is Atty. Raisa Jujuri. Atty. Jujuri (comments during focus group discussion, 16 August 2015) is of the opinion that having women in elective positions through the political party mechanism is not a question of entitlement but capacity. She said the notion of a“woman’s quota” in the UBJP slate has been brought up by external agents, but did not surface in their community consultations. She is doubtful that such a quota system will work as UBJP will be hard pressed to find women who are capable and skilled in public speaking and planning. Rather than adopting a quota, she thinks that UBJP is better off adopting internal rules that will allow for more voluntary recruitment of women, as potential candidates gain capacity. Further, according to Sam Al Mansoor, UBJP Chairman (comments during focus group discussion, 16 August 2015), the party is envisioned as a pathway to reintegration for demobilised Bangsamoro Islamic Armed Forces (BIAF) combatants. Thus, organising activities for chapter coordinators include engagement with co-located MILF-BIAF commanders. The BWUP and UBJP are explicitly linked to the MNLF and MILF, respectively. BWUP claims that it has sought and received the green light from its principals (male leaders of the MILF Executive Council led by Muslimen Sema; and also informally to the Nur Misuari faction) to establish the party. The MNLF male leaders also expressed great confidence in the leadership of Bainon Karon and her organising capacity given her previous political roles as Regional Assembly Woman and Deputy ARMM Governor (Jan Jakilani, personal communications, 03 June 2015; Omar Sema, personal communications, 03 June 2015). Given the current factionalism of the MNLF leadership, BWUP functions autonomously from the movement. By contrast, the link between UBJP and the MILF is on a more formal footing. The party was created through a directive by the MILF Central Committee. UBJP’s central office committee memberships are also persons who concurrently occupy formal positions in the MILF. The MILF-CC retains “veto power” over UBJP rules, including nomination procedures which as it stands limits women to be parliament members but not to hold executive positions including mayor and Chief Minister, and the determination of the party’s list of nominees (criteria for slot and order distribution between geographic areas, ethnicity and gender) (Sam Al-Mansoor, comments during focus group discussion, 16 August 2015). Many of the two parties’ activities are geared towards building a mass base or voter constituency and informal candidate recruitment. BWUP is focused on recruiting and grooming local women leaders; emphasing education in party principles, social obligation as Muslim women and women’s agenda, but their activities are ad hoc and involve normal networking. No concrete examples of activities or strategies for candidate recruitment and voter registration drive were provided. BWUP’s short term plan is to endorse womenfriendly candidates in the 2016 elections and to build alliances with male-led partyformations. Its long term plan is to get accredited as a regional party; field candidates for both the Bangsamoro parliament and local elections; adopt a nomination procedure 656 | Asea Uninet Scientific and Plenary Meeting 2016 whereby candidate-nominees are to be drawn from their own members and a convention of members to scout and persuade potential candidates. For funding, they intimated that each core member donate the sum of 10,000 pesos each as “seed money” to support initial mobilisation. UBJP’s mass base comes from MILF members and supporters. Given the party’s unofficial status, their point persons could not openly recruit for members nor solicit/accept campaign donations. In Basilan, ground work is done through informal introductions to MILF communities, often piggy-backed to Bangsamoro Development Agency supported community projects or to social outreach projects by the MILF Social Welfare Committee (Abduljamid Tanasak, personal communications, 22 August 2015). UBJP officers encounter difficulties explaining about UBJP as a continuation of MILF’s struggle from political to democratic participation, particularly before Christian communities that think UBJP is an exclusive vehicle for MILF’s path to power under the proposed Bangsamoro Political Entity (Ahkmad Al-Hamid, personal communications, 22 August 2015). Both parties are cognisant that they formidable challenges in running against clandominated electoral politics and national party influence on local electoral outcomes. UBJP’s strategy against the first is three-fold: (1) change “the rules of the game”— more seats should be allocated through the party list system compared to district seats (which are naturally-controlled by clans); (2) a separate Bangsamoro Electoral Office and a Bangsamoro Election Code from which more neutral election guidelines (e.g. how are sectoral votes to be counted; sectoral vote conversion to seats and applicable thresholds) will emanate, and not subject to manipulation by Manila; (3) work against vote mobilization/demobilization by recruiting numerous poll watchers/monitors and pushing for voter re-registration. UBJP officers express confidence that their version of a locallygoverned “principled political party” would resonate more with MILF supporters over family/clan obligations during election time. BWUP’s strategy is fielding only candidates in local council positions and in localities where they will not run up against a clansupported candidate.While the male MNLF leaders generally welcome the creation of BWUP, they are not confident that the gains made by MNLF women in their NGO work and community immersions would suffice for winning elections. They argue that grassroots women can’t be relied upon when it comes to votes as their primary loyalty rests with their respective families/clans (Omar Sema, personal communications, 05 June 2015; Jan Jakilani, personal communications, 05 June 2015). For them, it is more pragmatic for BWUP to align themselves with a mainstream national party if the goal is to win seats. MILF male leaders are more optimistic of the loyalty of their MILF mass base given the relatively large amount showing during MILF assemblies and in the June 2015 gathering for volunteers (Dr. Pigkaulan, comments during focus group discussion, 16 August 2015). Both set of male leaders’ depict conservative views about the political role of women. While it is acceptable for women to run for political office, there are “reservations”: (1) that women only seek legislative, not executive posts (e.g. mayor or governor); (2) that women must be qualified, i.e. with comparable experience and education necessary for the position aspired for; and (3) all things being equal, women can run for the same position only if no other men are qualified. These reservations are in place because a woman’s priority is her family; running for office would run the risk of neglecting family over career. For married women in particular, a husband’s approval for a political career path is necessary (Omar Sema, personal communications, 05 June 2015; Ustadz Faisal Esmael, personal communications, 06 June 2015; Miskuddin Tupay, personal communications, 21 August 2015; Dr. Pigkaulan, comments during focus group discussion, 16 August 2015). Asea Uninet Scientific and Plenary Meeting 2016 | 657 Moro women have made inroads into elective positions at the ARMM legislature and as member of the national Congress. Two-term House Representative Sandra Sema, a member of the powerful Sinsuat clan and wife to MNLF leader-turned politician husband sums up that the key to winning elections is to get the approval of the clan leader who controls the municipalities (Sandra Sema, personal communications, 16 August 2015). Supporting village level candidates to cultivate local allies or local coordinators, and funding maintenance and other infrastructure projects are also important. While she secured national party endorsement, she sees marginal value in party affiliation during the campaign. The Regional Assemblywomen themselves connected with a political family and have male relatives (typically husband or father) who are incumbents, also sought party affiliation when they ran for office but admit that the parties offered marginal benefit to their candidacy and campaign. The women politicians views about women’s role in politics uses Islamic and cultural reference points. For Janimah Pandi (personal communications, 07 September 2015), Maranao women are not allowed to lead (occupy executive positions) but to legislate is alright because women’s interests have to be addressed and for which she has to be consulted. Politics being a family matter, it is a matter of negotiation and quite acceptable for women to run for office in place of termed-out husband, father or brother. Nedra Burahan (personal communications, 07 September 2015) similarly affirms that while there is equality between men and women in decisionmaking, married women’s entry into politics must first be consulted with and approved by the husband. Both Janimah Pandi and Myrna Ajihil (personal communications, 07 September 2015) highlight the importance of a woman’s family background in getting votes; the Muslim woman candidate’s character and reputation matter. 4 DISCUSSION Philippine political parties have evolved in ways contrary to the Western template of cleavage-based formations and vehicles for representation that are integral to democratic contestations via elections. Pragmatic elite alliances, transient, heavily state influenced and Presidential-candidacy-centered- these are the main characteristics of national political parties (Manacsa and Tan, 2005; Sidel, 2014; Hutchcroft and Rocamora, 2003). Four things account for this trend: (1) electoral rules, notably the majoritarian, first-the post-system (FPTP) which creates premium for personal appeal and name familiarity easier acquired by media exposure rather than rigorous constituency-building; (2) cultural prediliction towards individual candidates/personalities (and their family/clan connections) as basis for voting; (3) state control over election rules (party accreditation, adjudication over contested outcomes, conduct of campaigns) and simultaneous state weakness against voter mobilization/demobilization by local power holders; and (4) national government/establishment/administration influence over local electoral outcomes by virtue of control over nominations and machinery (Sidel, 2014; van Biezen and Kopecky, 2007). Multiparty Presidential races and the introduction of party list in the national House of Representatives post-1986 have not changed these malaise. In the ARMM, political parties carry little traction on election outcomes. Those 658 | Asea Uninet Scientific and Plenary Meeting 2016 who win in local elections predictably follow clan bailiwicks, while the President’s choice of regional governor and provincial governor candidates guarantee command votes for national candidates (Co et al., 2013). For women’s entry into the political arena, political parties have also not been much help. While the number of women seeking elective office and succeeding have increased since 1988, many were fielded by and received support mainly from their families and clans (Veneracion-Rallona, 2008). Women’s agency in this sphere has been mediated by cultural assumptions about her role, which tend to see them as substitutes or transition candidates for deceased or termed out male relatives, and increasingly as add-ons to clan’s political expansion. In the ARMM, the number of women running for office are lower than the national average; the winners invariably are those fielded by established political clans. While the Bangsamoro Basic Law (BBL) has yet to be enacted, the future electoral horizon for the Bangsamoro region is projected to do at least three things: (1) accommodate the entry of the MILF as a democratic political player via its own political party; (2) lessen the influence of clans and national parties/establishment/administration on regional electoral outcomes by dispersing power; and (3) provide fertile ground for the development of “principled regional political parties”. The MILF’s transformation from an armed group to a political party that contests formal elections is seen as crucial if peace to be sustained in the region. Partisan activities present promising civilian life-pathways for former MILF combatants. For the Moro National Liberation Front, the new electoral rules under the proposed Bangsamoro Parliament is also an open opportunity for collective participation in electoral politics. UBJP and BWUP were deliberately created by MILF and MNLF leaders as platforms for espousing their political programs of governance, equality and identity. BWUP has a distinctive women’s agenda in its platform; while UBJP offers a broader appeal, inclusive of men, women, Muslims, Christians and Lumads. Currently, both are focused on building their constituency among those that have provided the backbone for the armed movements since their inception. The “mass base” for the two parties are differentiated: while BWUP draws from MNLF women in the federation of cooperatives and NGO network from peace and development projects for the past two decades, UBJP draws from the MILF campcommunities, with members of the MILF Social Welfare Committee as crucial lynchpin for important groundwork (i.e. voter registration). Of the two, UBJP has a much more concrete constituency-building activities targeting volunteers and voter registration. UBJP’s institution building efforts are much more articulated than the BWUP which is hampered by seeming looseness of organization and logistical challenges. Both parties have not yet come up with a definitive nomination procedure but they offer contrary views as to their openness to recruiting more women to run for office and supporting them to win. Because BWUP envisions itself as a woman’s party at this point, all their candidates would be women and they will be open to supporting like-minded female candidates outside of the party. UBJP, meanwhile sees the proposition for a voluntary gender quota counter-intuitive noting that few MILF women as yet have the requisite capability/skill to be candidates. Determining the nominee list and rank will likely Asea Uninet Scientific and Plenary Meeting 2016 | 659 put more weight to regional and ethnic balance, rather than gender. They also see the party as primary vehicle for demobilised BIAF male combatants. While BWUP party leaders do not see any reservations to fielding women candidates (apart from pragmatic considerations of winnability), UBJP leaders are more articulate about presumed limitations to having women as Chief Minister or equivalent executive positions. As to their prospects of competing against powerful clans, BWUP and UBJP proffer different strategies: UBJP is banking on the new electoral rules under the proposed (agreed version) of the BBL whereby party and sectoral seats combined comprise the majority over district seats and where an independent, more neutral Bangsamoro Elections Office can reduce clan influence in the parliament. UBJP plans not to contest local elections at all, but BWUP plans to do so for local legislative positions not particularly coveted by clans. BWUP is optimistic about the added value to linking up with national parties while UBJP at this point is lukewarm on the idea. There is a great deal of convergence of ideas between women party activists, incumbent Moro women politicians, and male MILF and MNLF leaders on parties, women’s role in politics and their limits. MNLF male leaders welcome the creation of an all women’s party as such is logical continuation of their women’s role inside the movement. MNLF women have always had a seat to the Central Committee, were trained as combatants like their male counterparts and were at the forefront of many development projects post-1996. However, male leaders are not confident that the supposed “women mass base” will deliver the votes for BWUP. Similarly, MILF leaders see UBJP as an important stage in MILF’s political struggle but at the same time cognisant of the realpolitik of clan dominance in the region. They are more confident that their communities in general will ultimately vote for UBJP candidates. The MNLF and MILF male leaders both recognise the contributions of women in their organization towards their respective political projects, but at the same time express reservations (couched in cultural terms) about the women’s suitability for executive positions and general lack of readiness to take on the challenging tasks of running for office. Women party activitists and incumbent women politicians meanwhile see these matters more in pragmatic terms. Political parties offer marginal benefits to local candidacies, compared to clan support. Therefore, the only reservations for women in term of seeking elective positions is their competitiveness against clan-endorsed candidates or in the case of incumbent women officials, if they have clan support in the first place. The women see more agency in their actions that what the male leaders recognize. 5 CONCLUSIONS AND SUGGESTION The BWUP and UBJP as regional party formations have an articulated gender agenda in their structure, incipient rules on membership recruitment and resource mobilisation, and projected candidate nomination procedure. Both parties also strongly rely on their civil society network of women (cooperatives; MILF Bangsamoro Social Welfare Committee) as their backbone for voter mobilisation. BWUP has a more clearly articulated gender agenda in its public education and interest aggregration activities, although much of the activities are as yet at a 660 | Asea Uninet Scientific and Plenary Meeting 2016 premature stage. BWUP aims to inculcate Muslim-culture convergent principles among their candidates-nominees and mass base through their voter’s education. While their women’s agenda is clear, their version of a voter’s education preclude discussion about the context of women’s participation— reserve seats, party list representation in the Bangsamoro Parliament. UBJP has no specific women’s agenda in its platform and voter’s education thrust. Their appeal is more geared towards Bangsamoro identity which as understood incorporates those of Muslim women within the ambit of their assumed importance as a sector. UBJP emphasizes “big picture” context— BBL, Bangsamoro Parliament, reserve seats, party list system- in their voter’s education and interest aggregation strategies. UBJP is at the further stage of party structure development with its roster of volunteers, local chapter presence in the core areas and concrete strategy for voter mobilisation within a projected 2 year timetable. By contrast, BWUP appears loosely organised and as yet weak ground presence in the island provinces. A more formal link exists between UBJP and its principals as their formation and party rules are sanctioned by the MILF Central Committee, compared to BWUP. which has no formal “principals” given the divided status of the MNLF leadership. Women party activists and male MNLF and MILF leaders agree on the limits posed by cultural assumptions/Central Committee directive on legislative but not executive positions where women can be nominated and only as last resort if qualified males are unavailable. The stasis in the proposed BBL before Congress and the electoral rules contained in it has created a wave of uncertainty to these regional party formations. Because the electoral rules determine to a large extent winners and losers in the elections game, it is important that they be legitimately established, i.e. acceptable to the MILF, MNLF and local power holders. Under the current ARMM dispensation, there is no chance for these incipient political parties to win seats in the single-member district, FPTP rules in the Regional Assembly, the governorship and the vice-governorship. With a change in the rules of the game and a new incentive structure, BWUP and UBJP have more room to evolve into political parties of substance where national parties failed. There remains hope for party formation in the Bangsamoro region because political parties are key ingredients to a stable power-sharing scheme and to a better guarantee for armed groups to switch their struggle in the electoral arena. For future research direction, the paper suggests a study of the party formations once the BBL has been passed and the first round of BPE elections completed. How women are integrated into party decision making and nomination mechanisms are expected to vary once election rules are more concrete and put to test. REFERENCES Aguilar, C. (1993). Women in Politics in the Philippines. In Latika Padgaonkar. Women and Politics. RUSHSAP Series on Monographs and Occasional Paper, 36. Bangkok. UNESCO Principal Office for Asia and the Pacific. Asea Uninet Scientific and Plenary Meeting 2016 | 661 Arguillas, C. Mindanawon women in power: from 11.5% to 28.8% in 25 years. Mindanews. 09 June 2013. Retrieved from http://www.mindanews.com/governance/2013/06/09/mindanawonwomen-in-power-from-11-5-to-28-8-in-25-years/. Brecht-Drouart, B. (2015). The influence of national question on gender issues in the Muslim areas of the southern Philippines: Maranao Muslim women between retraditionalization and Islamic resurgence. In Huma AhmedGhosh. Contesting Feminisms: Gender and Islam in Asia. Albany: SUNY Press. pp. 89-114. Co, E,, R. L. Fernan III,, M. F. L. Diola,, A.Rasul,, M. K. Sadain,, A. A. Latiph,, R. C. Guiam,, B. R. Bacani and R. N. Montes Jr. (2013). State of Local Democracy in the Autonomous Region in Muslim Mindanao (SoLD ARMM). National College of Public Administration and Governance,University of the Philippines Diliman (UP-NCPAG) and the Philippine Center for Islam and Democracy (PCID). Hutchcroft, P. and Rocamora, J. (2003) Strong Demands and Weak Institutions: The Origins and Evolution of the Democratic Deficit in the Philippines. Journal of East Asian Studies 3. 259–292. Ilagan, K. A. (2013). The ties that bind. Philippine Center for Investigative Journalism. 10 April 2013. Retrieved from http://pcij.org/stories/the-tiesthat-bind/ Lingao, E. (2013). The clan politics of ARMM Ampatuans, web of kin warp Maguindanao polls. Philippine Center for Investigative Journalism. Retrieved from http://www.ombudsman.gov.ph/UNDP4/wp-content/uploads/2013/06/PCIJ-2012Clan-Politics-of-ARMM.pdf. Manacsa, R.C. and Tan, A. (2005) Manufacturing Parties: Re-examining the Transient Nature of Philippine Political Parties. Party Politics 11 (6), 748– 765. Sidel, John. 2014. Achieving Reforms in Oligarchical Democracies: The Role of Leadership and Coalitions in the Philippines. Developmental Leadership program Research Paper 27.University of Birmingham, UK. Teehankee, J. 2006. Consolidation or crisis of clientilistic democracy: The 2004 synchronised elections in the Philippines. In Aurel Croissant and Beate Martin eds. Between Consolidation and Crisis: Elections and Democracies in Five Nations in Southeast Asia. Lit Verlag. 662 | Asea Uninet Scientific and Plenary Meeting 2016 van Biezen, I. and P. Kopecky´. 2007. The State and the Parties: Public Funding, Public Regulation and Rent-Seeking in Contemporary Democracies. Party Politics 13 (2), 235–254. Veneracion-Rallonza. L. 2008. Women and the Democracy Project: A Feminist Take on Women’s Political Participation in the Philippines. In Kazuki Iwanaga ed. Women’s Political Participation and Representation in Southeast Asia: Obstacles and Challenges. Copenhagen: NIAS Press. THE DYNAMICS TRI NING TRI ECOTOURISM IN BALI PROBLEMS AND STRATEGIES IN THE DEVELOPMENT OF THREE ECOTOURISM TYPES IN BALI I Nyoman Sukma Arida Tourism Faculty, University of Udayana, Bali Abstract This study is aimed at mapping the dynamic process in the development of ecotourism in Bali. Its objectives are 1) to identify and analyze typologies of ecotourism in Bali, 2) to analyze each type of ecotourism, focusing on the aspects of ecotourism products, local community involvement, and its development strategy, and 3) to analyze and formulate appropriate model of ecotourism development in Bali. This is a descritive qualitative research with relevant data acquisition techniques, namely (a) in-depth interview, (b) field observation, (c) Focus Group Discussion (FGD), and (d) document studies. The four methods were used to capture the needs of data in the field, in accordance with scope of the problem investigated and research objectives.This study found that ecotourism typology in Bali, in terms of its main moving actors (agent of change), is divided into three, namely: (1) investor-driven ecotourism (investor type), (2) community-driven ecotourism (community type), and (3) governmentdriven ecotourism (government type). This three-type ecotourism in Bali is also known as tri ning tri. In practice, each type of ecotourism has different level of conformity with ecotourism principles (TIES, 2000), so that they can be categorized into three groups, which are major (utama), intermediate (madya) and contemptible (nista). Some particular Balinese life stances such as rwa bhineda (dualism), paduwen sareng (common ownership), dan nempahang rage (self devotion) enable the different types of ecotourism to live and develop side by side harmonically in Bali, without negating each other. Through observation in the micro level, this study found that the characteristic of each type tends to shift into hybrid type due to, among others, close interaction with different kinds of stake holders. This also means that the type of ecotourism developed in a village, for example, will most likely to be modified or improvised in such a way to accommodate the available resource potency and characteristic of stakeholders involved on its development or management. The ability to manage all forms of ecotourism, which mainly come from outside of Bali, is then combined by Balinese with their life stance of rwa bhineda. Therefore, any ecotourism type or model that comes into, enters and develops in Bali, eventually transforms into a new type of ecotourism. Keywords: ecotourism, tri ning tri, local community Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 663 664 | Asea Uninet Scientific and Plenary Meeting 2016 1 1.1 INTRODUCTION Background Several phenomenaoccurred as the result of tourism development of Bali, whichstrongly tend to be mass tourism. It is not only the number of tourists, but also provided tourism infrastructure, tourist behavior, as well as activities taken by tourists in Bali clearly represent mass tourism (Picard, 2006). In addition, government policy factor indesignating Bali as main tourism destination plays important role in this regard. In order to drive tourism development, Government always-targetingbig numbers of tourists visit asa reflection of success. Accommodation facilities in such, both five-star rated hotel and non – star,or luxury resorts owned by foreign investors are continually built without taking into account Bali’s capacity. It is reflected in the increase number of tourism investment inBali, Provincial Investment Board (BPMP) of Bali Province noted 7 trillion Rupiah of investment in 2010, in which 80 percent is on tourism sector. Other data shows that in 2009, the recorded number of hotel rooms is 18,684 units and additional 21,775 units of non star hotel rooms (BPS, 2011). Whereas, the number of hotel rooms in Bali, both star rated and non – star, in 2010 had reached 45,557 rooms. It can be assumed that the average area of land used for 1 unit room is 25 m2,so then the total land area occupied hotel rooms reached 113.89 hectares. Massive growth in tourism investment can be clearly seen in the drastic change of its landscape. The coastal areas, riparian areas, hills and mountains and even forest that serves as water catchment area were also targeted as construction location for tourism facilities. Rapid change in land function, is not only a serious threat to the existence of farmers who have been long depended on rice farm, but it also cause changes in the job choices which might creates unemployment (Sutawan, 1997). In the context of developing tourism destinations, this condition potentially change Bali’s image that isfar from the values of cultural tourism. In fact, in Bali, the social cultural life and tourism are two things that cannot be separated. Socio-cultural component is the main capital in the development of tourism in Bali. In that components, agrarian culture embodied in form of DesaPakraman (formerly called as DesaAdat-traditional village) and Subak, Balinese irrigation system, in which both serve as the main pillar to support the existing socio-cultural structures. It means that the key success factor of tourism development in Bali is in the sustainability of those two institutions. Ideally, the development of tourism in Bali should be directed to be able to create a pattern of mutually beneficial relationship (symbiotic - mutualistic) between elements of DesaPakraman and tourism industry. Thus tourism is expected to become a part of life and has meaning / benefits to the local community that is DesaPakraman (Timothy and Boyd, 2003). In the midst of this circumstance, some people tried to stay optimistic with design patterns of tourism product development that close to the principles of cultural tourism. They develop tourism products, which based on ecotourism in several potential villages. Although this is pilot project (pioneer), the development of ecotourism tries to apply the principles of ecotourism asimplementation of sustainable tourism development. Based on the background explained, this study intends to map the situation and condition in terms of the changing process that occurs in the development of ecotourism in Bali. The study is focused at two important aspects, namely ecotourism product and process of community involvement aspect. Thru this, it is expected that typology of different types of ecotourism products as well as a model of synergy that can be built between each typology can be established. Asea Uninet Scientific and Plenary Meeting 2016 1.2 | 665 Research Problems Based on the background above, the research problems are formulated as follows: How do the types of ecotourism grow in Bali viewed from the driving aspect of ecotourism? How is the development of each type of ecotourism, particularly in terms of ,productalso in the process of involvinglocal communities? And, how is the development strategy on each types of ecotourism? 1.3 Research Benefits Theoretically, this research is expected to provide new ideas related to ecotourism phenomenon in the country, particularly in the context of tourism in Bali. Currently, there are many foreign researchers that study about Bali and discover new theories, especially in the field of social sciences. As a relatively new branch of science, tourism still open a very wide opportunities to developnew theories. Therefore, this study is expected to be one pillar in the efforts of developing tourism theory that appropriate to local context. Practically, this study attempts to find a solution in the emergence of various ecotourism attractions in Bali. The results of this study is expected to produce a synergy model, which is needed among those various typologies of eco-tourism, so it can be translated in form of useful policies to manage different types of existing attractions in order to be complementary but not mutually exclusive. 2 2.1 LITERATURE REVIEW Understanding Ecotourism In the history of ecotourism development, the term itself experience dialecticdefinition, by not ignoring the substance of promoting pro local people. One of thedefinition is given by Ecotourism Society, a non-profit organization that was declared in Vermont, that highly concern on ecotourism (Ceballos – Lacuarin, 1987). These non government organization (NGO) define ecotourism as "Responsible travel to the natural areas that conserves the environment and sustains the well being of local people", or like HectorCebalosLascuarin (1987 in Boo, 1991) stated ecotourism as "Traveling to undisturbed areas or uncontaminated natural areas with a specific objective of studying, admiring and enjoying the scenery and its wild plants and animals." The concept then reemphasized by David Western (1987) who states: ecotourism is an activity that responsible for natural preservation. Ecotourism should be able to create and satisfy nature, by conserving, preserving ecology, and involving active participation of tourists in each stage of development and construction. Not too different with the concepts explained above, The International Ecotourism Society (2002), specify the definition into: ecotourism is a form of travel that is responsible for natural areas, in which it is done with the aim of conserving the environment and preserving the lives and well-being of local residents.Responsibility and sustainability aspects were further emphasized by Fennel (1999:43) by putting ecotourism, as a nature based tourism activities, which is sustainable, specially managed, and give positive impact to environment, local-oriented, non- consumptive, and focus on the experience and education of nature. 2.2 Typology The American Heritage Dictionary describes the notion of typology as, 'The study or systematic classification of types that have characteristics or traits in common'. Thus, typology is the study or systematic classification of types that have similar characteristics 666 | Asea Uninet Scientific and Plenary Meeting 2016 or qualities. Furthermore, Waddock (1989) proposed a more operational definition of typology. He formulated the notion of typology as 'An organizational model that systematically illustrates the different and similarities of various social phenomena in relation to certain attributes' (Waddock , 1989 via Selin : 263). This concept will be used in this research. Typology is useful for further development of a tourism destination, as revealed by Gee, Powers, and Mansfeld. Understanding tourist typology based on origin country and region, gender, age, social class, economy power, culture, and climate, becomes important in the context of creating image of a destination (Gee, 1997). In addition to this, typology is also useful to know the traffic patterns, motivations, and impact to promotion and marketing strategies (Hsuand Powers, 2002). Thus, tourist typology in this context can be an effective planning instrument, also as a practical guide for identifying the spatial impact, benchmark of growth, and instruments in formulating tourism policy (Mansfeld, 1992). In line with the explanation, it is predicted that forming a typology for ecotourism will yield same benefits. Among various types of ecotourism typology application in various studies, there is one common thread that can be learned, that is the forming of typology was made by examining more on tourist activity aspect. This can be seen in a study conducted by Weaver (2001), Lindberg (1991), and the formulation of Queensland ecotourism (1995). Selin (1999) formulates typology, which slightly different, that is by observingavailable patterns of cooperation in various areas within a destination. From the results of previous studies, it can be concluded that no study has been conducted to find out the driver of ecotourism development. Therefore, this study tries to form ecotourism typology for Bali by observe and examine various aspects that drive the development of ecotourism, that it becomes an important alternative which is necessary to be developed. 3 METHODS This research is a descriptive qualitative research. In accordance with qualitative approach and theory chosen in this study, the data collection tends to be descriptive and not in form of tabulation like in the quantitative approach. The technique in collecting data is relevance to the approach and the theoretical framework, in which there are four methods, namely: (a) in-depth interview, (b) observations (field observations), (c) focus group discussions (FGD), and (d)literature study. This study applies those methods to capture the needs of data in the field, in accordance with the scope of problems and research objectives. Firstly is an in-depth interview. In-depth interview was conducted with key informants and ordinary informants from government, community leaders, religious leaders, traditional leaders, intellectuals, ecotourism operator, and other ecotourism stakeholders. It was conducted based on the guidelines of research interview, in form of dialogue, and flexible with improvisation. Secondly is field observation, which is carried out to have a general overview of ecotourism typology in the research area, particularly seeing the infrastructure components as require by sociocultural evolution theory. Third method is focus group discussions (FGDs). FGDs were conducted collectively in order to obtain and record the views local community, which were represented by intellectual people of the village or those who have direct experience with ecotourism management. The forth is literature study. Literature study is intended to gain an understanding of some basic concepts related to this study, they are: sustainable tourism, ecotourism theory, typology concept, community involvement, and ecotourism products. This study is also intended to obtain information about previous research on the same field done byexperts. Asea Uninet Scientific and Plenary Meeting 2016 4 4.1 | 667 RESULTS AND DISCUSSION Typology of Ecotourism This study succeed in identifying 42 Directed Tourism Destination(DTD) which can beclassified as ecotourism. Each DTD has potency, various attractions, and segmentedmarket; furthermore its levels of development vary in accordance with their characteristics. Through a simple instrument in the form of a simple questionnaire, those 42 DTD classified into groups or specific types according to their characteristics. Matrix 1 Ecotourism Typology in Bali Type of ecotourism (1) Investor Type (Elephant Safari Park, Bali Zoo Park, Bali Bird Park, Bakas Safari, Bali Safari and Marine Park) (2) GovernmentType (Taman Nasional Bali Barat, Kebun Raya Bedugul, DesaBaha, Pangsan, Penglipuran, Bayunggede) (3) Community Type (Monkey Forest, BurungKokokan, JED (Dukuh,Sibetan, Ceningan,Tenganan,Plaga), Ecotourism Type and Product Community Operational Involvement Managements Pattern Tourist Characteristic Park Horseback endangered species Beach tourism Rafting Natural panorama Rural tourism; Short visit to village(Sight seeing). Actor: foreign and domestic investor Lame corporation model. Low participation of local community Sharing economic profits to Banjar Casual / popular Soft activity Joint cooperation of village and local government Community represented by Banjar Fully managed by local community: primary coorperation and Banjar. Low-medium Casual/ participation popular of local Soft actifity community Active Banjar Active with local community, tracking, hiking, Bird watching High participation of local community Participatory pattern: training, workshop. Popular Small group Hard activity Source: Field Data Analysis (2012-2013), and literature study on the research of Weaver, (2001); Lindberg, (1991); Queensland, (1995), and Selin, (1999). Some aspects which were explored and collected, among others are: (1) the form and type of attractions to be marketed; (2) the initiator and management of ecotourism, (3) local communities involvement in the planning and management, control over resources, accommodated as workers, and the profits that can be enjoyed by the community, and (4) the role of government in each stage of the process. Optimum result that can be achieved from this process is illustrated in Matrix 1. From the above findings it appears that the typology of ecotourism Bali in terms of main actors (agents of change) as well as management operation can be divided into 668 | Asea Uninet Scientific and Plenary Meeting 2016 three, they are: (1) ecotourism driven by investor (Investor type), (2) ecotourism driven by community (Participatory type), and (3) ecotourism driven by government (government type). Beloware the characteristics of each type of ecotourism in Bali. 4.1.1 Investor-type (BanjarKaja Taro and Bali Elephant Park) Investor type ecotourism means that the planning and development process are conducted by the capital-owner and the main goal is to get profit from the business side. As its goal is business interests, ecotourism is only used as label to form a good image. When global discourse filled with environmental issues, including in the tourism sector (green tourism), then this environmental issues are also used by the some capital owners to expand its business. It then can be seen in the rise of various forms of tourism, which call themselves as ecotourism or green tourism. The main characteristic is dominant role of capital owner, which are originated outside the region, or even from abroad, in managing ecotourism. Capital is an important factor in controllingthe operations of ecotourism, starts fromthe planning, management, up till the profit share. With capital accumulation, entrepreneur in eco tourism runs their business in order to make profits in targeted period. In accordance with the nature of capital, investor type will always set financial profit as their main goal. 4.1.2 Government Type (Pengelipuran village, Bangli) Government type ecotourism is characterized by the role and intervention of government in the development of ecotourism in a village. Government intervention in this case, is represented by the Tourism Department with 'rural tourism development' label. Villages were developed as rural tourism, which commonly has large culture and nature potency. This type of ecotourism has a distinct character in its development strategy, among others; relying on the dominant role of government, tend to be a duplication, small scale, and marginalize the role of local community. Strong role of government is the main characteristic as government, in this case is the tourism department, initiated and developed ecotourism. Governments play an important role to mobilize all available resources to promote the establishment of eco-tourism (rural tourism) in a village. Thus ecotourism program is top down from top to bottom, instructional, with minimal participation. Ecotourism villages that belong to government type rely on its landscape and richness in culture as the main attraction and products. Several villages in the central mountainous region of Baliagethat have cultural treasures 'original Balinese' promoted intensively by some local government as they believe it can be a magnetic tourist attraction. These villages have a distinctive settlement pattern and customs that reflect the uniqueness of their culture. Some villages depend on agriculture, the Subak with all of its trimmings. However, unlikecommunity type village, which commonly succeed in exploring its uniqueness then packed into an attraction, government type village is rarely able to find its potencyused as product branding. The potencyof bamboo forest in Penglipuran, Bangli, for example, cannot be maximized as tourism product, whereas it can support the development of ecotourism in this village. This is similarly occur in other villages in other regencies, such as Pinge village, Tabanan ;Lodtunduh village, Gianyar ; and Baha village, Badung. These villages are predicted to become rural tourism village based on agriculture, but ' failed ' in pursedthe brand to be more specific so it can fully belong to the village. 4.1.3 CommunityType (BanjarDukuh ,Sibetan , Karangasem) Ecotourism which is initiated and managed andfully under thecontrol of local community, is classified as community type ecotourism (grass roots).Local community, either independently or with external assistance (leaders or NGOs), took the initiative to establish and develop ecotourism based on their own natural resources. The development of Asea Uninet Scientific and Plenary Meeting 2016 | 669 community type ecotourism will naturally follow the stages of local community understanding. Community type ecotourism has some distinctive character in its development strategy, among others; involves local community maximally, covers small-scale in form of attraction and capital, and networking. The most striking feature of community type ecotourism is the high level of community involvement in managing ecotourism. In some cases, local community even acts as active participant by using traditional institutions like banjar ,sekehe, and subak. In some cases ~ for example on Village Ecotourism Network (VEN) ~ community involvement is formed due to the intervention from outside parties such as Non Governmental Organizations (NGOs). But in someearlier ecotourism villages, community involvement emerges naturally and independently, triggered by one or several village’s figures (case examples are in Munduk, Tabanan and Kemenuh Village, Sukawati). Furthermore, people seek the development and management of ecotourism to be selfreliance, spontaneous, and self-management. The phenomenon can be seen in natural attraction of WanaVanara or the monkey forest, in PadangTegal village, Ubud; Kokokanbirds, in Petuluvillage, Ubud; the monkey natural tourist attraction, in Sangeh, Badung. The purpose in the development of ecotourism does not solely at gaining financial profits. In other words, at least most people realize that what they are doing through ecotourism is not to gain fast and instant financial profits. In the construction of a more public awareness, thus people then associate ecotourism as an instrument to identify and explore its resources and pack it into a tourist product. It can be said that business is less concerned in the development of ecotourism. Instead of develops it professionally that must fulfill business interest. 4.2 Ecotourism Development Strategy In developing ecotourism, these three village types apply different according to the context of the problems faced (Matrix 2). Chosen strategies pursued are necessarily related to the community empowerment models and development of ecotourism product in each village. In some dimension,chosen strategy adopted similar patterns. Some of the similarities, aresuch as: using village as main attraction, use institution like banjaras an instrument while negotiates with outside parties, build network with multiple stakeholders, and develop promotional and information via internet.Overall, those strategies are used to accelerate all local tourism resources in order to achieve prosperity through tourism development. Matrix 2. Comparison of Development Strategy in Three Village Types of Ecotourism Village StrategiPengembanganEkowisata Taro (Investor Type) Corporate with big investors Use strong cultural patronage relation with the Ubud figure who was also the Regent of Gianyar Use the power of BanjarAdat in negotiating with investor Use temple as a consolidation symbol in utilizing the profit of ecotourism Internet based in promoting ecotourism product Corporate with local government (local tourism department) in developing ecotourism Participating in various tourism contest to promote ecotourism Penglipuran (Government Type) 670 | Asea Uninet Scientific and Plenary Meeting 2016 Dukuh,Sibetan (Participatory Type) Utilize the Banjaron ecotourism management Use travel agent service to get tourist visit Utilize temple as ecotourism icon Corporate with NGOs Develop tour packages based on the potency of village Formulating spatial village as a means to preserve the integrity function of Banjararea Form primary cooperation in Banjarto manage ecotourism Use the influence and power of Banjarin developing ecotourism Build network with other villages in a forum like VEN and Bali DWE. Source: Survey and field interview(2012-2013) 4.2.1 Three Patterned Ecotourism From the typology and strategies applied on each case of ecotourism, it can be known that there is a connection among them. The connection is in form of 'all in three' on each types of ecotourism in Bali, namely: investor (private), community, and government type (see Matrix 1). “All in three” pattern appears at the macro level (island / province) and micro, namely ecotourism village level. In local terminology (Balinese), this “all in three” pattern known as tri ningtri, thereforethe emergence of “all in three” in the development of ecotourism in Bali should also named as tri ning tri. This study then confirms that the pattern of tri ning triecotourism can be found in every parts of Bali island; South Bali, Central Bali (mountains), and North Bali79. Other studies also reveal that the presence of ecotourism in a region or location should be supported by at least these three components, they are; local community as the owner and custodian of the region, investor/privatesector (local, national, or global) as party that will support the funding, and government as the authorityto issued license to facilitate tourism businesses and tourism development. It turns that the “all in three” concept does not only emerge in the spreading pattern of ecotourism at macro level in Bali, but it also infiltrates into aspects of life, like the most subtle thing of Balinese people, their ways of thinking and believes, in addition, in this study this is represented in form of the three types of ecotourism village. In Balinese terminology, 'all in three' pattern is called tri ning tri (all in four pattern is called kanda pat). Starting from this background concept then, this study named ecotourism pattern of Bali as tri ning tri ecotourism, a pattern of ecotourism that always has a tendency to be divided into three. Tri ning tri ecotourism is a typical authentic ecotourism of Bali. In the context of research findings;the three types of ecotourism can also be sorted according to the understanding framework of Balinese people, that is the concept of Tri Mandala (Matrix 3). The matrix shows that Bali’s ecotourism can be understood as a tiered grouping based onits quality,start with the lowest, medium, and highest level. In this case, quality is determined by level of compliance in fulfilling the principles of ecotourism TIES. Based on qualitative assessment, investor type is regarded as nista (harsh) ecotourism, government type belongs to madya(middle) ecotourism, and community type is included to utama(main) ecotourism. 79 Among social scientists, particularly anthropologists, Bali is divided into 3 socio-culturalunits which is done so. Example can be seen in the study or writing by Cliford Geertz, Reuter, Bateson, Picard, and many others. Asea Uninet Scientific and Plenary Meeting 2016 | 671 Matrik 3Tri ning Tri Ecotourism in the Local Understanding Framework of ‘Tri Mandala’ ‘Tri Mandala’ aspects Item Bali’scosmology meaning Implementation of village hall setting Implementation in zoningruralareas Implementation in ecotourism management Implementation in Tri Ning Tri model Utama (main) Mandala Madya (middle) Mandala Nista (harsh) Mandala Parahyangan Head (Tri angga) Upstream, sacred Kahyangantiga( desa, villagepuseh,an ddalem), dadiatemple, subaktemple, panguluncarik, catuspata, pempatanagung springs, ponds, hauntedareas, ravine (pangkung), bengang, dll. Pure conservation zone (protection zone): As a conservation area for variousplants and animals. Touristunable to accessthis area. Banjar style management Pawongan Body Middle (transition) Palemahan Foot Teben (downstream),Pr ofan Settlement (karangdesa, karangpaumaha n), schools, markets, roads, halls, banjar hall, and plaza. Communitytype Rice fields, drylands (abian),ceme teries (setra), rivers, lakes, empelan, karangsuwun g, karangbenga ng. Village/ Banjar that apply All three villages Limited Use Zone (transition zone): Tourist can cross this area for ecotourismac tivities under certainrules. Utilization Zone pemanfaatan: The areaisusedas location for accomodation and othersupportingf acilities. BanjarDuk uh, Sibetan Government style management Governmentt ype Private style management DesaPengli puran Investor type BanjarDuk uh DesaPengli puran 672 | Asea Uninet Scientific and Plenary Meeting 2016 Banjar Taro Kaja Source: Primary Data Analysis (2012) This brings to the nextquestion of; why the formed pattern tendsto be “all in three”? If referring to the way of thinking and the beliefof Balinese people, then their conformity can be found. It turns out thatBalinese people have been accustomed to think or referring to a“all in three” concept either individually or collectively80. The example is like the familiarity of Balinese people in understanding the moral spirit of any “all in three” concept, such as tri kaya parisudha(manacika, wacika ,kayikathe concept of think good, speak good, and act good), tri kahyangan (Puseh temple, bale agung, dalem), tri murtithree Gods in Hinduism (Brahma, Vishnu, Shiva) , tri mandala (utama, madya, nista), tri angga (head, body, feet) , tri hitakarana (parahyangan, pawongan, palemahan), tri samaya (atita, Nagata, wartamana), tri rna (God, Rsi, Pitra), tri saksi-three witnesses (God witness, human witnesses, teacher witnesses) and others . Thus, according to the system of beliefs, at the empirical level, Balinese people will divide and manage their lives into three parts, the utama(main part) consisting of worship building, madya(middle part) consisting of residential buildings, and nista(downstream/teben) in which it is a space to dispose and manage waste, raising cattle, and drying laundry. 4.2.2 RwaBhineda in PeduwenSareng Based on the local spatial arrangement concept (tri mandala), local community in those three villages were then translate it into local wisdom which are also very operational, namely the concept of rwabhineda81, paduwensareng82 , and nempahangraga83 . Rwabhinedaguides people to always accept the presence of good and bad side,as a reality in life that any elements will definitely have functional value, therefore as cultured human, people must show respect to nature. So people will feel that anything owned by nature also belong to them that it is regarded as community property (druwenangsareng). As people realize that nature has given all resources, tit will be utilized wisely; in example use without reducing its functionality value. Adequacy of their daily lives is always measured with a threshold of ecological environment (carrying capacity). In order to determine the threshold, people should always do positioning (nempahang raga), by concerning the extent to which their activities have disturbed or interfered the existence of natural living space, social, and culture as their habitat. When it is drawn into a wider scopethat is regional scope (island), the application of rwabhinedaconcept and paduwensareng lead to a deeper meaning, that the three types of ecotourism have different characteristics, furthermore contradictory (for example 80 Research finding of Bali Tourism Branding Team which was appointed by Bali Tourism Department in 2005, found that Balinese favorite number is “three” and the most frequently used form in the culture-expression is triangle. This then emerging the draft symbolof Bali Tourism with Bali Shanti ShantiShantias its tagline and use triangle-based form as its base. 81 Rwabhineda means everything has a good and bad side, both are useful both in sustaining social systems. 82 Paduwensareng is the concept of life, a sense of owning together everything regarded as community property, both physical and non-physical. 83 Nempahang rage is the concept of life by positioning ourselves in certain situation and condition. Asea Uninet Scientific and Plenary Meeting 2016 | 673 investor type with big scale will be contrary to community type with small -scale), but all three types of ecotourism can still be alive and develop based on its own track in Bali. It means that each ecotourism type has its own path to develop themselves, and not omitting each other. Each can grow and develop at the placeeven with limited natural resources as each has targetedtheir own market(due to different characteristics of the “segmented” travelers). 5 CONCLUSION AND REFLECTION Bali is a small island with limited natural resources as paduwensareng(community property), so it has to be protected and used wisely in order to be sustainable. This condition leads and realized by ecotourism operator in Bali, of any ecotourism type, should extend and practicethe duwenangsarenglifestyle in utilizing the natural resources of Bali. To make ecotourism sustain in its development, its habitat that is Bali Islandhas to be taken care and maintained together. The attitude of duwenangsareng leads ecotourism operator and related stakeholders to the second concept of nempahang rage (aware with position). In the operation of each ecotourism type, should always do positioning,by reviewing its standing point in order not to raise conflict withothers. Community type ecotourism should set development strategies according to its characteristics as well its targeted market segment. It should not behave developed like investor type which covers large scale. Similarly to government type ecotourism that should always be aware of its role in the business development, by not pretending to be another type of ecotourism. In short, any type of ecotourism has a position, a choice and their respective roles, which, if it is denied will becounterproductive, even backfired to its sustainability. Those two conceptions and practices of empirical attitude makeany type of ecotourism in Bali can grow together, supporting each other mutually, and not stuck in unhealthy competition. Incertain situations, competition does happen, however this is a commonplace in business. But empirically, these three types of ecotourism still exist and flourish in Bali up till now. This condition illustrates that they all can live together in Bali despite having different character (rwabhineda). In the rwabhineda concept,the good and bad can be received and lives in harmony. Similarly to empirical reality in the development of ecotourism, in which each type has both good and bad quality in a very diverse range of scales, but all of them can stay in its own “track”respectively. The results of this study confirm a formulation of Bali’s ecotourism,which is tri ning tri and engaged in a pattern of collective attitudes of peduwensareng. Tri ning tri ecotourism shouldmanage as an eco ~ spiritual; ecotourism is not only aimed at conserving physical environment, but far beyond that, it also has to be able to appreciate local culture, and consider the non ~ physical environment, including the spiritual environment, so it can provide new insights for eco ~ tourist and local community once doing ecotourism activities. People’s view of traveling will be no longer regard this just asa process of fulfilling desire to have fun, but rather a process of 'uniting' themselves with nature by trying to become part of the environment in order to achieve life balance. 674 | Asea Uninet Scientific and Plenary Meeting 2016 BIBLIOGRAPHY Arida, N.S. , 2009,Meretas Jalan Ekowisata Bali, Denpasar: Udayana Press. Arida,N.S., 2008, Problematik Pengembangan Ekowisata di Banjar Kiadan, Desa Pelaga, Kec.Petang, Kabupaten Badung, Provinsi Bali, Tesis: Universitas Udayana. Arida, N.S danDamanik, J., 2012, ProblemaPerkembangan Pseudo-Ekowisata di Bali, JurnalKepariwisataan Indonesia, Vol 7(1): 53-68. Ashrama, B., 2007, PemetaanKondisiObyektifdanImplementasiVisi Pembangunan Bali, dalambukuBali is Bali Forever, Ajeg Bali dalmBingkai Tri Hita Karana, Denpasar: Bali Travel News. Atmaja, Y., I.B., 2002,Ekowisata Rakyat: Lika-Liku Ekowisata di Tenganan, Pelaga, Sibetan dan Nusa Ceningan,Denpasar: Wisnu Press. Baiquni, M., 2002, “IntegrasiEkonomidanEkologi: dariMimpiMenjadiAksi”, Wacana, Volume III, No 12. Baiquni, M, 2007, StrategiPenghidupan di MasaKrisis, BelajardariDesa, Yogyakarta: Ideas Media. Boo, E., 1990,Ecotourism: The Potentials and Pitfalls, Washington DC.: World Wildlife Fund. Cochrane, J., 1993, Tourism and Conservation in Indonesia and Malaysia, dalamApproaches to Planning for Rural and Village Tourism Realising The Potential of Rural Areas and Villages, Fagence, M(ed), Bandung: ITB Press. Damanik,J,2013, Pariwisata Indonesia, AntaraPeluangdanTantangan, Yogyakarta: PustakaPelajar. Damanik, J. dan Weber, H.F., 2006,Perencanaan Ekowisata – dari Teori ke Aplikasi, Yogyakarta: Andi Offset. Picard, Michel, 2006, Bali: PariwisataBudayadanBudayaPariwisata, Jakarta: KPG, Forum Jakarta-Paris. Timothy, Dallen J. and Boyd, Stephen W. 2003. Heritage Tourism. Prentice Hall, London. Selin, S.,1996, “ Developing a Typology of Sustainable Tourism Partnerships”,Journal of Travel and Tourism Marketing. Waddock, S.A. ,1989, Understanding SocialPartnerships: An evolutionary Model of PartnershipOrganizations: Administration and Society 21 (1):78–100. Wearing, S.,1997, The Nature of Ecotourism; The Place of Self, Identity and Communities as Interacting Element of Alternative Tourism Experience, Lambert Academic Publishing. Weaver, D. B., 2001, Ecotourism as Mass Tourism: Contradiction or Reality?, Cornell Hotel and Restaurant Administration Quarterly. Western, D., 1997, MemberiBatasanTentangEkotourisme,North Bennington Vermont: Ecotourism Society. Wilson, M., 1987,Nature-Oriented Tourism in Ecuador: Assessment of Industry Structure and Development Needs. FPEI Working Paper No. 20., Research Institute Triangle Park, NC: Southeastern Center for Forest Economic Research. Yoeti, O.A.2000,Ekowisata Pariwisata Berwawasan Lingkungan Hidup, Jakarta: Pt.Pertja. Proceedings Asea Uninet Scientific and Plenary Meeting 2016 ISBN: 978-602-294-097-5 675

Log In

COVER IS HERE

COVER IS HERE

Related Papers

RELATED PAPERS