Next Article in Journal
Effects of Hydrological Drought Periods on Thermal Stability of Brazilian Reservoirs
Previous Article in Journal
Groundwater Circulation in the Shallow Crystalline Aquifer of Tharisa Mine, South Africa: Evidence from Environmental Isotopes and Near-Surface Geophysics
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 15
Issue 16
10.3390/w15162875
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Possible Origin and Distribution of an Invasive Diatom Species, Skeletonema potamos, in Yangtze River Basin (China)

by
Jingwen Hu
1,2,
Zhengxin Yang
1,
Yuxin Yi
1,
Zhaoqing Shu
1,
Pan Yu
1,
Qingmin You
1,* and
Quanxi Wang
1,*
1
College of Life Sciences, Shanghai Normal University, 100 Guilin Rd., Hohhot 200234, China
2
College of Environmental and Geographical Sciences, Shanghai Normal University, 100 Guilin Rd., Hohhot 200234, China
*
Authors to whom correspondence should be addressed.
Water 2023, 15(16), 2875; https://doi.org/10.3390/w15162875
Submission received: 27 June 2023 / Revised: 19 July 2023 / Accepted: 4 August 2023 / Published: 9 August 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
Skeletonema potamos is a freshwater diatom that has been widely distributed in North America, Europe, and Australia since the 1980s. However, there have been few previous reports of S. potamos in China. Only recently has S. potamos been frequently found in our extensive ecological surveys in China, and it has sometimes even been the dominant species. This study clarified the morphology, distribution, and origin of S. potamos, as well as the underlying mechanism contributing to its dominance. We examined the samples collected from the Changjiang River (Yangtze River) Basin during 2016–2022 and determined their geographical distribution. Genetic distance analysis indicated that S. potamos strains in China might have been transported by ships and ballast water from the USA or Japan through the East Sea into the Yangtze River Estuary. Cargo ships possibly contribute to its dispersal. An analysis of the ecological factors affecting the occurrence and distribution of S. potamos in China indicated that many waterbodies provide environments suitable for S. potamos. The suitable environment, small size, and rapid reproduction of S. potamos are the reasons for its dominance in the Yangtze River Basin. We predict that S. potamos is likely to form “blooms” in China in the future.

1. Introduction

Skeletonema is a common coastal diatom genus that contains 13 species, 11 of which have been defined as marine species [1], and two, Skeletonema potamos and Skeletonema subsalsum, as freshwater species [2]. Skeletonema potamos is a poorly known diatom, which is mainly found in freshwater and slightly brackish habitats [3]. It is a common “bloomer” in many Eastern North American rivers and is a good indicator of river health [4].
S. potamos was first discovered in Jensensee, Germany, but it was erroneously thought to be conspecific to Stephanodiscus subsalsus (Cleve) Hustedt [5,6]. In 1970, a description of S. potamos was published, describing the species collected from the Little Miami River (OH, USA) as Microsiphonia potamos Weber [7]. In 1976, Hasle and Evensen placed this species in Skeletonema and ascribed Stephanodiscus subsalsus as a synonym for S. potamos [6,8]. Since then, S. potamos has been found in many rivers and lakes in North America, Europe, and Australia [9].
The records of S. potamos in China are rare. Cheng and Liu (1992) first reported S. potamos in Xiamen Port [10]. Considering its morphological features, it is possible that Skeletonema subsalsum was misidentified as S. potamos due to limited technology. Lin and Yang (2007) studied the phytoplankton diversity of the Taiwan Strait and included S. potamos in the list [11]. However, there have been no additional reports of S. potamos in China in the following ten years. Notably, in our surveys of ecosystem diversity, we found a large population of S. potamos in Dianshan Lake in 2016. Subsequently, we observed that S. potamos is widespread in China and is sometimes a dominant species in the Changjiang River (Yangtze River) Basin. Similarly, S. potamos was detected in the Yangtze River and Tai Lake by Zhang et al. (2022) using an environmental DNA (eDNA) biological monitoring method [12].
These findings inspired us to investigate the distribution of S. potamos in China, the reason for its frequent appearance in China in recent years, its mode of entry and wide distribution within China, and the reasons for its survival and dominance.
In this study, we determined the distribution of S. potamos in China based on our extensive ecological surveys of existing samples from the Yangtze River Basin over the past six years. We observed strains from cultures and field samples and clarified the morphological characteristics of S. potamos. We conducted a literature survey and sample examinations to estimate the global distribution of S. potamos. We also conducted genetic diversity and ecological analyses to determine the origin and underlying mechanisms contributing to the dominance of S. potamos. The goal of this study was to clarify the identification and geographical distribution of S. potamos and identify its possible origin and dispersal mode. We examined the mechanisms contributing to the dominance of S. potamos, providing basic data for future physiological and ecological studies.

2. Materials and Methods

2.1. Sample Examination and Analysis

We examined the presence of S. potamos in samples collected from the Yangtze River Basin during 2016–2022. In each sample containing S. potamos, at least 400 algal units were counted using a 0.1 mL counting chamber at 400× magnification [13,14]. Individual cells were taken as a counting unit. This process was repeated at least three times [15].
Light microscopy (LM) examination was conducted using an Axio Imager A2 microscope (Carl Zeiss Inc., Hallbergmoos, Germany) and a microscope-attached camera (DP72, Olympus, Tokyo, Japan). Samples were treated with concentrated nitric acid using a microwave accelerated reaction system (MARS) (CEM Corporation, Charlotte, NC, USA) and a preprogrammed digestion scheme (temperature, 180 °C; ramp, 15 min; hold, 15 min) [16]. The samples were washed seven times with distilled water to remove the acid and were kept in 95% ethanol. The cleaned diatoms were then mounted on Naphrax® to obtain permanent slides for the LM analysis.
An ultrastructural morphological examination was performed using scanning electron microscopy (SEM).(Tokyo, Japan) Cleaned specimens were air-dried and attached to copper stubs, coated with ~15-nm gold-palladium using a sputter coater (HITACHI E-1045) (Tokyo, Japan) [17]. The cleaned frustules were examined using a Hitachi SU 8010 SEM (2 kV) (Tokyo, Japan) and images were compiled with Adobe Photoshop CS4 (Adobe Photoshop CS4 Extended) [18].
Water temperature (WT), salinity, pH, total dissolved solids (TDS), and dissolved oxygen (DO) were measured using a YSI ProPlus multi-parameter meter (YSI, Yellow Springs, OH, USA) [16]. Water samples, which were collected from a depth of 0.5 m below the water surface, were transferred to the laboratory for determining total nitrogen (TN), total phosphorus (TP), and chemical oxygen demand (COD). These chemical samples were analyzed using Chinese standard methods [15].

2.2. Sample Isolation and Cultivation

The samples collected from the Jiuduansha Wetland National Nature Reserve (31°13′58″ N, 121°46′50″ E) were screened for isolation and cultivation. An S. potamos strain, cjh2, was isolated using a capillary method under a Nikon Ts2 inverted microscope (Nikon, Tokyo, Japan) [19]. The strain was cultured in 24-well cell plates that contained CSI medium. Cultures were kept at 24 °C under a 12:12 h (L:D) photoperiod at 62.5 μmol photons m−2 s−1 provided by cool white, fluorescent tubes. We used a semi-continuous batch culture and transferred the cultures to fresh media every four days.

2.3. DNA Extraction, PCR Amplification, and Sequencing

Monoclonal cultures of cjh2 were harvested by centrifugation at 6000 r/min for 3 min. The DNA of cjh2 was extracted using the Chelex method [20]. The extraction process was as follows: addition of 200 μL 10% Chelex-100, vortexing for 10 s, centrifugation at 13,000 r/min for 2 min, heating at 95 °C for 20 min, vortexing for 15 s, and final centrifugation at 13,000 r/min for 2 min.
Polymerase chain reaction (PCR) amplification of five genes, namely nuclear-encoded small and large subunits of the rDNA (nSSU rDNA and nLSU rDNA), mitochondrial-encoded cytochrome c oxidase I (cox1), ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL), and photosystem II CP43 protein (psbC), was performed as described by Orsini et al. (2002) [21], Theriot et al. (2011) [22], and Yamada et al. (2017) [23]. The primers used are shown in Table 1. The PCR products were sequenced by BGI Tech Corporation (Shanghai, China).

2.4. Statistical Analysis

The distribution maps of S. potamos were drawn using ESRI ArcInfo 10.8 GIS program based on the sites listed in Tables S1 and S2. SPSS was used for the Spearman correlation coefficient analysis. Box and whisker plots as well as correlation graphs were drawn using Origin 2021.
All sequences of S. potamos were downloaded from the NCBI database and aligned using Clustal W [24] in BioEdit version 7.2.1 [25]. Genetic distance analysis was conducted using MEGA v. 6.0.

3. Results

3.1. Morphological Observations of S. potamos

The frustules are cylindrical in the girdle view (Figure 1a–c). They frequently form short filaments with 2–4 cells, but both single cells and longer chains (six, eight, or ten cells) are also common. Cells are 1.3–3.0 μm in diameter and the pervalvar axis is 4.0–12.0 μm. Adjacent cells are separated by gaps ranging from 0.2 to 0.4 μm. There are one or two parietal chloroplasts per cell (Figure 1a,b).
In SEM, the valve face is flat in the center and slightly rounded near the edge (Figure 1d–f). Small granules occur on the valve face (Figure 1d,e). There are fine striae arranged in radial rows, consisting of irregular polygonal areolae and transverse branches. These heavily silicified striae are deposited onto the valve face, valve mantle, and fultoportula processes (FPPs) (Figure 1d–f). Near the margin of valves, a ring of 3–7 FPPs is situated (Figure 1f,g). FPPs are tubular externally and have root-like protrusions with truncated or cleft distal ends (Figure 1h). At the bases of FPPs, external pores are not visible, but there are three satellite pores in the internal valve view (Figure 1g,h). Two opposite frustules are linked by interleaving intercalary fultoportula processes (IFPPs) (Figure 2b). A girdle with numerous bands is also present between the two linked frustules (Figure 2a). Each valve has one rimoportula (RP) with a small external process. The rimoportula process (RPP) is short and sessile. Terminal rimoportulae (TRPs) are situated close to the ring of marginal FPPs or near the valve center, and intercalary rimoportulae (IPRs) are near the ring of FPPs (Figure 2b–d).

3.2. World Distribution of S. potamos

S. potamos is widely distributed across five continents [1] (Figure 3). Although most common in Europe, it has been detected in 72 water bodies (a total of 95 positions) in 16 countries, mainly in rivers [26,27], and also in lakes, reservoirs, and estuaries. In North America, mainly in the USA and Canada, S. potamos is widely distributed in rivers, lakes, and their estuaries, which flow into the Atlantic and Pacific Oceans (71 water bodies in total). In South America, S. potamos has been found in two water bodies (eight positions) in Brazil [28] and two water bodies in Argentina. And in Oceania, it occurs in four rivers in Australia [29]. In addition, there are some reports of S. potamos in Asia. In Japan, it has been observed in 11 water bodies, including lakes, seas, and tidal areas. Furthermore, S. potamos has been found in two rivers, five reservoirs, and Neva Bay in Russia, in addition to one occurrence in Mongolia. In China, S. potamos has previously only been reported in the Taiwan Strait [11] (for coordinates and references, see Supplementary Materials Table S1).
In this study, S. potamos was frequently found in over six years of samples collected from the Yangtze River Basin (Figure 3 and Figure 4). In total, S. potamos was found at 89 positions. In the downstream area, from the mouth of Poyang Lake (Jiangxi Province) to the Yangtze River Estuary in Shanghai, S. potamos was found at 23 sites in the mainstream. It was also found in 27 sites in the Lower Yangtze River Basin, including 13 rivers and lakes, such as Tai Lake (five sites), Dianshan Lake, and Dishui Lake. In the middle reaches of the Yangtze River Basin, there were 14 positions that had S. potamos, including six positions in Poyang Lake. In the upper reaches of the Yangtze River, from Yichang (Hubei Province) to Yibin (Sichuan Province), S. potamos was detected in seven mainstream locations and eight tributary locations. In addition, S. potamos also occurred at ten positions on the Jinsha River (the upper part of the Yangtze River). (See Supplementary Materials Table S2 for details).

3.3. Genetic Diversity

We searched almost all the sequences of five genes of S. potamos in the NCBI database. However, only 19 sequences obtained from Japan, the USA, and Hungary were found and used for genetic distance analysis. Our results suggested that the cox1 gene of strain cjh2 (GenBank accession number OP699718) was consistent with the partial sequences obtained from Japanese waterbodies (LC192721, LC192723, and LC192732). The rbcL gene obtained in this study (OP819055) was identical to the available sequence published earlier in the USA (KJ081746) but was different from the genotype obtained from Hungary (KF621301) (Table 2). These results indicated that strain AJA010-19 reported from the USA and strains FCH102, FCH106, and FIS101 reported from Japan are the closest known relatives of strain cjh2.
Genetic distance analysis based on nSSU rDNA, nLSU rDNA, and psbC showed that there are no divergence differences among the strains obtained from China, Hungary, the USA, and Japan. Accordingly, the nSSU rDNA, nLSU rDNA, and psbC of S. potamos appear to lack intraspecific variability (Table S3).

3.4. Ecology Analysis

Samples collected from the Yangtze River Basin were examined and the abundance of S. potamos was recorded. To reveal the important environmental factors that significantly affect the occurrence and abundance of S. potamos, a correlation analysis was carried out based on the ecological factors obtained from samples collected in the Yangtze River Basin. The Spearman method was selected for analysis due to the non-normal distribution of most of the ecological factors.
The correlations among the nine ecological factors were examined with emphasis on key environmental factors that are significantly related to the abundance of S. potamos. Our results indicated that the abundance of S. potamos was significantly correlated with three environmental factors (Figure 5). It was positively correlated with chemical oxygen demand (COD) (r = 0.318) and negatively correlated with water temperature (WT) (r = 0.352) and total phosphorous (TP) (r = 0.347).
We also collated the important environmental factors recorded when S. potamos was found in our samples, which are presented in the box and whisker plots (Figure 6). In China, the WT of the waterbodies where S. potamos exists ranges from 6 °C to 36 °C, and the TP ranges from 0.18 to 1.07 mg L−1. The COD of waterbodies with S. potamos ranges from 0.8 to 13.5 mg L−1. However, S. potamos also occurs in heavily polluted waterbodies, with COD values greater than 15 mg L−1. These waterbodies include Nanxing Lake and Dianshan Lake.

4. Discussion

4.1. Morphological Comparison

S. potamos specimens from the Yangtze River were similar to the type of material from the Little Miami River, Ohio, USA [6,7]. Both specimens had a knobby valve face, heavily silicified areolae, and tubular FPPs with a cleft at the distal tip. However, the Chinese specimens had a smaller frustule diameter than did specimens collected from the Little Miami River. This may be due to the influence of different environmental factors. Our analysis of previous reports on the morphology of S. potamos showed that other characteristics of S. potamos observed in China were similar to the specimens described in the literature (Table 3).
Notably, we clarified the different positions of the IRPs and TRPs in this study. We counted 40 TPRs and observed that 29 TRPs were close to the FPPs and 11 TRPs were near the center of the valve. All observed IRPs were located near the FPPs.

4.2. Possible Origin of S. potamos in China

Algal research was initiated in China in the early 20th century when many outstanding algal scholars emerged. However, there are few reports of S. potamos in China, unlike in Europe, North America, and Australia, where S. potamos was frequently found in the 1980s [9]. Until recent years, S. potamos was frequently found in our samples and it was sometimes the dominant species in the Yangtze River Basin. This suggests that S. potamos is an invasive species. Similarly, Descy et al. (2012), who studied phytoplankton diversity in the Loire River, also proposed that S. potamos was the most frequent and abundant invasive planktonic species [32].
To explore the origin of S. potamos, we downloaded all available sequences of S. potamos and conducted a genetic distance analysis. A similar method was used by Pfannkuchen et al. (2018), who revealed how Skeletonema grevillei was introduced into the Northern Adriatic Sea [33]. In the genetic analysis based on nLSU rDNA, nSSU rDNA, and psbC, we found that the distance between all sequences was zero, which indicates a lack of intraspecific variability of these three genes in S. potamos. This possibility is supported by Duleba et al. (2014), who discussed the biogeography and phylogenetic position of S. potamos and found little invariability in nLSU rDNA and nSSU rDNA [1]. In contrast, cox1 and rbcL have greater potential for the exploration of intraspecific differences. However, there are few psbC sequences for S. potamos in the NCBI database, so their applicability requires further exploration.
Genetic analysis based on cox1 and rbcL indicated genetic similarity of the Yangtze River Estuary isolates (cjh2) to isolates from the USA and Japan. Combined with the discovery history, we inferred that S. potamos probably entered the Yangtze River Estuary from Japan or the USA through the East Sea, and from there into the Yangtze River Basin. Ship traffic and the release of ballast water from ships may be responsible for the migration of S. potamos. Liu et al. (2012) reached a similar conclusion that coastal currents and the ballast water of coastal ships provided transportation for the northward expansion of Skeletonema tropicum [34].
At present, we can only propose one possible origin of S. potamos due to the limited sequence information in the NCBI database. In the future, the enrichment of S. potamos sequences could help reveal additional possibilities for the origin of S. potamos in China and its likely diffusion paths in other parts of the world.

4.3. The Diffusion Pattern and Dominant Mechanism of S. potamos in China

The Yangtze River is the Golden Waterway, with the greatest amount of cargo transportation in the Inner River around the world [35]. In the last 10 years, the Yangtze River Pilotage Center has guided over 588,000 vessels from home and abroad. In 2022, ports on the main line of the Yangtze River have dealt with 3.59 billion tons of goods. Cargo ships are possible carriers for the introduction and dispersal of S. potamos in the Yangtze River Basin.
Once introduced into the Yangtze River Basin, S. potamos needs a suitable environment for growth and reproduction. In this study, we conducted a correlation analysis of the ecological factors in the Yangtze River Basin. The results suggest that WT, TP, and COD are important environmental factors affecting the occurrence and abundance of S. potamos. Although salinity, which varies little in the Yangtze River Basin, has not been screened out, it is considered an important environmental factor due to its influence on the morphology of S. potamos. Similarly, Liu et al. (2012) also proposed that seawater temperature and salinity determine the occurrence and abundance of S. tropicum [36].
We summarized the four key environmental factors recorded in previous reports and discussed the ecological preferences of S. potamos (Table 4). In previous reports, the WT of S. potamos habitats ranged from 6 to 30 °C, which is similar to the WT of S. potamos found in the Yangtze River Basin. This indicated that the Yangtze River can provide a suitable WT for the survival of S. potamos. Regarding salinity, we realized that S. potamos is primarily distributed in freshwater and slightly brackish water and that the Yangtze River Basin is a suitable habitat for its growth and reproduction. There are few records of TP and COD in waterbodies that S. potamos inhabits, which have TP values ranging from 0.01 to 1.9 mg L−1 and COD values ranging from 2.45–19.6 mg L−1. The TP and COD in most of the water bodies inhabited by S. potamos in the Yangtze River Basin are also within these ranges.
The Yangtze River Basin appears to provide suitable living conditions for S. potamos. In addition, the small size and rapid reproduction of this species give it a competitive advantage, so that it can become the dominant species. Based on these results, we predict that S. potamos in China could form a population “bloom” in the future.

5. Conclusions

In this study—given that there were few previous reports of S. potamos in China until our research group made the recent discovery in the Yangtze River Basin—S. potamos was identified as an invasive species. Genetic distance analysis showed that one S. potamos strain from the USA and three strains from Japan were the closest known relatives of the S. potamos strain from China. Ship and ballast water transport from the USA or Japan through the East Sea into the Yangtze River Estuary would help explain the genetic similarity of the strains. A large number of cargo ships on the Yangtze River are possible carriers for the dispersal of S. potamos in China.
We summarized the ecological preferences of S. potamos based on historical reports. By screening and analyzing key ecological factors, we found that the waterbodies of China could provide environments allowing the survival and proliferation of S. potamos. The suitable environment, small size, and rapid reproduction of S. potamos give it the potential to be a dominant species and create population “blooms.”

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/w15162875/s1, Table S1: Sites used for the distribution map of S. potamos; Table S2: Detailed information on the distribution of S. potamos in the Yangtze River Basin; Table S3: Genetic distance analysis based on nSSU rDNA, nLSU rDNA, and psbC.

Author Contributions

J.H., Q.Y. and Q.W. designed the research and provided comments. J.H., P.Y., Q.Y. and Q.W. conducted the research. J.H. wrote the paper. Z.Y., Y.Y. and Z.S. assisted with experimental data. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Shanghai (No.21ZR144730).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

We thank LetPub for its linguistic assistance during the preparation of this manuscript. We would like to thank Yue Cao, Lin Yang, Meijia Cai, Bingwei Xing, Gaogang Fan, and Xinran Su for sampling and identification assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Duleba, M.; Ector, L.; Horváth, Z.; Kiss, K.T.; Molnar, L.; Pohner, Z.; Szilágyi, Z.; Tóth, B.; Vad, C.F.; Várbíró, G.; et al. Biogeography and phylogenetic position of a warm-stenotherm centric diatom, Skeletonema potamos (C.I. Weber) Hasle and its long-term dynamics in the River Danube. Protist 2014, 1655, 715–729. [Google Scholar] [CrossRef]
  2. Cheng, J.F.; Gao, Y.H.; Liang, J.R.; Chen, C.P. Research progress on species and gene diversity of Skeletonema. Prog. Nat. Sci. 2007, 17, 586–594. (In Chinese) [Google Scholar]
  3. Kiss, K.T.; Klee, R.; Ector, L.; Ács, É. Centric diatoms of large rivers and tributaries in Hungary: Morphology and biogeographic distribution. Acta Bot. Croat. 2012, 71, 311–363. [Google Scholar] [CrossRef] [Green Version]
  4. Poulin, M. A Multidisciplinary, Community-Based Study of the Environmental Health of the Rideau River: Final Report; Canadian Museum of Nature: Montréal, ON, Canada; Ottawa, ON, Canada, 2001; pp. 1–41. [Google Scholar]
  5. Hustedt, F. Die Kieselalgen Deutschlands, Österreichs und der Schweiz unter Berücksichtigung der Übrigen Länder Europas Sowie der Angrenzenden Meeresgebiete; Akademische Verlagsgesellschaft m.b.h. Leipzig: Leipzig, Germany, 1928. [Google Scholar]
  6. Hasle, G.R.; Evensen, D.L. Brackish water and freshwater species of the diatom genus Skeletonema. II. Skeletonema potamos comb. nov. J. Phycol. 1976, 12, 73–82. [Google Scholar] [CrossRef]
  7. Weber, C.I. A new freshwater centric diatom Microsiphona potamos gen. et sp. nov. J. Phycol. 1970, 6, 149–153. [Google Scholar] [CrossRef]
  8. Heudre, D.; Wetzel, C.E.; Vijver, B.V.D.; Moreau, L.; Ector, L. Brackish diatom species (Bacillariophyta) from rivers of Rhin-Meuse basin in France. Bot. Lett. 2020, 168, 56–84. [Google Scholar] [CrossRef]
  9. Torgan, L.C.; Becker, V.; Santos, C.B.D. Skeletonema potamos (Bacillariophyta) in Patos Lagoon, southern Brazil: Taxonomy and distribution. Rev. Peru. Biol. 2011, 16, 93–96. [Google Scholar]
  10. Cheng, Z.D.; Liu, S.C. A taxonomy study of Skeletonema Greville from Xiamen Harbour, China. J. Xiamen Univ. (Nat. Sci.) 1992, 31, 295–297. (In Chinese) [Google Scholar]
  11. Lin, G.; Yang, Q. Species diversity and the distribution of micro-phytoplankton in the Taiwan Strait. Biodivers. Sci. 2007, 15, 31–45. (In Chinese) [Google Scholar]
  12. Zhang, L.J.; Yang, J.H.; Zhang, Y.; Shi, J.Z.; Yu, H.X.; Zhang, X.W. eDNA biomonitoring revealed the ecological effects of water diversion projects between Yangtze River and Tai Lake. Water Res. 2022, 210, 117994. [Google Scholar] [CrossRef]
  13. Zhao, K.; Cao, Y.; Pang, W.T.; Wang, L.Z.; Song, K.; You, Q.M.; Wang, Q.X. Long-term plankton community dynamics and influencing factors in a man-made shallow lake, Lake Dishui, China. Aquat. Sci. 2021, 83, 1–14. [Google Scholar] [CrossRef]
  14. Hu, H.J.; Wei, Y.X. The Freshwater Algae of China Systematics, Taxonomy and Ecology; Sciences Press: Beijing, China, 2006. (In Chinese) [Google Scholar]
  15. Zhao, K.; Wang, L.Z.; You, Q.M.; Pan, Y.D.; Liu, T.T.; Zhou, Y.D.; Zhang, J.Y.; Pang, W.T.; Wang, Q.X. Influence of Cyanobacterial blooms and environmental variation on zooplankton and eukaryotic phytoplankton in a Large, Shallow, Eutrophic Lake in China. Sci. Total Environ. 2021, 773, 145421. [Google Scholar] [CrossRef] [PubMed]
  16. Yang, L.; Yu, P.; You, Q.M.; Li, G.S.; Wang, Q.X. Morphological and phylogenetic analysis of a new Melosira species and revision of freshwater Melosira in China. J. Oceanol. Limnol. 2021, 40, 712–728. [Google Scholar] [CrossRef]
  17. Luo, F.; You, Q.M.; Wang, Q.X. A new species of Genkalia (Bacillariophyta) from mountain lakes within the Sichuan Province of China. Phytotaxa 2018, 372, 236–242. [Google Scholar] [CrossRef]
  18. Yu, P.; You, Q.M.; Kociolek, J.P.; Lowe, R.L.; Wang, Q.X. Nupela major sp. nov., a new diatom species from Maolan Nature Reserve, central-south of China. Phytotaxa 2017, 311, 245–254. [Google Scholar] [CrossRef]
  19. Jiang, X.D.; Chen, X.; Pang, W.T.; Wang, Q.X. Phylogeny of Trachelomonas and Strombomonas (Euglenaceae) based on morphological and molecular data. Diversity 2022, 14, 623. [Google Scholar] [CrossRef]
  20. Richlen, M.L.; Barber, P.H. A technique for the rapid extraction of microalgal DNA from single live and preserved cells. Mol. Ecol. Notes 2005, 5, 688–691. [Google Scholar] [CrossRef]
  21. Orsini, L.; Sarno, D.; Procaccini, D.; Poletti, R.; Dahlmann, J.; Montresor, M. Toxic Pseudo-nitzschia multistriata (Bacillariophyceae) from the Gulf of Naples: Morphology, toxin analysis and phylogenetic relationships with other Pseudo-nitzschia species. Eur. J. Phycol. 2002, 37, 247–257. [Google Scholar] [CrossRef]
  22. Theriot, E.C.; Ruck, E.C.; Ashworth, M.; Nakov, T.; Jansen, R.K. Status of the pursuit of the diatom phylogeny: Are traditional views and new molecular paradigms really that different? Cell. Orig. Life Extrem. Habitats Astrobiol. 2011, 19, 119–142. [Google Scholar]
  23. Yamada, M.; Otsubo, M.; Tsutsumi, Y.; Mizota, C.; Nakamura, Y.; Takahashi, K.; Iwataki, M. Utility of mitochondrial-encoded cytochrome coxidase I gene for phylogenetic analysis and species identification of the planktonic diatom genus Skeletonema. Physiol. Res. 2017, 66, 217–225. [Google Scholar]
  24. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The Clustal_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Hall, T.A. Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  26. Belcher, J.H.; Swale, E.M.F. Skeletonema potamos (Weber) Hasle and Cyclotella atomus Hustedt (Bacillariophyceae) in the plankton of rivers in England and France. Br. Phycol. J. 1978, 13, 177–182. [Google Scholar] [CrossRef] [Green Version]
  27. Steinberg, C.; Heindel, B.; Tille-Backhaus, R. Phytoplanktonstudien an langsamfließenden Gewässern: Donau und Vils. Arch. Für Hydrobiol. 1987, 68, 437–456. [Google Scholar]
  28. Bergesch, M.; Garcia, M.; Odebrecht, C. Diversity and morphology of Skeletonema species in Southern Brazil, Southwestern Atlantic Ocean. J. Phycol. 2009, 45, 1348–1352. [Google Scholar] [CrossRef]
  29. Chessman, B.C. Phytoplankton of the La Trobe River, Victoria. Aust. J. Mar. Freshw. Res. 1985, 36, 115–122. [Google Scholar] [CrossRef]
  30. Kiss, K.T.; Ács, É.; Kovács, A. Ecological observations on Skeletonema potamos (Weber) Hasle in the River Danube, near Budapest (1991–92, daily investigations). Hydrobiologia 1994, 289, 163–170. [Google Scholar]
  31. Cavalcante, K.P.; Tremarin, P.I.; Ludwig, T.A. Taxonomic studies of centric diatoms (Diatomeae): Unusual nanoplanktonic forms and new records for Brazil. Acta Bot. Bras. 2013, 27, 327–351. [Google Scholar] [CrossRef] [Green Version]
  32. Descy, J.; Leitão, M.; Everbecq, E.; Smitz, J.; Deliege, J. Phytoplankton of the River Loire, France: A biodiversity and modelling study. J. Plankton Res. 2012, 34, 120–135. [Google Scholar] [CrossRef] [Green Version]
  33. Pfannkuchen, D.M.; Godrijan, J.; Tanković, M.S.; Baričević, A.; Kužat, N.; Djakovac, T.; Pustijanac, E.; Jahn, R.; Pfannkuchen, M. The ecology of one cosmopolitan, one newly introduced and one occasionally advected species from the Genus Skeletonema in a highly structured ecosystem, the Northern Adriatic. Environ. Microbiol. 2018, 75, 674–687. [Google Scholar] [CrossRef]
  34. Liu, D.Y.; Jiang, J.J.; Wang, Y.; Zhang, Y.; Di, B.P. Large scale northward expansion of warm water species Skeletonema tropicum (Bacillariophyceae) in China seas. Chin. J. Oceanol. Limnol. 2012, 30, 519–527. [Google Scholar] [CrossRef] [Green Version]
  35. Du, L.N.; Zhang, J.B. The cooperation relationship study on the Golden Waterway of the Yangtze River and economic development along the Yangtze River. AIP Conf. Proc. 2017, 1890, 040021. [Google Scholar]
  36. Yamada, M.; Otsubo, M.; Tsutsumi, Y.; Mizota, C.; Iida, N.; Okamura, K.M.; Umehara, A. Species diversity of the marine diatom genus Skeletonema in Japanese brackish water areas. Fish. Sci. 2013, 79, 923–934. [Google Scholar] [CrossRef]
  37. Numazawa, A. Relationship between Productivity and Transparency Fall Discovered in Water Quality Monitoring and Plankton Analysis in Lake Kasumigaura Ecosystem. In Proceedings of the 11th World Lake Conference, Nairobi, Kenya, 31 October–4 November 2005; Odada, E.O., Olago, D.O., Ochola, W., Ntiba, M., Wandiga, S., Gichuki, N., Oyieke, H., Eds.; Ministry of Water and Irrigation, Kenya, ILEC: Nairobi, Kenya, 2005; pp. 297–300. [Google Scholar]
  38. Main, S.P. Benthic diatom distribution in the Cedar River Basin, Iowa. Proc. Iowa Acad. Sci. 1977, 84, 23–29. [Google Scholar]
  39. Sabater, S.; Muñoz, I. Successional dynamics of the phytoplankton in the lower part of the river Ebro. J. Plankton Res. 1990, 12, 573–592. [Google Scholar] [CrossRef]
  40. Chang, T.P.; Steinberg, C. Seasonal changes in the diatom flora in a small reservoir with special reference to Skeletonema potamos. Diatom Res. 1988, 3, 191–201. [Google Scholar] [CrossRef]
  41. Mihaljević, M.; Špoljarić, D.; Stević, F.; Pfeiffer, T.Ž. Assessment of flood-induced changes of phytoplankton along a river–floodplain system using the morpho-functional approach. Environ. Monit. Assess. 2013, 185, 8601–8619. [Google Scholar] [CrossRef] [PubMed]
  42. Pérez, M.C.; Maidana, N.I.; Comas, A. Phytoplankton composition of the Ebro River estuary, Spain. Acta Bot. Croat. 2009, 68, 11–27. [Google Scholar]
  43. Hamilton, P.B.; Lavoie, I.; Ley, L.M.; Poulin, M. Factors contributing to the spatial and temporal variability of phytoplankton communities in the Rideau River (Ontario, Canada). River Syst. 2011, 19, 189–205. [Google Scholar] [CrossRef]
  44. Admiraal, W.; Breebaart, L.; Tubbing, G.M.; Zanten, B.V.; Steveninck, E.D.; Bijkerk, R. Seasonal variation in composition and production of planktonic communities in the lower River Rhine. Freshw. Biol. 1994, 32, 519–531. [Google Scholar] [CrossRef]
  45. Lomas, M.W.; Glibert, P.M. Temperature regulation of nitrate uptake: A novel hypothesis about nitrate uptake and reduction in cool-water diatoms. Limnol. Oceanogr. 1999, 44, 556–572. [Google Scholar] [CrossRef]
  46. Cloern, J.E.; Dufford, R. Phytoplankton community ecology: Principles applied in San Francisco Bay. Mar. Ecol. Prog. 2005, 285, 11–28. [Google Scholar] [CrossRef]
  47. Gosselain, V.; Descy, J.P.; Everbecq, E. The phytoplankton community of the River Meuse, Belgium:seasonal dynamics (year 1992) and the possible incidence of zooplankton grazing. Hydrobiologia 1994, 289, 179–191. [Google Scholar] [CrossRef]
  48. Devercelli, M.; Farrell, I.O. Factors affecting the structure and maintenance of phytoplankton functional groups in a nutrient rich lowland river. Limnologica 2013, 43, 67–78. [Google Scholar] [CrossRef]
  49. Devercelli, M. Phytoplankton of the Middle Paraná River during an anomalous hydrological period: A morphological and functional approach. Hydrobiologia 2006, 563, 465–478. [Google Scholar] [CrossRef]
  50. Lehman, P.W.; The, S.J.; Boyer, G.L.; Nobriga, M.L.; Bass, E.; Hogle, C. Initial impacts of Microcystis aeruginosa blooms on the aquatic food web in the San Francisco Estuary. Hydrobiologia 2010, 637, 229–248. [Google Scholar] [CrossRef] [Green Version]
  51. Brown, L.R.; May, J.T. Periphyton and Macroinvertebrate Communities at Five Sites in the San Joaquin River Basin, California, during June and September, 2001; US Geological Survey: Reston, Virginia, 2004. [Google Scholar]
  52. Lehman, P.W. The influence of phytoplankton community composition on primary productivity along the riverine to freshwater tidal continuum in the San Joaquin River, California. Estuar Coast 2007, 30, 82–93. [Google Scholar] [CrossRef]
  53. Tavernini, S.; Pierobon, E.; Viaroli, P. Physical factors and dissolved reactive silica affect phytoplankton community structure and dynamics in a lowland eutrophic river (Po river, Italy). Hydrobiologia 2011, 669, 213–225. [Google Scholar] [CrossRef]
  54. Čađo, S.; Miletić, A.; Dopuđa-Glišić, T.; Denić, L. Physical-Chemical Characteristics and Phytoplankton Composition of the Sava River on Its Lower Flow Stretch through Serbia. In Proceedings of the 36th International Conference of IAD, Klosterneuburg, Austria, 4–8 September 2006; Austrian Committee DanubeResearch/IAD Vienna: Vienna, Austria, 2006; pp. 184–188. [Google Scholar]
  55. Marshall, H.G.; Alden, R.W. A comparison of phytoplankton assemblages and environmental relationships in three estuarine rivers of the Lower Chesapeake Bay. Estuaries 1990, 13, 287–300. [Google Scholar] [CrossRef]
Water 15 02875 g001
Figure 1. General morphology of S. potamos. LM: (a–c), colonies, scale bars, 5 μm. SEM: (d–h), scale bars, 1 μm (d,e,g,h); 0.5 μm (f). (d) Terminal valve with heavily silicified areolae; (e) valve face with fine striae and small granules in valve view; (f,h) FPPs with root-like protrusions, truncated or cleft margin and tubular externally without pores at their bases; (g) three satellite pores of FPPs and one RP in the external valve view; (h) the opposite frustules linked by interleaving IFPPs.
Figure 1. General morphology of S. potamos. LM: (a–c), colonies, scale bars, 5 μm. SEM: (d–h), scale bars, 1 μm (d,e,g,h); 0.5 μm (f). (d) Terminal valve with heavily silicified areolae; (e) valve face with fine striae and small granules in valve view; (f,h) FPPs with root-like protrusions, truncated or cleft margin and tubular externally without pores at their bases; (g) three satellite pores of FPPs and one RP in the external valve view; (h) the opposite frustules linked by interleaving IFPPs.
Water 15 02875 g001
Water 15 02875 g002
Figure 2. Girdle bands and RPs of S. potamos. (a) The structure of girdle bands; (b) the IRPs located near the ring of marginal FPPs (arrowhead); (c,d) the TRPs located at the edge of the valve (arrowhead) or near the valve center (arrowhead). Scale bars, 1 μm.
Figure 2. Girdle bands and RPs of S. potamos. (a) The structure of girdle bands; (b) the IRPs located near the ring of marginal FPPs (arrowhead); (c,d) the TRPs located at the edge of the valve (arrowhead) or near the valve center (arrowhead). Scale bars, 1 μm.
Water 15 02875 g002
Water 15 02875 g003
Figure 3. Map of S. potamos worldwide distribution. The rectangle indicates the distribution of S. potamos in the Yangte River Basin observed in this study.
Figure 3. Map of S. potamos worldwide distribution. The rectangle indicates the distribution of S. potamos in the Yangte River Basin observed in this study.
Water 15 02875 g003
Water 15 02875 g004
Figure 4. Distribution map of S. potamos in the Yangtze River Basin.
Figure 4. Distribution map of S. potamos in the Yangtze River Basin.
Water 15 02875 g004
Water 15 02875 g005
Figure 5. Spearman correlation analysis among ecological factors. WT, water temperature; Sal, salinity; DO, dissolved oxygen; TDS, total dissolved solids; TP, total phosphorous; TN, total nitrogen; COD, chemical oxygen demand; AB, the abundance of S. potamos. The circle size represents the degree of correlation. Black stars mean value, *: p < 0.05, **: p < 0.01.
Figure 5. Spearman correlation analysis among ecological factors. WT, water temperature; Sal, salinity; DO, dissolved oxygen; TDS, total dissolved solids; TP, total phosphorous; TN, total nitrogen; COD, chemical oxygen demand; AB, the abundance of S. potamos. The circle size represents the degree of correlation. Black stars mean value, *: p < 0.05, **: p < 0.01.
Water 15 02875 g005
Water 15 02875 g006
Figure 6. Box and whisker plots for environmental parameters. WT, TP, and COD were recorded in samples when S. potamos were observed. The top and the bottom of the boxes represent the 25th and 75th percentiles. Solid lines show the median and the dotted lines show the mean; the dots represent outliers.
Figure 6. Box and whisker plots for environmental parameters. WT, TP, and COD were recorded in samples when S. potamos were observed. The top and the bottom of the boxes represent the 25th and 75th percentiles. Solid lines show the median and the dotted lines show the mean; the dots represent outliers.
Water 15 02875 g006
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Gene MarkersPrimers NamesPrimers Sequences (5′–3′)
cox1FdGGAACTTTATATTTAATCTTTGGTGC
1047RAATACCAGAATTAGCAAGAACAAC
424FGCGTCTTCTATTTTAGGTG
644RGGATCACCTCCACCACCAGC
nLSU rDNAD1RACCCGCTGAATTTAAGCATA
D2CCCTTGGTCCGTGTTTCAAGA
nSSU rDNA11FTGATCCTGCCAGTAGTCATACGCT
1147RAGTTTCAGCCTTGCGACCATAC
rbcL66FTTAAGGAGAAATAAATGTCTCAATCTG
1255RTTGGTGCATTTGACCACAGT
psbC22FCGTGGTGATACATAGTTA
1154RGCDCATGCTGGTTTAATGG
Table 2. Genetic distance analysis based on cox1 and rbcL.
Table 2. Genetic distance analysis based on cox1 and rbcL.
cox11234567
1 LC192721 FCH102 (Japan) 0.0000.0010.0010.0010.0000.000
2 LC192723 FCH106 (Japan)0.000 0.0010.0010.0010.0000.000
3 AB706249 FCH024 (Japan)0.0010.001 0.0000.0020.0010.001
4 LC192720 FCH101 (Japan)0.0010.0010.000 0.0020.0010.001
5 LC192731 FCH159 (Japan)0.0020.0020.0030.003 0.0010.001
6 LC192732 FIS101 (Japan)0.0000.0000.0010.0010.002 0.000
7 OP699718 cjh2 (China)0.0000.0000.0010.0010.0020.000
rbcL123
1 KJ081746 AJA010-19 (USA) 0.0010.000
2 KF621301 (Hungary)0.001 0.001
3 OP819055 cjh2 (China)0.0000.001
Bold words represent the strain cultured in this study.
Table 3. Features of S. potamos observed in Yangtze River Basin and previously reported in the literature.
Table 3. Features of S. potamos observed in Yangtze River Basin and previously reported in the literature.
ChloroplastFrustule
Diameter (µm)		Pervalvar
Axis (µm)		Distance between Cells (µm)Number of FPPsRP
Observed1–21.3–34–120.2–0.43–61
Weber (1970) [7]several3–44–8—5–8—
Hasle and Evensen (1976) [6]1–2 (4)3–4——6–81
Belcher and Swale (1978) [25]1–23–46–100, >15–61
Torgan et al. (2009) [9]1–23–4, 56–10—5–71
Kiss et al. (2012) [30]—3–6.55–18—3–81
Cavalcante et al. (2013) [31]—2.4–3.64.4–7.3short4–81
—: no data.
Table 4. Four key environmental factors recorded in previous reports.
Table 4. Four key environmental factors recorded in previous reports.
LocationWT
(°C)		Sal
(psu)		TP
(mg L−1)		COD
(mg L−1)		Reference
Tidal area of the Chikugo River (Japan)28.2 13.0 ——Yamada et al., 2013 [36]
Lake Kasumigaura (Japan)11.0–18.0 (D)—0.05–0.175 (D)5–7 (D)Numazawa, 2005 [37]
Cedar River Basin (USA)11.0–16.0—0.9–1.9—Main, 1977 [38]
Patos Lagoon (Brazil)19.0 4.0 ——Bergesch et al., 2009 [28]
River Ebro (Spain)28.0 ———Sabater and Muñoz, 1990 [39]
River Rott-Postmünster (Germany)17.7–19.8———Chang and Steinberg, 1988 [40]
River Cachoeira (Brazil)24.6 (M)———Cavalcante et al., 2013 [31]
Patos Lagoon (southern Brazil)14.0–24.00.0–7.2——Lezilda et al., 2011 [9]
River Danube, near Budapest (Hungary)14.0–25.0———Kiss et al., 1994 [30]
River Danube at Göd (Hungary) 14.9–27.0———Duleba et al., 2014 [1]
River Danube (Croatia)8.0–23.0———Mihaljević et al., 2013 [41]
Little Miami River (OH, USA)6.0–29.0—0.455 —Weber, 1970 [7]
Estuary of the River Ebro (Spain)9.8–27.32.3–5.1——Pérez et al., 2009 [42]
Rideau River (ON, Canada)11.9–26.8—0.037—Hamilton et al., 2011 [43]
River Rhine (Netherlands)—0.2–0.9——Admiraal et al., 1994 [44]
Chesapeake Bay (Virginia, USA)14.1 ———Lomas and Glibert, 1999 [45]
San Francisco Bay (CA, USA)17.0–22.00.0–5.0——Cloern and Dufford, 2005 [46]
River Meuse at Namur (Belgium)12.0–22.0 (D)———Gosselain et al., 1994 [47]
Salado River, El Vado stream (Argentina)11.0–30.0—0.52–0.63—Devercelli and Farrell., 2013 [48]
Parana’ River (Argentina)12.0–29.0———Devercelli, 2006 [49]
Suisun Bay (USA)21.5———Lehman et al., 2010 [50]
San Joaquin River (CA, USA)24.4–25.6———Brown and May, 2004 [51]
San Joaquin River (CA, USA)21.0–25.5—0.14 —Lehman, 2007 [52]
Po River (Italy)——0.302 —Tavernini et al., 2011 [53]
Sava River (Republic of Serbia)——0.067–0.0922.45–3.45Čađo et al., 2006 [54]
Moselle River (France)——0.1 19.6 Heudre et al., 2020 [8]
Estuary of River York (VA, USA)——0.01–0.13—Marshall et al., 1990 [55]
—: no record; D: the value of ecological factors when S. potamos is the dominant species; M: the mean value of ecological factors in the water bodies where S. potamos was found.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, J.; Yang, Z.; Yi, Y.; Shu, Z.; Yu, P.; You, Q.; Wang, Q. Possible Origin and Distribution of an Invasive Diatom Species, Skeletonema potamos, in Yangtze River Basin (China). Water 2023, 15, 2875. https://doi.org/10.3390/w15162875

AMA Style

Hu J, Yang Z, Yi Y, Shu Z, Yu P, You Q, Wang Q. Possible Origin and Distribution of an Invasive Diatom Species, Skeletonema potamos, in Yangtze River Basin (China). Water. 2023; 15(16):2875. https://doi.org/10.3390/w15162875

Chicago/Turabian Style

Hu, Jingwen, Zhengxin Yang, Yuxin Yi, Zhaoqing Shu, Pan Yu, Qingmin You, and Quanxi Wang. 2023. "Possible Origin and Distribution of an Invasive Diatom Species, Skeletonema potamos, in Yangtze River Basin (China)" Water 15, no. 16: 2875. https://doi.org/10.3390/w15162875

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop